Download Supplementary Materials for: “The Clathrin-Binding Domain

Supplementary Materials for: “The Clathrin-Binding Domain of CALM-AF10 Alters the
Phenotype of Myeloid Neoplasms in Mice.” by Stoddart et. al.
Supplementary Methods
FRET Analysis.
Acceptor FRET imaging experiments were performed on a Leica SP2 confocal
microscope (Leica Microsystems). The acceptor photobleaching module of the Leica software
was used for the acceptor photobleaching FRET assay. The 405-nm laser line was used to excite
CFP and the 514-nm laser line was used to excite and bleach YFP. A region containing
aggregates that expressed both CALM2091AF10-CFP and CALM2091AF10-YFP with similar
levels of expression was selected for bleaching. The Leica confocal software was configured to
achieve a 50% bleach of YFP. Within bleached regions, regions of interest (ROI) were drawn
around CALM2091AF10 aggregates. FRET efficiency was calculated as follows: FRETeff =
(Dpost − Dpre)/Dpost for all Dpost > Dpre, where Dpre and Dpost represent donor fluorescence
intensity before and after photobleaching, respectively. The average FRET efficiency of
unbleached ROIs (3.5%) served as a negative control. Within bleached zones, only FRET
efficiencies > 3.5% were considered positive. At least 8 different cells were examined for the
presence of FRET signals in each experiment, and a total of 147 and 97 ROIs within bleached
and non-bleached areas, respectively, were used to calculate average percent FRET and average
FRET efficiencies. For donor FRET, the CFP excitation wavelength on the Olympus IX 70
microscope was used for bleaching and images, with a time-lapse interval set at 3 frames, was
captured using the Metamorph software. ROIs were selected and the resulting decay curves were
fitted to the equation for a single exponential decay with offset using Image J. Fluorescence
intensity (y)=a-bx + c, where “a” denotes the starting value, “c” (offset) denotes the final
fluorescence signal, “b” is the decay constant and “x” denotes a relative value defined by
iterations of bleaching procedures. A smaller decay constant, compared to CFP alone control,
represents slower decay and indicates that FRET has occurred.
Preparation of Clathrin-coated vesicles.
Clathrin-coated vesicles were isolated by a differential centrifugation method adapted
from Chakrabarti, et al (J Cell Biol. 1993;123:79-87). Briefly, cells were homogenized by three
freeze-thaws in a 100mM 2-N-morpholino ethanesulfonic acid (MES) buffer with 1mM EGTA,
0.5mM MgCl2, 0.02%NaN3, 50mM NaF, 1mM Phenanthroline, 10 µg/ml pepstatin, aprotinin,
and leupeptin, pH 6.5. After removal of cellular debris, crude membrane structures were isolated
by centrifugation (100,000 g). The crude membrane pellet was resuspended in an equal volume
of a ficoll/sucrose solution (12.5% wt/vol), centrifuged at 28,000g to pellet aggregated
membrane and cytoskeleton components, and the supernatant diluted with five volumes of MES
buffer and centrifuged at 100,000g to obtain a pellet of ~80% pure coated vesicles.
Transferrin Uptake
To monitor transferrin uptake by flow cytometry, CA cell lines were incubated with 10
g/ml Alexa Fluor 647 conjuated-transferrin for 15 minutes to allow binding and then incubated
at 37C for 0-30 minutes to allow internalization. Transferrin remaining on the cell surface was
removed by a mild acid wash (0.2M acetic acid, 0.5M NaCl) and the intensity of the Alexa Fluor
647 fluorophore was measured to monitor internalization of transferrin. To monitor transferrin
uptake by immunofluorescence, 293T cells were transiently transfected with CALM-AF10-GFP
or control constructs. Twenty-four hours later, cells were grown on coverslips overnight, then
incubated with 10 g/ml Texas Red conjuated-transferrin for 15 min at 37 C, washed in PBS
and mounted for microscopy. Transferrin uptake in GFP+ cells was monitored by
immunofluorescence.
Microarray analysis
We used Stat60 (Tel-Test) to isolate RNA from GFP+ sorted spleen cells isolated from
mice with AML or MPD that were transplanted with cells expressing CALM2091AF10 or
CALM1926AF10, respectively. RNA was purified with the RNeasy Mini Kit (Qiagen), and
hybridized to standard Affymetrix 430 2.0 mouse genome arrays. Raw data were normalized
with the RMA algorithm implemented in the “Expression File Creator” module from the Gene
Pattern Software Package (http://www.broad.mit.edu/cancer/software/genepattern/). The
Comparative Marker Selection module was used to identify differentially expressed genes
between the two groups. For each gene, the Comparative Marker Selection module uses a test
statistic to calculate the difference in gene expression between the two classes, estimates the
significance (P-value) of the test statistic score, and then sorts the genes based on the value of
their test statistic scores. A derived dataset of the highest scoring 200 genes (referred to as
RANK) was created and viewed using the Heat Map Viewer. Analysis of differentially
expressed genes, with a P value <0.05, identified 112 probe sets, corresponding to 87 genes that
were significantly under-expressed in CALM2091AF10+ AMLs compared to CALM1926AF10+
MPDs, whereas only 31 probe sets, corresponding to 28 genes, were significantly over-expressed
in AML samples.
Transfection of small interfering RNA (siRNA).
To knock-down CALM-AF10 (human sequence), siRNA target sequences specific for
human AF10 were used, as they did not cross-react with mouse AF10. Two clathrin heavy chain
(CLTC) pools were: siGenome SMARTpool M-063954-01-0005 specific for mouse CLTC and
siGenome SMARTpool M-004001-00-0005 designed for human CLTC, but cross-reactive with
mouse. The siGenome non-targeting siRNA #2 was used as a control. All siRNAs were
purchased from Thermo Scientific.
AF10-1st: AGGUAAUGGUGCCGAUAAUUU
AF10-2nd: AGAUAAUGCAAGUCAGAAA
D-0636954-01, mouse CLTC: CAACUUAGCUGGUGCUGAA
D-0636954-02, mouse CLTC: UAGAGGAGCUUAUCAACUA
D-0636954-03, mouse CLTC: UCACAGAGCUAGCUAUUUU
D-0636954-04, mouse CLTC: GAUCAUCAAUUACCGUACA
D-004001-01, ‘human’ CLTC: GAAAGAAAUCUGUAGAGAAA
D-004001-02, ‘human’ CLTC: GCAAUGAGCUGUUUGAAGA
D-004001-03, ‘human’ CLTC: UGACAAAGGUGGAUAAAUU
D-004001-04, ‘human’ CLTC: GGAAAUGGAUCUCUUUGAA
Non-targeting siRNA #2: GGAUCUGGCCAGCUUUGAU
Supplementary Figure Legends
Figure S1. CALM2091AF10 co-localizes with clathrin in the cytoplasm, but not in the
nucleus in 293T cells.
293T cells were transiently transfected with expression constructs of CALM-AF10 fused to GFP.
Cells were left untreated or treated with 20 nM leptomycin B to block nuclear export, where
indicated. Expressed fusion proteins were detected by GFP fluorescence, nuclei were visualized
by DAPI staining, and clathrin was detected by immuno-staining with the monoclonal anticlathrin antibody, X22, followed by rhodamine-red conjugated donkey anti-mouse IgG. Original
magnification  787.5 for all panels.
Figure S2. Variable expression of CALM-AF10 in leukemic mice, regardless of CALM
breakpoint. RNA was isolated from CALM-AF10+ Ba/F3 cells or CALM-AF10+ spleen cells
from leukemic mice (CALM2091AF10 mice n=4; CALM1926AF10 mice n=3). CALM-AF10+
expression levels were quantified by real-time PCR, using forward primers that spanned the
CALM2091AF10 or CALM1926AF10 breakpoints with a reverse primer in exon 6 of AF10.
Expression levels were calculated from standard curves with known amounts of CALM2091AF10
or CALM1926AF10 plasmid DNA and normalized to Gapdh expression. Error bars represent
experimental triplicates for each sample. Relative quantification reveals that neither CALMAF10 fusion construct was expressed at consistently higher levels.
Figure S3. Analysis of gene expression of immediate target genes following CALM-AF10
expression. E 14.5 day fetal liver progenitors isolated from C57Bl/6 mice were infected with
retroviral vectors expressing either CALM2091AF10 or CALM1926AF10. Cells were sorted for
GFP-positivity, and grown in IL-3, IL-6, and SCF in vitro for a total of 10-12 days post initial
infection. RNA was isolated, cDNA was generated and real-time PCR was performed by
standard methods. (A) Expression of CALM2091AF10 or CALM1926AF10 was confirmed in four
independent experiments. (B) Relative gene expression after enforced expression of CALMAF10 fusions or MIGR1 is shown. CALM-AF10 expression resulted in changes in the
expression of genes associated with myeloid differentiation (Csf1r, Itgam, Kit) relative to
MIGR1 controls. Other changes originally observed in MPD vs. AML cells (e.g., Klf9, Pim1,
Crebbp) were not observed in progenitor cells expressing CALM-AF10 for a short, defined
period suggesting, that events secondary to CALM-AF10 expression caused these changes.
Figure S4. Histological analysis of CALM-AF10+ cell lines. To generate cell lines, GFP+ cells
were sorted from the spleen of mice with AML or MPD, and plated in methylcellulose with IL-3,
IL-6 and SCF. Ten days later, individual colonies were selected and grown in liquid cultures
containing IL-3. Wright-Giemsa staining of cytospins is shown. These cells displayed an
immature myeloid phenotype; however, some mature neutrophils were observed for the lines
CA2091-CL2 and CA1926-CL1.
Figure S5. CALM2091AF10 localizes to nucleus of interphase cells and co-localizes with
clathrin in metaphase cells in a CALM-AF10+ leukemia cell line. (A) Immunofluorescence
images of CA2091-CL1 cells were stained with an anti-FLAG antibody and DAPI and captured
in different planes. CALM2091AF10 aggregates localize throughout the volume of the nucleus,
and can only be found infrequently in the cytoplasm, as shown by the white arrow. The antiCALM antibody detects punctate CALM2091AF10 in the nucleus as well as endogenous CALM
at the plasma membrane. (B) Co-staining of CALM2091AF10 (flag antibody) and clathrin
(clathrin heavy chain antibody) in representative interphase and metaphase CA2091-CL1 cells.
CALM2091AF10 and clathrin co-localize only in metaphase cells.