Download Exome sequencing identified RPS15A as a novel

Published Ahead of Print on December 1, 2016, as doi:10.3324/haematol.2016.153932.
Copyright 2016 Ferrata Storti Foundation.
Exome sequencing identified RPS15A as a novel causative gene
for Diamond-Blackfan anemia
by Fumika Ikeda, Kenichi Yoshida, Tsutomu Toki, Tamayo Uechi, Shiori Ishida,
Yukari Nakajima, Yoji Sasahara, Yusuke Okuno, Rika Kanezaki, Kiminori Terui,
Takuya Kamio, Akie Kobayashi, Takashi Fujita, Aiko Sato-Otsubo, Yuichi Shiraishi,
Hiroko Tanaka, Kenichi Chiba, Hideki Muramatsu, Hitoshi Kanno, Shouichi Ohga,
Akira Ohara, Seiji Kojima, Naoya Kenmochi, Satoru Miyano, Seishi Ogawa, and Etsuro Ito
Haematologica 2016 [Epub ahead of print]
Citation: Ikeda F, Yoshida K, Toki T, Uechi T, Ishida S, Nakajima Y, Sasahara Y, Okuno Y, Kanezaki R,
Terui K, Kamio T, Kobayashi A, Fujita T, Sato-Otsubo A, Shiraishi Y, Tanaka H, Chiba K, Muramatsu H,
Kanno H, Ohga S, Ohara A, Kojima S, Kenmochi N, Miyano S, Ogawa S, and Ito E.
Exome sequencing identified RPS15A as a novel causative gene for Diamond-Blackfan anemia.
Haematologica. 2016; 101:xxx
doi:10.3324/haematol.2016.153932
Publisher's Disclaimer.
E-publishing ahead of print is increasingly important for the rapid dissemination of science.
Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that
have completed a regular peer review and have been accepted for publication. E-publishing
of this PDF file has been approved by the authors. After having E-published Ahead of Print,
manuscripts will then undergo technical and English editing, typesetting, proof correction and
be presented for the authors' final approval; the final version of the manuscript will then
appear in print on a regular issue of the journal. All legal disclaimers that apply to the
journal also pertain to this production process.
Exome sequencing identified RPS15A as a novel causative gene for
Diamond-Blackfan anemia
Fumika Ikeda1, Kenichi Yoshida2,3, Tsutomu Toki1, Tamayo Uechi4, Shiori Ishida4, Yukari
Nakajima4, Yoji Sasahara5, Yusuke Okuno2,6, Rika Kanezaki1, Kiminori Terui1, Takuya
Kamio1, Akie Kobayashi1, Takashi Fujita1, Aiko Sato-Otsubo2,3, Yuichi Shiraishi7, Hiroko
Tanaka7, Kenichi Chiba7, Hideki Muramatsu6, Hitoshi Kanno9, Shouichi Ohga10, Akira
Ohara11, Seiji Kojima6, Naoya Kenmochi4, Satoru Miyano7,8, Seishi Ogawa2,3 and Etsuro
Ito1
1
Department of Pediatrics, Hirosaki University Graduate School of Medicine, Hirosaki,
Japan
2
Cancer Genomics Project, Graduate School of Medicine, The University of Tokyo,
Tokyo, Japan
3
Department of Pathology and Tumor Biology, Graduate School of Medicine, Kyoto
University, Kyoto, Japan
4
Frontier Science Research Center, University of Miyazaki, Miyazaki, Japan
5
Department of Pediatrics, Tohoku University Graduate School of Medicine, Sendai,
Japan
6
Department of Pediatrics, Nagoya University Graduate School of Medicine, Nagoya,
Japan
7
Laboratory of DNA Information Analysis, Human Genome Center, Institute of Medical
Science, The University of Tokyo, Tokyo, Japan
8
Laboratory of Sequence Analysis, Human Genome Center, Institute of Medical Science,
The University of Tokyo, Tokyo, Japan
9
Department of Transfusion Medicine and Cell Processing, Tokyo Women's Medical
University, Tokyo, Japan
10
Department of Pediatrics, Graduate School of Medicine, Kyushu University, Fukuoka,
Japan
11
Department of Pediatrics, Omori Hospital, Toho University, Tokyo, Japan
Running head: RPS15A mutation in Diamond-Blackfan Anemia
Correspondence:
Seishi Ogawa, M.D., Ph.D. ([email protected]) or
Etsuro Ito, M.D., Ph. D. ([email protected])
Main text 1442 words, 3 figures, 1 supplemental file
Acknowledgements
The authors would like to thank T. Kudo Y. Kudo and A. Mikami for their technical
assistance. This work was supported by Practical Research Project for Rare/Intractable
Diseases (15ek0109133) and Grant-in-Aids (15ek0109099h001) from the Japan
Agency for Medical Research and Development (AMED) and the Research on
Measures for Intractable Diseases Project and Health and Labor Sciences Research
grants (Research on Intractable Diseases) from the Ministry of Health, Labour and
Welfare and JSPS KAKENHI Grant Numbers JP2591003, JP15K09656.
1
Diamond-Blackfan anemia (DBA) is a congenital bone marrow failure syndrome,
characterized by red blood cell aplasia, macrocytic anemia, variable malformations and
increased risk of malignancy.1-3 DBA has been associated with heterozygous mutations
or large deletions in ribosomal protein (RP) genes in more than 50% of patients, except
for rare germline GATA1 mutations reported in three X-linked DBA families.4 We
recently identified two novel causative RP genes, RPS27 and RPL27 by whole-exome
sequencing (WES) analysis of 48 patients without known causative mutations.5 To date,
14 RP genes (RPS7, RPS10, RPS17, RPS19, RPS24, RPS26, RPS27, RPS28, RPS29,
RPL5, RPL11, RPL26, RPL27 and RPL35A) have been reported to be responsible for
DBA.5-12 These mutations have been reported in up to 60% of DBA patients. However,
the molecular etiology of many DBA patients remains to be clarified.
In this report, we performed WES to survey novel DBA disease-causing genes in a
family with multiple individuals affected with DBA. We identified a novel DBA causative
gene, RPS15A, and we used a human erythroid cell line and zebrafish as model
systems to determine the consequences of the DBA-associated mutation. The proband
was a girl born at a gestational age of 37 weeks to unrelated parents. Her birth weight
was 2,155 g and her height was 47 cm. She had total anomalous pulmonary venous
connection and bilateral acetabular dysplasia. She had a family history of anemia. Her
mother and older sister presented anemia during childhood. They do not have physical
abnormalities. She was diagnosed with DBA at the age of three months. Peripheral
blood analysis at diagnosis showed hemoglobin 88 g/L, mean corpuscular volume
(MCV) 88.5 fL, white blood cell (WBC) 5.1 x 109/L with normal differential counts,
platelet count 306 x 109/L and 0.1% reticulocytes. Bone marrow aspiration showed
severe selective erythroid hypoplasia (0%) but otherwise normal cellularity. She
developed macrocytosis (MCV 113.0) at 14 years old. The proband as well as her sister
and mother responded to the initial corticosteroid therapy, and eventually became
steroid-independent. The clinical characteristics of the affected family members are
presented in Table S1. All of them were negative for mutations or deletion in 11 known
DBA causative genes (RPL5, RPL11, RPL27, RPL35A, RPS7, RPS10, RPS17, RPS19,
RPS24, RPS27 and GATA1) and RPS14, which is implicated in the 5q- myelodysplastic
syndrome characterized by a defect in erythroid differentiation.5,14
2
We then performed whole-exome sequencing (WES) of all family members. All clinical
samples were obtained with informed consent from the patients and family. The Ethics
Committee of Hirosaki University Graduate School of Medicine and the University of
Tokyo approved this study. Genomic DNA (gDNA) was extracted from peripheral blood
leucocytes with the QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany), enriched
for protein-coding sequences with a SureSelect Human all Exon V5 kit (Agilent
Technologies, Santa Clara, CA, USA) and followed by massive parallel sequencing with
the HiSeq 2000 platform with 100 bp paired-end reads (Illumina, San Diego, CA, USA)
as described previously.5,13 To validate the detected mutations, we performed direct
sequencing analysis using gDNA and primers described in Supplementary Methods.
WES revealed a putative splicing mutation at the third exon of RPS15A (c.213G>A,
p.K71K) in the affected members, but not the unaffected father. The mutation had not
been registered in the SNP database either of the Exome Aggregation Consortium
(ExAC) (http://exac.broadinstitute.org/) or the Tohoku Medical Megabank Organization
(https://ijgvd.megabank.tohoku.ac.jp/). The mutations were validated by direct
sequencing analysis (Figure 1A). The estimate of the prevalence of RPS15A mutation is
1 of 141 families (0.7%) in our cohort.
To confirm the effect of the mutation, we performed reverse transcriptase polymerase
chain reaction (RT-PCR) analysis of all family members. We found a shorter transcript
lacking the third exon by alternative splicing in addition to the full-length transcript only
in the affected family members (Figure 1B).
We then performed CRISPR/Cas9 genome editing in the human erythroid cell line K562
to validate the effect of the RPS15A-deficiency on erythroid lineage cells. The
CRISPR/Cas9 genome editing technique was performed using GeneArt CRISPR
Nuclease Vector kit (Life Technologies, Carlsbad, CA, USA) according to the
manufacturer’s protocol. Using two kinds of ssODNs (see Supplementary Methods), we
introduced the mutation observed in the patients (c.213 G>A) into K562 cells. We also
used a silent mutation (c.207 A>C) as a negative control. These transfected cells were
cultured for 12 days continuously. We analyzed allele frequency in bulk DNA of each
culture by targeted next generation sequencing with Miseq (Illumina) once every 3 days
3
up to 12 days. Paired t-test showed that the allele frequency of the DBA-associated
RPS15A mutation (c.213G
＞ A)
was significantly decreased (see Supplementary
Methods, Table S2 and Figure S1). These results suggested that the RPS15A mutation
observed in the patients suppressed cell proliferation.
Several studies showed that the heterozygous mutations in RP genes observed in DBA
disturb the synthesis of either the small or large subunit through defects in
pre-ribosomal RNA (pre-rRNA) processing.6,8,9,15 To determine if the haploinsufficiency
for RPS15A would affect pre-rRNA processing in erythroid lineage cells, we applied
CRISPR/Cas9 technology to introduce mutations in one copy of RPS15A in K562 cells.
We established a stable cell line (#75) with a heterozygous RPS15A mutation by limiting
dilution after genome editing. This cell line expressed normal and alternative splicing
forms lacking the second exon of RPS15A (Figure S2). Northern blotting analysis
showed the decrease of 18S-E pre-rRNA expression and the accumulation of 30S
pre-rRNA in #75 cell line as well as RPS15A, RPS19 or RPS27 knocked-down cells by
siRNAs (Figure 2) (see Supplementary Methods).5 No differences were discernable
other than the known effect of RPL5 knockdown on increased 32S. These results
suggested that haploinsufficiency for RPS15A would disturb processing of 18S rRNA.
Because a limited number of RP genes have been shown to cause DBA, it is likely that
haploinsufficiency for some RP genes is either harmless or lethal. We showed that
knockdown of RPS15A expression with siRNA disturbed pre-ribosomal RNA processing
in the human erythroid cell line K562. However, most knockdowns with siRNA will
decrease newly synthesized RP by well over 50% and it is very difficult to control the
knockdown levels. To overcome this problem, we successfully introduced a
heterozygous RPS15A mutation into K562 cells by CRISPR/Cas9 genome editing and
established a stable cell line showing disturbed pre-ribosomal RNA processing (Figure
2). This cell model system might be very useful for functional analysis of these variants.
Finally, to investigate the effects of the RPS15A mutations in vivo, we knocked down the
zebrafish ortholog (rps15a) using a morpholino antisense oligonucleotide (MO), after
which we analyzed the morphology and erythropoietic states during embryonic
development. The coding region of rps15a shares 81% of the nucleotides and 99% of
4
the amino acid identities with its human ortholog. MO was designed on the 5’-splice site
of the second intron of rps15a that corresponds to the position at which the mutation
was identified in the patients (Figure 3A). Injection of 0.5-2.5 μg/μL rps15a MO into the
one-cell stage embryos perturbed the splicing as observed in the patients and resulted
in exclusion of exon 3 (Figure 3B). The amount of the shorter transcript was increased
with increases in MO concentration.
We compared the MO-injected embryos (morphants) with wild type-embryos in terms of
their morphological features and erythropoietic development. The morphants showed
abnormal phenotypes, such as a thin yolk sac extension and a bent tale at 24 hours
post fertilization (hpf) (Figure 3C). These phenotypes were similar to other known DBA
morphants. We performed hemoglobin staining at 54 hpf and found a marked reduction
of erythrocyte production in the cardiac vein of the morphants (Figure 3C). These
abnormalities were more prominent in the morphants that were injected with MO at
higher concentrations (Figure S3). All these abnormalities were rescued by the
simultaneous injection of rps15a mRNA into the embryos, indicating that the abnormal
phenotypes were caused by the aberrant splicing of rps15a in zebrafish. These results
suggested that the splice site mutation identified in human RPS15A could be
responsible for the pathogenesis of DBA.
In conclusion, WES analysis identified RPS15A loss-of-function mutations in a DBA
family. We demonstrated that the mutation caused splicing aberrations. The RPS15A
mutation observed in the patients led to suppressed cell proliferation in K562 cells.
Heterozygous knock-in of the mutation by CRISPR/Cas9 gene editing disturbed
pre-rRNA processing for the small subunit. The zebrafish model of RPS15A mutation
showed impairment of erythrocyte production. These results suggested that RPS15A
plays an important role in erythropoiesis and that haploinsufficiency of RPS15A, like
haploinsufficiency of other ribosomal protein genes, caused Diamond Blackfan anemia.
This discovery adds another RP gene to the growing list of mutated genes in DBA
patients and supports DBA as a disorder of the ribosome.
5
References
1. Vlachos A, Ball S, Dahl N, et al. Diagnosing and treating Diamond Blackfan
anaemia: results of an international clinical consensus conference. Br J Haematol.
2008;142(6):859-876.
2. Ito E, Konno Y, Toki T, et al. Molecular pathogenesis in Diamond-Blackfan anemia.
Int J Hematol. 2010;92(3):413-418.
3. Vlachos A, Rosenberg PS, Atsidaftos E, et al. Incidence of neoplasia in Diamond
Blackfan anemia: a report from the Diamond Blackfan Anemia Registry. Blood.
2012;119(16):3815-3819.
4. Klar J, Khalfallah A, Arzoo PS,et al. Recurrent GATA1 mutations in
Diamond-Blackfan anaemia. Br J Haematol. 2014;166(6):949-951.
5. Wang R, Yoshida Y, Toki T, et al. Loss of function mutations in RPL27 and RPS27
identified by whole-exome sequencing in Diamond-Blackfan Anemia. Br J Haematol.
2015;168(6):854-64.
6. Doherty L, Sheen MR, Vlachos A, et al. Ribosomal protein genes RPS10 and
RPS26 are commonly mutated in Diamond-Blackfan anemia. Am J Hum Genet.
2010;86(2):222-228.
7. Draptchinskaia N, Gustavsson P, Andersson B, et al. The gene encoding ribosomal
protein S19 is mutated in Diamond-Blackfan anaemia. Nature Genetics.
1999;21(2):169-175.
8. Gazda HT, Grabowska A, Merida-Long LB, et al. Ribosomal protein S24 gene is
mutated in Diamond-Blackfan anemia. Am J Hum Genet. 2006;79(6):1110-1118.
9. Gazda HT, Preti M, Sheen MR, et al. Frameshift mutation in p53 regulator RPL26 is
associated with multiple physical abnormalities and a specific pre-ribosomal RNA
processing defect in diamond-blackfan anemia. Hum Mutat. 2012;33(7):1037-1044.
10. Gerrard G, Valgañón M, Foong HE, et al. Target enrichment and high-throughput
sequencing of 80 ribosomal protein genes to identify mutations associated with
Diamond-Blackfan anaemia. Br J Haematol. 2013;162(4):530-536.
11. Konno Y, Toki T, Tandai S, et al. Mutations in the ribosomal protein genes in
Japanese patients with Diamond-Blackfan anemia. Haematologica.
2010;95(8):1293-1299.
12. Mirabello L, Macari ER, Jessop L, et al. Whole-exome sequencing and functional
studies identify RPS29 as a novel gene mutated in multi-case Diamond-Blackfan
6
anemia families. Blood. 2014;124(1):24-32.
13. Kunishima S, Okuno Y, Yoshida K, et al. ACTN1 mutations cause congenital
macrothrombocytopenia. Am J Hum Genet. 2013;92(3):431-438.
14. Ebert BL, Pretz J, Bosco J, et al. Identification of RPS14 as a 5q- syndrome gene by
RNA interference screen. Nature. 2008;451(7176):335-339.
15. Choesmel V, Bacqueville D, Rouquette J, et al. Impaired ribosome biogenesis in
Diamond-Blackfan anemia. Blood. 2007;109(3):1275-1283.
7
Figure Legends
Figure 1. Pedigree of a Diamond-Blackfan anemia family with RPS15A mutation.
(A) Each electropherogram indicates the gDNA sequence including the boundary
between the third exon and IVS-3 of the RPS15A gene. Red arrows indicate the
position of nucleotide substitution c.213G>A. (B) Reverse-transcriptase polymerase
reaction (RT-PCR) analysis using the primer set located on the second and fourth exons
of the RPS15A gene. Arrows indicate PCR products for the full-length variant and
alternative splicing form lacking the third exon of RPS15A. Both transcripts were
expressed only in the affected family members.
Figure 2. Perturbation of pre-rRNA processing by knockdown or heterozygous
knockout of RPS15A.
Northern blot analysis of pre-rRNA processing in K562 cells in which we knocked down
RPS15A, RPS19, RPS27 or RPL5 by siRNAs or heterozygously knocked out RPS15A
by CRISPR/Cas9 gene editing (#75). The 5’-extremities of the internal transcribed
spacer 1 (ITS-1) was used as probes to detect the precursors to the 18S rRNA
associated with the small subunit. The UV images of the gels were used to judge
loading consistency. The decrease of 18S-E pre-rRNA was detected by the ITS-1 probe
in RPS15A knockdown cells and #75 cell line (red arrows) as well as RPS19 and
RPS27 knockdown cells.
Figure 3. Morphological features and hemoglobin staining of Rps15a-deficient
zebrafish.
(A) The gene structures of human RPS15A (NM_001019.4) and zebrafish rps15a
(NM_212762.1). The MO target site is underlined. The arrow indicates the position of
the mutated nucleotide in the patients. Arrowheads show the primer positions for the
RT-PCR. Black and white boxes indicate coding and non-coding exons, respectively.
Black lines indicate introns. (B) The results of RT-PCR of rps15a in wild-type and
MO-injected embryos. A smaller transcript without exon 3 was observed in the
morphants as seen in the patients at a comparable level. The amount of smaller
transcripts correlated with the concentration of injected MOs. (C) Morphological features
of wild-type and MO-injected embryos. A thin yolk sac extension and a bent tail (red
8
arrows) were prominent in the morphants injected with 1.0 μg/μL MO targeted against
rps15a, whereas these features were rescued in the embryos injected with rps15a
mRNA at 400 ng/μL. Compared to the wild-type embryos, rps15a morphants injected
with MO showed a drastic reduction in the number of hemoglobin-stained blood cells
(black arrow). Morphants co-injected with rps15a mRNA showed recovery of the stained
cells.
9
Supplementary Appendix
Exome
sequencing
identified
RPS15A
as
a
novel
causative
gene
for
Diamond-Blackfan anemia
Fumika Ikeda, Kenichi Yoshida, Tsutomu Toki, Tamayo Uechi, Shiori Ishida, Yukari
Nakajima, Yoji Sasahara, Yusuke Okuno, Rika Kanezaki, Kiminori Terui, Takuya Kamio,
Akie Kobayashi, Takashi Fujita, Aiko Sato-Otsubo, Yuichi Shiraishi, Hiroko Tanaka,
Kenichi Chiba, Hiroko Tanaka, Hideki Muramatsu, Hitoshi Kanno, Shouichi Ohga, Akira
Ohara, Seiji Kojima, Naoya Kenmochi, Satoru Miyano, Seishi Ogawa, Etsuro Ito
1
A. Supplementary Methods
Whole-exome sequencing analysis
gDNA of individuals of the family (Table S1) was enriched for protein-coding sequences
with a SureSelect Human all Exon V5 kit (Agilent Technologies, Santa Clara, CA, USA).
This was followed by massive parallel sequencing with the HiSeq 2000 platform with
100 bp paired-end reads (Illumina, San Diego, CA, USA). Candidate germline variants
were detected through our in-house pipeline for WES analysis with minor modifications
for the detection of germline variants. The resultant sequences were aligned to the
University of California Santa Cruz (UCSC) Genome Browser hg19 with the
Burrows-Wheeler Aligner (Li & Durbin, 2009). After removal of duplicate artifacts
caused by the polymerase chain reaction (PCR), the single nucleotide variants with an
allele frequency >0.25 and insertion-deletions with an allele frequency >0.1 were called.
With a mean depth of coverage of 116.3× (67× − 166×), more than 92% of the 50 Mb
target sequences were analyzed by more than 10 independent reads. To validate the
detected mutations, direct sequencing analysis was performed using genomic DNA
derived from the leucocytes.
Cell lines
The human erythroleukemic cell line K562 was maintained in RPMI 1640 medium
(Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS)
(Life Technologies, Carlsbad, CA, USA) at 37℃ in a 5% CO2 atmosphere.
Genome editing using a CRISPR/Cas9 Vector
The CRISPR/Cas9 genome editing technique was performed using GeneArt CRISPR
Nuclease Vector kit (Life Technologies, Carlsbad, CA, USA) according to the
manufacturer’s protocol. An appropriate guide RNA (gRNA) sequence targeting the
3’-splice site of the third exon of RPS15A was identified using an online CRISPR Design
Tool
(http://tools.genome-engineering.org).
Oligomers
encoding
gRNA
were
synthesized, annealed and cloned into the GeneArt CRISPR Nuclease Vector. The
vector
was
transfected
into
K562
cells
with
two
kinds
of
single-strand
oligodeoxynucleotides (ssODNs) using Amaxa Nucleofector (Amaxa Biosystems). The
ssODNs (90 base pairs) were designed to introduce the mutation observed in the
2
patients (c.213 G>A) or a silent mutation (c.207 A>C) as a negative control. The primer
sequences are described below. To validate the effect of the RPS15A-deficiency on
erythroid lineage cells, the allele frequencies of RPS15A mutations (c.213 G>A and
c.207 A>C) were determined by targeted next generation sequencing with Miseq
(Illumina) once every 3 days up to 12 days. The experiments were performed three
times independently. From Day1 to Day3, the allele freqauency of the silent mutation
and the DBA-associated RPS15A mutation were increased respectively. These results
suggested that the genome editing progressed until Day3. We then performed paired
t-test (Day3 vs Day12) to assess if the changes in the allele frequency are significant.
Paired t-test showed that the allele frequency of the DBA-associated RPS15A mutation
(c.213G＞A) was significantly decreased (p=0.008) (Table S2).
Transient transfection with small interfering RNA
To knock down the RPS15A gene, cells were transfected by using Amaxa Nucleofector
(Amaxa Biosystems, Gaithersburg, MD, USA).
Oligonucleotide sequences
To validate the RPS15A mutations from the patients and their family as well as the K562
cell genome edited by the CRISP/Cas9 vector, we performed direct sequencing
analysis using primers as follows:
RPS15A F2 (5’-AGCACAGAGGTTTAGCTCTCAAGT-3’) and
RPS15A R2 (5’-ATTTCCAAAGGCAATTACAACATT-3’).
For RT-PCR analysis of family members, we used the following primers located on the
second and fourth exons:
RPS15 cDNA f1 ( ATCCTGCAATCTAAGCCACAAT) and
RPS15 cDNA f2 (CATTTTTCCAGGTCTTTGAGTTG).
To construct the CRISPR/Cas9 vector, we used the following oligomers encoding the
gRNA targeted at the 3’-splice site of the third exon of RPS15A:
CRISPR F (5’-CCTCACAGGCAGGCTAAACAAGTTTT -3’) and
CRISPR R (3’-GTGGCGGAGTGTCCGTCCGATTTGTT-5’).
3
To introduce a mutation observed in the patients (c.213 G>A) or a silent mutation (c.207
A>C) as a negative control in K562 cells, the following oligodeoxynucleotides (ssODN)
were cotransfected with CRISPR/Cas9 Vector: ssODN ( c.213 G>A),
5’-CAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGCTAAACAAAgtaagaacga
gtgatctacacatttcaaagctttaagaatttttt-3’);
ssODN (c.207 A>C),
(5’-CAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGCTCAACAAGgtaagaacg
agtgatctacacatttcaaagctttaagaatttttt-3’)
Full-length zebrafish rps15a (GenBank accession no. NM_212762) was amplified by
PCR using forward and reverse primers appending EcoRl and Xhol sites (forward:
5’-CCGGAATTCCATCATGGTGCGCATGAAC-3’
and reverse: 5’-CGGCTCGAGTGTTGGCGACTTTACATGTTT-3’).
To detect rps15a transcripts, reverse transcriptase-PCR was performed using primers
as follows:
(5’-TGCGCTGAAAAGCATCAATA-3’) and
(5’-CCAGATCCTTCAACTGCACA-3’).
The sequence of the MO targeting the splice junction of rps15a pre-mRNA was
(5’-GCAAGTCACACTCACCTTGTTCAGC-3’).
Conditions for Northern blot analysis.
Total RNA was extracted from cells using the RNeasy plus kit (QIAGEN). Total RNA
was hybridized at 42ºC in RapidHyb buffer (GE Healthcare UK, Ltd. Buckinghamshire,
England) and the membranes were washed in 0.1 x SSC, 0.1% SDS, 42°C. The probes
used in the present study were as follows:
5′ITS1 (5′–CCTCGCCCTCCGGGCTCCGTTAATGATC-3′) and
5’ITS2 (5’-GGGGCGATTGATCGGCAAGCGACGCTC-3’).
Functional analysis using zebrafish
A morpholino antisense oligonucleotide (MO) targeting the splice site of zebrafish
rps15a was obtained from Gene Tools, LLC (Philomath, OR, USA). MO was injected at
4
concentrations of 0.5-2.5 µg/µL into one-cell stage embryos. The MO-injected embryos
(morphants) were grown at 28.5oC. The morphological features of the morphants were
compared with wild-type embryos at 24 hours post fertilization (hpf). Hemoglobin
staining was performed at 54 hpf using o-dianisidine. Full-length rps15a was amplified
by PCR and cloned into a pCS2+ vector for in vitro transcription. Capped mRNAs were
synthesized from the linearized template using an mMessage mMachine SP6 kit (Life
Technologies). The synthesized rps15a mRNA was injected at 400 ng/µL into
one-cell-stage embryos with the splice site-targeting MO at 1.0 µg/µL. Total RNA was
isolated from the wild-type embryos and the morphants. To distinguish normal or cryptic
sizes of the rps15a transcript, RT-PCR was performed with primer pairs designed at
exons 2 and 4.
5
B. Supplementary Table
Table S1. Clinical characteristics of the affected family members
Patient
Mother
Older sister
Proband
46
18
17
Gender
Female
Female
Female
Age at diagnosis
0 month
1year 0 month
3 month
Malformation
No
No
Yes
Clinical data
at 42 years old
at diagnosis
at diagnosis
RBC (109/L)
580
1,680
2,870
Hb (g/L)
24
60
88
MCV (fL)
122
103
88.5
Reticulocyte (%)
1.8
3.9
1.0
WBC (109/L)
4.0
5.6
5.1
Plt (109/L)
557
691
306
Bone marrow
N/A
N/A
Yes
Yes
Yes
No
No
No
Age (years old)
Response to first
steroid therapy
Present therapy
N/A: not available
6
Normal cellularity,
Erythroid 0%
Table S2. The allele frequency of the DBA-associated RPS15A
mutation (c.213G>A) and a silent mutation (c.207A>C)
Paired
Allele
c.207 A>C : Syn
c.213 G>A : SE
t-test
Day 1
Day 3
Day 12
Day 1vs 12
Day 3 vs 12
Ave
18.90
27.38
37.00
0.033
0.030
SD
4.46
6.00
8.93
Ave
9.76
16.67
7.70
0.199
0.008
SD
5.08
2.84
4.16
Syn : Synonimous substitution, SE : Splicing error,
Ave : Average,
SD : Standard deviation
Data were derived from three independent experiments.
7
C. Supplementary Figures
Figure S1. Erythroid cell line K562 after CRISPR/Cas9 gene editing.
The CRISPR/Cas9 vector was co-transfected into K562 cells with two kinds of
single-stranded oligodeoxynucleotides using Amaxa Nucleofector (Amaxa Biosystems).
We analyzed allele frequency in bulk DNA of each culture once every 3 days. From
Day1 to Day3, the allele frequency of the silent mutation and the DBA-associated
RPS15A mutation were increased respectively. After Day 3, the allele frequency of the
DBA-associated RPS15A mutation (c.213G＞A) was decreased. The data were derived
from three independent experiments.
8
Figure S2. K562 subclone #75 with heterozygous mutation in RPS15A
This cell line expresses normal and alternative splicing form lacking second exon of
RPS15A (black arrow head).
9
. /
0
0
0
0
0
0
Figure S3. Hemoglobin staining of Rps15a-deficeint zebrafish
A reduction of erythrocyte production was more prominent in the morphants that were
injected with MO at higher concentrations.
10