Download Regeneration and Phenotype That Promote Muscle Growth IL

IL-10 Triggers Changes in Macrophage
Phenotype That Promote Muscle Growth and
Regeneration
This information is current as
of August 3, 2017.
Bo Deng, Michelle Wehling-Henricks, S. Armando Villalta,
Ying Wang and James G. Tidball
J Immunol 2012; 189:3669-3680; Prepublished online 29
August 2012;
doi: 10.4049/jimmunol.1103180
http://www.jimmunol.org/content/189/7/3669
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2012/08/29/jimmunol.110318
0.DC1
This article cites 63 articles, 28 of which you can access for free at:
http://www.jimmunol.org/content/189/7/3669.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2012 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
Supplementary
Material
The Journal of Immunology
IL-10 Triggers Changes in Macrophage Phenotype That
Promote Muscle Growth and Regeneration
Bo Deng,* Michelle Wehling-Henricks,† S. Armando Villalta,* Ying Wang,* and
James G. Tidball*,†,‡
C
hanges in muscle use or acute damage produce a rapid and
highly structured inflammatory response that is dominated
by successive waves of invasion of myeloid cells that can
strongly influence both the magnitude of muscle damage and the
rate at which repair occurs (1). Regardless of the perturbation that
leads to inflammation, the muscle experiences an initial, rapid invasion by neutrophils and CD68high macrophages. In an apparently
nonadaptive response, these inflammatory cells amplify damage to
the muscle, producing lesions to muscle cell membranes that can
lead to necrosis of muscle fibers. These lesions are primarily attributable to the actions of free radicals generated by myeloperoxidase and inducible NO synthase (iNOS) (2–6). However, within
days of increased muscle use or acute injury, the numbers of
CD68high macrophages and neutrophils decline, whereas the numbers of macrophages that express CD163 and CD206 increase and
remain elevated as muscle repair, regeneration, and growth proceed
(7–10).
*Molecular, Cellular, and Integrative Physiology Program, University of California,
Los Angeles, Los Angeles, CA 90095; †Department of Integrative Biology and
Physiology, University of California, Los Angeles, Los Angeles, CA 90095; and
‡
Department of Pathology and Laboratory Medicine, David Geffen School of Medicine at University of California, Los Angeles, Los Angeles, CA 90095
Received for publication November 9, 2011. Accepted for publication July 27, 2012.
This work was supported by grants from the National Institutes of Health (R01
AR47721, R01 AR47855, R01 AR/AG054451) and the Muscular Dystrophy Association (157881) to J.G.T.
Address correspondence and reprint requests to Dr. James G. Tidball, Molecular,
Cellular, and Integrative Physiology Program, University of California, Los Angeles,
1135 Terasaki Life Science Building, Los Angeles, CA 90095-1606. E-mail address:
[email protected]
The online version of this article contains supplemental material.
Abbreviations used in this article: Arg1, arginase-1; HMOX-1, heme oxygenase-1;
iNOS, inducible NO synthase; MKP-1, MAPK phosphatase-1; QPCR, quantitative
real-time PCR.
Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1103180
In addition to their capacity to exacerbate muscle damage,
macrophages have been implicated in promoting muscle regeneration following acute muscle injuries or during increased muscle
loading. For example, genetic ablation of CCR2 or its ligand (CCL2)
greatly reduced the numbers of macrophages in muscles that were
injured by freezing (11, 12), ischemia (13, 14), or cardiotoxin injection (15), and those reductions in macrophages were associated
with slower muscle regeneration and growth of the injured tissue.
Furthermore, transplantation of wild-type bone marrow into irradiated, CCR2-mutant mice prior to muscle injury was sufficient to
restore macrophage invasion and normalize muscle growth to wildtype rates (16). Although other myeloid cells can express CCR2,
ablation of CCR2-mediated signaling does not affect chemoattraction of neutrophils or lymphoid cells to injured muscle (17),
providing strong support that the reported treatment effects of
disrupted CCR2 signaling reflect a disruption of macrophage
functions in promoting muscle regeneration. Similarly, selective
depletion of circulating CD11b-expressing cells prior to muscle
injury by toxin injection reduced muscle regeneration (18), lending
support to the view that CD11b+ leukocytes, most likely macrophages, promote muscle regeneration.
In vitro observations indicate that macrophages may positively
affect muscle growth and regeneration by modulating both the
proliferation and differentiation of a population of muscle stem
cells, called satellite cells, that normally reside in muscle in
a quiescent state. Upon increased muscle loading or injury, satellite
cells are activated to proliferate, after which some of the activated
cells withdraw from the cell cycle to enter a stage of early differentiation, followed by terminal differentiation when they fuse to
form muscle fibers (19). Each of these stages of myogenesis is
characterized by shifts in the expression of developmentally regulated genes. For example, during the proliferative stage of myogenesis, muscle cells show elevated expression of the transcription
factor MyoD (20, 21). During early differentiation, muscle cells
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
We examined the function of IL-10 in regulating changes in macrophage phenotype during muscle growth and regeneration following injury. Our findings showed that the Th1 cytokine response in inflamed muscle is characterized by high levels of expression of
CD68, CCL-2, TNF-a, and IL-6 at 1 d postinjury. During transition to the Th2 cytokine response, expression of those transcripts
declined, whereas CD163, IL-10, IL-10R1, and arginase-1 increased. Ablation of IL-10 amplified the Th1 response at
1 d postinjury, causing increases in IL-6 and CCL2, while preventing a subsequent increase in CD163 and arginase-1. Reductions
in muscle fiber damage that normally occurred between 1 and 4 d postinjury did not occur in IL-10 mutants. In addition, muscle
regeneration and growth were greatly slowed by loss of IL-10. Furthermore, myogenin expression increased in IL-10 mutant
muscle at 1 d postinjury, suggesting that the mutation amplified the transition from the proliferative to the early differentiation
stages of myogenesis. In vitro assays showed that stimulation of muscle cells with IL-10 had no effect on cell proliferation or
expression of MyoD or myogenin. However, coculturing muscle cells with macrophages activated with IL-10 to the M2 phenotype
increased myoblast proliferation without affecting MyoD or myogenin expression, showing that M2 macrophages promote the
early, proliferative stage of myogenesis. Collectively, these data show that IL-10 plays a central role in regulating the switch of
muscle macrophages from a M1 to M2 phenotype in injured muscle in vivo, and this transition is necessary for normal growth and
regeneration of muscle. The Journal of Immunology, 2012, 189: 3669–3680.
3670
IL-10–ACTIVATED MACROPHAGES PROMOTE MUSCLE REGENERATION
Materials and Methods
Animals
All experimental protocols involving the use of animals were conducted
according to the National Institutes of Health Guide for the Care and Use of
Laboratory Animals and were approved by the University of California,
Los Angeles Institutional Animal Care and Use Committee. Adult C57BL/
6J mice and IL-10–null mice (B10.129P2[B6]-Il10tm1Cgn/J) were purchased from The Jackson Laboratory (Bar Harbor, ME). Mutant mice were
back-crossed onto the C57BL/6J background for at least eight generations
by the supplier.
Hindlimb muscle unloading and reloading
In the present investigation, we use the rodent hindlimb unloading followed
by reloading model to cause muscle damage, regeneration, and growth that
occur over a well-delineated time course (33). In this manipulation, rodent
hindlimbs are elevated for a period of time so that they are no longer
weight-bearing, which causes a rapid loss of mass in some muscles as they
adapt to the unloaded condition. The soleus muscle is most rapidly affected and can lose 30 to 40% of its mass in 10 d through mechanisms that
resemble those that occur in the muscles of patients subjected to prolonged bedrest (34). Reloading the hindlimbs by returning the animals to
normal weight-bearing and ambulation provides a reproducible model for
studying muscle adaptation to increased loading. During reloading,
muscle experiences growth and regeneration that are characterized by the
appearance of central-nucleated muscle fibers that show renewed expression of developmental genes, as well as a rapid increase in fiber crosssectional area, so that the fibers return to their original, presuspension size
within 4–7 d of reloading. This response of soleus muscle to reloading
permits the in vivo analysis of the contributions of specific leukocyte
populations to injury, regeneration, and growth that result from increased
muscle use.
Four-month-old female mice were subjected to 10 d of hindlimb
unloading using a previously described device (33), followed by no
reloading or by 1 or 4 d of reloading by normal weight-bearing. At the end
of the treatment period, mice were euthanized with inhalation of isoflurane,
and soleus muscles were rapidly dissected and collected. Ambulatory,
control mice were subjected to normal cage activity until euthanized for
tissue collection.
Immunohistochemistry
One soleus muscle from each mouse was dissected and then rapidly frozen
in isopentane cooled in liquid nitrogen. Frozen cross-sections were cut from
the midbelly of each muscle at a thickness of 10 mm. The frozen sections
were air-dried and fixed in cold acetone for 10 min, and endogenous
peroxidase activity was quenched with 0.03% H2O2. Sections were
blocked in 3% BSA and 2% gelatin in 50 mM Tris buffer (pH 7.2) for 1 h
and then immunolabeled with rat anti-CD68 (Serotec) or rat anti-CD163
(Serotec) for 3 h or with mouse anti-MyoD (BD Bioscience) or mouse antimyogenin (BD Bioscience) overnight. Negative control sections were
prepared for each primary Ab using isotype control IgG in place of the
specific primary Ab. Sections were washed with 50 mM sodium phosphate (pH 7.2) containing 150 mM sodium chloride (PBS) and then incubated with biotin-conjugated secondary Ab (Vector) for 1 h and Avidin
D-conjugated HRP (Vector) for 30 min. Immunoreactive cells were visualized using the enzyme substrate, 3-amino-9-ethylcarbazole, which yields
red reaction products in the presence of peroxidase (AEC kit; Vector). The
number of immunolabeled cells/volume of muscle tissue was then determined by first measuring the total volume of each section using a stereological, point-counting technique to determine section area (31) and then
multiplying that value by the section thickness (10 mm). The numbers of
immunolabeled cells in each section were counted and expressed as the
number of cells/unit volume of each section.
Assay for muscle fiber injury
Muscle fibers experiencing membrane lesions were identified by IgG
staining, as previously described (35). Presence of IgG in the cytosol
indicates the presence of muscle membrane lesions large enough to allow
the unregulated transit of large molecules through lesions in the cell
membrane. Frozen sections were air-dried and blocked in 1% gelatin diluted in PBS and then labeled with FITC-conjugated mouse anti-IgG
(Vector) for 1 h. After washing with PBS, the staining was visualized by
epifluorescence microscopy, and the number of injured fibers showing
cytosolic fluorescence and total number of fibers were counted. The extent
of muscle injury was expressed as the number of injured fibers relative to
the total number of fibers in the muscle cross-section.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
withdraw from the cell cycle, and the expression of myogenin,
also a transcription factor, increases (20, 21). This transition in the
myogenic program may be influenced by macrophages. For example, when satellite cells are placed in cocultures with macrophages, satellite cell proliferation increases (22–25), whereas the
proportion of muscle cells that express myogenin is reduced
(23).
Although some in vitro observations of macrophage/satellite cell
cocultures show that macrophages can promote proliferation and
inhibit differentiation of muscle cells, other findings indicate that
some macrophage populations can promote muscle differentiation.
For example, if muscle cells are cocultured with CD163+ macrophages, muscle cell fusion to form myotubes is increased (26),
which is a morphological indicator of increased differentiation.
CD163, a hemoglobin/haptoglobin receptor, is selectively expressed on macrophages that are activated to an anti-inflammatory, M2 phenotype (27–30). In injured tissues, CD163+ macrophages are in a state of alternative activation in which they secrete
anti-inflammatory cytokines that can deactivate neutrophils and
CD68high macrophages and, thereby, reduce tissue damage. Thus,
in vitro findings suggest that M2 macrophages could improve
repair and regeneration of muscle by deactivation of cytotoxic
neutrophils and CD68high macrophages, as well as by directly
influencing muscle cell differentiation. Similarly, in vivo observations support a role for CD163 + macrophages in promoting
muscle growth following increased muscle loading or injury.
Depletion of macrophages from injured muscles at the stage when
CD68high macrophages decline and CD163+ macrophages increase
resulted in reductions in muscle repair and greatly slowed muscle
growth and regeneration (31).
Collectively, these observations indicate that the transition of
macrophage populations in injured muscle from a CD68high/
CD1632 population to a CD68low/CD163+ population reflects
transition to a macrophage population that can promote muscle
growth and regeneration following injury. If that were true, then
modulation of the expression of signaling molecules that promote
the CD163+ M2 phenotype would affect the course of muscle
differentiation, regeneration, and growth. Although several cytokines can drive macrophages to the M2 phenotype, IL-10 provides
an especially good candidate molecule for regulating changes in
macrophage phenotype that influence muscle growth and regeneration. IL-10 is a strong activator of CD163 expression in vitro
(29), and ablation of IL-10 expression in dystrophic muscle
reduces the numbers of CD163+ macrophages in the muscle, indicating that IL-10 is also capable of modulating muscle macrophage phenotype in vivo (32). In addition, IL-10 promotes
phagocytosis by macrophages (32), and induction of phagocytosis
can produce a phenotype switch from proinflammatory M1 macrophages to the anti-inflammatory M2 phenotype, at least in vitro
(18).
In the present investigation, we tested whether ablation of IL-10
expression affects muscle injury, regeneration, or growth that
occurs following muscle damage caused by increased muscle
loading. We anticipate that null mutation of IL-10 in mice experiencing muscle reloading after disuse atrophy will attenuate the
shift of macrophages to the M2 phenotype that is caused by increased muscle loading and help us to identify the functional
importance of that shift in the context of muscle growth and regeneration. Finally, we test whether IL-10 has direct effects on
muscle cell growth or differentiation in vitro, to assess whether IL10–mediated influences on muscle can reflect direct actions on
muscle cells in addition to effects mediated through the myeloid
compartment.
The Journal of Immunology
Assay for muscle fiber regeneration
Centrally located nuclei are morphological markers of muscle fibers undergoing regeneration. The number of fibers containing central nuclei in
complete cross-sections of soleus muscles was counted in unfixed sections
that were air-dried and stained with hematoxylin. Central-nucleated, regenerative fibers are expressed as the percentage of the total number of fibers in
each section.
Measurement of muscle fiber cross-sectional area
Muscle fiber atrophy or growth was analyzed by measuring the muscle fiber
cross-sectional area using a digital imaging system (BIOQUANT). In each
soleus muscle cross-section, 250 muscle fibers were randomly chosen and
measured for each of six mice in each treatment group. The average of the
group of 250 fibers was calculated; that value was used as a single datum
that was used to calculate the mean and SEM for fiber cross-sectional area
for each treatment group.
RNA isolation and quantitative real-time PCR
Macrophage isolation
Peritoneal macrophages were isolated from 3–6-mo-old C57BL/6J mice.
Mice received an i.p. injection of 12% sodium casein in 0.9% sodium
chloride and were euthanized with isoflurane 3 d later. Immediately after
euthanization, the peritoneal cavity of the mouse was opened and rinsed
with PBS. The peritoneal exudates were then collected and filtered through
a 70-mm cell strainer (BD Bioscience). Filtered peritoneal cells were
centrifuged and resuspended in proliferation medium (DMEM [SigmaAldrich] supplemented with 10% FBS and 1% penicillin and streptomycin [Life Technologies]). Cell suspensions were overlaid on an equal
volume of Histopaque-1077 (Sigma-Aldrich) and centrifuged at 400 3 g
for 30 min. Macrophages were collected from the interface of Histopaque
and DMEM, centrifuged, and resuspended in DMEM media for later use.
Some isolated cells were adhered to microscope slides by centrifugation at
14 3 g for 3 min using a Cytospin (Shandon) and stained with rat anti-F4/
80 (0.2 mg/ml) to confirm that they were macrophages. Rat anti-F4/80 was
prepared previously by ammonium sulfate precipitation of Igs from F4/80
hybridoma cultures (HB-198; American Type Culture Collection).
Assay for muscle cell proliferation or differentiation
Peritoneal macrophages were seeded at 4.0 3 105 cells/well in six-well
plates and stimulated for 24 h with IL-10 (10 ng/ml) to induce the M2
phenotype or IFN-g and TNF-a (10 ng/ml of each) to induce the M1
phenotype. After stimulation, cytokines were washed away with DMEM.
C2C12 cells that were grown previously in proliferation medium under
subconfluent conditions were plated on top of stimulated macrophages at
4.0 3 105 cells/well in differentiation media in which 10% FBS was
replaced by 2% horse serum. Fresh differentiation media were added to the
cocultures every 24 h. Myoblast proliferation was assayed by harvesting
cells from 2-d-old cocultures in 0.05% trypsin-EDTA, after which the cells
were pelleted, resuspended in PBS, and counted using a hemocytometer.
Macrophages remained adherent to the culture dishes during trypsinization. Myoblast differentiation was assayed by collecting cell lysates
from 4-d cocultures in reducing sample buffer (80 mM Tris [pH 6.8], 0.1
M DTT, and 70 mM SDS) and protease inhibitor mixture (1:100; SigmaAldrich) for Western blot analysis.
Western blot analysis
Cell lysates collected in reducing sample buffer with protease inhibitor
mixture were electrophoresed in polyacrylamide gels and then transferred
electrophoretically to nitrocellulose membranes. Thirty micrograms of sample
was used in each lane for all gels and blots analyzed. Following transfer, the
membranes were stained with Ponceau S solution (Sigma-Aldrich) to confirm
the equal loading of samples. Nitrocellulose membranes were blocked with
3% nonfat milk and then incubated with mouse anti-MyoD (BD Bioscience),
mouse anti-myogenin (BD Bioscience), rabbit anti-CD163 (Santa Cruz
Biotechnology), or rabbit anti-mouse iNOS (Upstate Biotechnology) for 3 h at
room temperature. The Abs were diluted in 50 mM Tris (pH 7.6) containing
150 mM NaCl, 0.1% NaN3, 0.05% Tween 20, and 3% BSA. After washing
with PBS buffer containing 0.1% Tween 20, the blots were incubated with
a specific secondary Ab conjugated with HRP (Amersham) for 1 h at room
temperature. After washing, the signal was detected by ECL (Amersham)
and a fluorochem imaging system (Alpha Innotech).
Statistics
Data are presented as mean 6 SEM. One-way ANOVA (GraphPad InStat
version 2.03) was used to test whether differences between groups were
significant at p , 0.05. Comparisons of two groups of values were analyzed using the unpaired, two-tailed t test. Differences were considered
significant at p , 0.05.
Results
Increased muscle use following periods of disuse induces an
initial Th1 cytokine response followed by a Th2 cytokine
response
Previous investigations demonstrated that CD68high macrophages
appeared at elevated numbers in the initial inflammatory infiltrate
in muscle experiencing increased loading, but their numbers then
declined, whereas a CD163+ macrophage population subsequently
increased (7–9). Our immunohistochemical observations confirm
the early invasion of CD68high macrophages into muscle that has
experienced 1 d of reloading and show that these macrophages can
invade the cytoplasm of injured muscle fibers (Fig. 1). We also
confirmed that their decline between days 1 and 4 of reloading
was accompanied by an increase in CD163+ macrophages that do
not invade damaged muscle fibers (Figs. 2, 3). CD68+ and CD163+
macrophages were found codistributed in the same inflammatory
lesions at each stage of reloading that was assayed (Supplemental
Fig. 1).
We assayed for changes in expression levels of CD68 and Th1
cytokines that are associated with classical activation of macrophages
to the M1 phenotype and found that there is a large, significant
increase in CD68 expression at 1 d of reloading in wild-type muscle
that is largely attenuated by 4 d of reloading (Figs. 3, 4), consistent
with changes in the numbers of CD68high macrophages that occur
during this period of reloading (31). This change in expression of
CD68 coincided with changes in the expression of TNF-a, IL-6, and
CCL2 (Fig. 4), all of which are cytokines that typify a Th1 cytokine
response (27). Other transcripts associated with a Th1 cytokine response (CCR2, IRF-5, and IL-12) were not elevated concurrently
(Fig. 4). In contrast, CD163 expression was not significantly elevated at 1 d of reloading, but it was increased at 4 d in wild-type
muscle. This increase in CD163 coincided with a tremendous increase in arginase-1 (Arg1) expression, a marker for M2 activation
of macrophages (36), along with substantial increases in the expression of IL-10 and its receptor, IL-10R1 (Fig. 5). However, expression of heme oxygenase-1 (HMOX-1), which can be activated
by CD163 ligation (37), was not increased at 4 d (Fig. 5). Collectively, these data indicate that the CD68high/CD1632 early invading
macrophages are characteristic of a Th1 cytokine response, and they
are subsequently replaced by a population of CD68lo/CD163+ M2
macrophages.
Null mutation of IL-10 attenuates the shift of muscle
macrophages to the M2 phenotype
The finding that the expression of IL-10, its receptor, and two major
indicators of macrophage activation to the M2 phenotype (CD163
and Arg1) increased in muscle experiencing 4 d of reloading following a period of atrophy led us to test whether the shift to the M2
phenotype in reloaded muscle was regulated by IL-10. Because
IL-4 expression levels remained very low throughout the unloading
and reloading process and did not differ significantly between any
two time points assayed (data not shown), we inferred that IL-4–
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
During tissue collection, one soleus muscle from each animal was rapidly
frozen in liquid nitrogen and used for RNA isolation. Total RNA was
isolated with TRIzol reagent, according to the manufacturer’s protocol
(Invitrogen). Five hundred nanograms of total RNA from each sample was
reverse transcribed to cDNA using Super Script Reverse Transcriptase II
(Invitrogen). Quantitative real-time PCR (QPCR) reactions with cDNA
were performed using SYBR Green Master Mix (Bio-Rad). The real-time
amplification of genes was measured with an iCycler thermocycler system
and iQ5 optical system software (Bio-Rad). Data were normalized to
b-actin transcript levels. The PCR primers used are listed in Table I.
3671
3672
IL-10–ACTIVATED MACROPHAGES PROMOTE MUSCLE REGENERATION
mediated signaling was not an important modulator of macrophage phenotype switching in this model. Expression levels of
markers of the M1 phenotype were assessed by QPCR (Table I) in
both wild-type (n = 6) and IL-102/2 muscle (n = 6) after 1 d of
reloading, showing that IL-10 ablation produced increased expression of two Th1-associated transcripts, CCL2 and IL-6 (Fig.
4). However, the expression levels of CD68 and TNF-a were not
significantly affected by the IL-10 mutation. Similarly, expression
levels of markers of the M2 phenotype were assayed in muscle
after 4 d of reloading, showing large, significant reductions in the
expression levels of CD163 and Arg1, although the expression
level of IL-10R1 was not significantly affected (Fig. 5). Together,
these data show that IL-10 plays a significant role in regulating
induction of the M2 macrophage phenotype switch in reloaded
muscle, although IL-10–mediated signaling does not influence the
expression of all Th1 or Th2 cytokines in injured muscles in vivo.
FIGURE 2. CD163+ macrophage distribution in soleus muscles. (A, C,
E, G) Wild-type muscles. (B, D, F, H) IL-10–null mutant muscles. (A and
B) Ambulatory control muscles showing CD163+ macrophages (arrows) in
the endomysium surrounding muscles. (C and D) In muscles experiencing
unloading only, the numbers and distribution of CD163+ macrophages
(arrows) did not differ from ambulatory controls, and fibers are atrophied.
(E and F) At 1 d of muscle reloading, both wild-type and IL-10–null
muscles show numbers of CD163+ macrophages (arrows) that are similar
to ambulatory controls. (G and H) At 4 d of reloading, CD163+ macrophage (arrows) numbers have increased substantially in wild-type muscle,
but they show little increase in IL-10–null muscles. All microphotographs
were taken at the same magnification. Scale bar, 100 mm.
Null mutation of IL-10 slows muscle fiber repair and
regeneration in vivo
We assayed whether the attenuated shift to a M2 macrophage
phenotype in IL-10–null mutants influenced muscle fiber injury
and regeneration that occur during the first 4 d of muscle reloading.
Sections of soleus muscles were immunolabeled with FITC-conjugated anti-mouse IgG to assay for the presence of extracellular
protein (Ig) in the muscle fiber cytoplasm, indicating the presence
of muscle membrane lesions that permitted unregulated transit of
large molecules across the cell membrane. The number of muscle
fibers containing cytosolic IgG did not differ between wild-type
and IL-102/2 mice in 1-d reloaded muscles (Fig. 6). In wild-type
mice, there was an 80% reduction in the percentage of IgG+
muscle fibers from days 1 to 4 of reloading; this indicates that the
majority of muscle membrane repair occurred between 1 and 4 d
reloading, which is consistent with previous findings (31). However,
the number of injured muscle fibers in IL-102/2 mice was not reduced at 4 d of reloading compared with 1 d of reloading (Fig. 6C),
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 1. CD68+ macrophage distribution in soleus muscles. (A, C, E,
G) Wild-type muscles. (B, D, F, H) IL-10-null mutant muscles. (A and B)
Ambulatory control muscles showing CD68+ macrophages (arrows) in the
endomysium surrounding muscles. CD68+ macrophages in wild-type muscles were frequently near blood vessels (*). (C and D) In muscles experiencing unloading without subsequent reloading, the numbers and distribution
of CD68+ macrophages (arrows) were similar to those observed in ambulatory controls. Muscle fiber diameters are reduced because of atrophy
during unloading. (E and F) At 1 d of muscle reloading following unloading,
wild-type and IL-10–null muscles show identical increases in the numbers
of CD68+ macrophages (arrows). (G and H) At 4 d of reloading, CD68+
macrophage (arrows) numbers have begun to decline in wild-type muscle but
remain elevated in IL-10–null muscle. All microphotographs were taken at
the same magnification. Scale bar, 100 mm.
The Journal of Immunology
3673
indicating that null mutation of IL-10 either impairs muscle membrane repair during reloading or that recurring membrane damage
persists for longer periods in the absence of IL-10.
Null mutation of IL-10 also impairs muscle regeneration during
muscle reloading. No significant difference in muscle fiber central
nucleation was observed between IL-102/2 and wild-type mice at
1 d of reloading (Fig. 6D). However, there was a 4-fold increase in
central nucleation between 1 and 4 d of reloading in wild-type mice,
suggesting that muscle experiences regeneration during this period
of reloading. However, the increase in central nucleation at 4 d of
reloading was less in IL-102/2 muscles (Fig. 6D), indicating that
IL-10 mediates processes that promote muscle regeneration.
Loss of IL-10–mediated signaling perturbs muscle
differentiation and reduces growth during regeneration
Our qualitative observations of muscle fiber histology (Figs. 1, 2)
suggested that muscle fibers in IL-102/2 mice regained their normal
size during reloading more slowly than did wild-type muscle fibers,
suggesting possible defects in growth and differentiation. We
assayed changes in muscle growth in IL-10–null mutant mice by
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 3. Null mutation of IL-10 amplifies CD68high macrophage numbers, reduces M2 macrophage numbers, and perturbs myogenin expression in
injured muscle. Numbers of CD68+ (A), CD163+ (B), MyoD+ (C), and myogenin+ (D) cells in soleus muscles of wild-type and IL-10–null mutants over the
time course of muscle unloading and reloading. (A) Numbers of CD68+ macrophages are increased at 1 d of reloading in wild-type and mutant muscles, and
CD68+ cell numbers begin to decline after 1 d of muscle reloading of wild-type muscle. However, IL-10–null mutants do not experience a decline in CD68+
cells at 4 d of reloading. (B) Numbers of CD163+ macrophages are increased slightly in wild-type muscles at 1 d of reloading but not in mutant muscles at
that time point. Numbers of CD163+ cells are increased in both wild-type and mutant muscles at 4 d of reloading, but the numbers are greatly amplified in
wild-type muscles. (C) The numbers of MyoD-expressing satellite cells show similar increases in wild-type and mutant muscles at 1 d of reloading and
similar reductions in numbers at 4 d of reloading. (D) The numbers of myogenin-expressing satellite cells show large increases in mutant muscle at 1 d of
reloading, although their numbers do not change significantly in wild-type muscles at that time point. QPCR data showing changes in the levels of expression of MyoD (E) and myogenin (F) over the course of muscle unloading and reloading. The changes in gene expression for the two transcripts resemble the changes in the numbers of MyoD+ and myogenin+ cells shown in (C) and (D). Each bar represents the mean and SEM for the muscles collected
from five mice in each data set. All data in each set were normalized relative to expression levels in ambulatory, wild-type muscles, which were set at 1.0.
(G) Image showing an anti-MyoD–labeled satellite cell (arrow) at the surface of a muscle fiber in 1-d reloaded, IL-10–null muscle. Scale bar, 40 mm. (H)
Image showing an anti-myogenin–labeled satellite cell (arrow) at the surface of a muscle fiber in 4-d reloaded, IL-10–null muscle. Scale bar, 40 mm. *p ,
0.05 versus ambulatory control muscle of same genotype, xp , 0.05 versus wild-type muscle under the same treatment conditions, +p , 0.05 versus 1-d
reloaded muscle of same genotype.
3674
IL-10–ACTIVATED MACROPHAGES PROMOTE MUSCLE REGENERATION
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 4. Levels of expression of transcripts related to the Th1 cytokine response during muscle unloading and reloading. Expression levels of CD68
(A), IL-6 (B), CCL2 (C), and TNF-a (D) were all increased at 1 d of reloading in wild-type muscles, reflecting a Th1 cytokine response, although IRF-5 (E),
CCR2 (F), and IL-12 (G) were not increased at that stage. The transcripts that were increased at 1 d of reloading were all significantly reduced by 4 d of
reloading, reflecting resolution of the Th1 cytokine response. Null mutation of IL-10 amplified the Th1 cytokine response at 1 d of reloading, reflected in
significant increases in IL-6 and CCL-2. Each bar represents the mean and SEM for the muscles collected from six mice in each data set. All data in each set
were normalized relative to expression levels in ambulatory, wild-type muscles, which were set at 1.0. *p , 0.05, versus ambulatory control muscle of same
genotype, xp , 0.05 versus wild-type muscle under the same treatment conditions, #p , 0.05 versus 1-d reloaded muscle of same genotype.
measuring changes in muscle fiber size during muscle unloading
and reloading. Consistent with previous findings in rodents subjected to hindlimb unloading (31), 10 d of unloading in wild-type
mice caused ∼40% atrophy in soleus muscle. No significant increase in the cross-sectional area of muscle fibers was observed at
1 d of reloading compared with the fiber size of mice that were
assayed immediately following completion of unloading. However,
there was a rapid increase in the fiber cross-sectional area from 1
to 4 d of reloading in wild-type mice, but that increase did not
occur in IL-102/2 mice (Fig. 6E). We assayed muscle differentiation by quantifying the expression of key myogenic transcription
factors by QPCR and by immunohistochemistry. Neither the expression level of MyoD nor the number of MyoD-expressing cells
was significantly affected by IL-10 mutation at any stage of
muscle unloading or reloading (Fig. 3). However, IL-10–null
mutant mice displayed a greatly increased expression of myogenin
The Journal of Immunology
3675
and significantly more myogenin-expressing cells in 1-d reloaded
muscle (Fig. 3), indicating that normal patterns of muscle differentiation are disrupted by null mutation of IL-10 during muscle
reloading.
M2 macrophages promote muscle cell proliferation without
direct effects on differentiation in vitro
Our in vivo data show that null mutation of IL-10 increased myogenin expression in reloaded muscle, indicating that IL-10 could
affect muscle differentiation either by direct actions on myogenic
cells or by acting through M2 macrophages. We tested these possibilities by analyzing the effects of IL-10 or IL-10–activated M2
macrophages on muscle cell proliferation and differentiation
in vitro. Although we were unable to detect IL-10R expression in
myoblasts at the protein level, expression of both IL-10R1 and IL10R2 was confirmed by RT-PCR in proliferative myoblasts, although IL-10R1 was barely detectable (Fig. 7A).
We assayed whether IL-10 or IL-10–activated macrophages
influenced myoblast proliferation in vitro. Consistent with previous findings (32), we found that the direct application of IL-10 to
myoblasts in vitro did not affect myoblast proliferation but that
coculture of myoblasts with IL-10–activated M2 macrophages
caused significant increases in myoblast proliferation (myoblasts
alone increased 5.5-fold in 48 h [SEM = 0.28]; myoblasts cocul-
tured with IL-10–stimulated macrophages increased 7.4-fold
[SEM = 0.20]; p , 0.01). We then tested whether direct stimulation of myoblasts with IL-10 affected early stages of muscle
differentiation but found no detectable changes in the expression
of MyoD or myogenin when muscle cell extracts were assayed by
Western blots (Fig. 7B). Finally, we tested whether the lack of
effect of direct stimulation of muscle with exogenous IL-10
in vitro could result from a saturation of IL-10 effects on muscle by endogenous IL-10 by assaying whether muscle cells in vitro
expressed IL-10. However, no IL-10 mRNA was detectable in
cultures of subconfluent myoblasts, confluent myoblasts, or differentiated myotubes (Fig. 7C).
Because perturbations of IL-10 expression in vivo influenced
expression of myogenin, but direct application of IL-10 to muscle
cells in vitro did not affect MyoD or myogenin expression, we
assayed whether coculturing muscle cells with IL-10–stimulated
M2 macrophages affected the expression of MyoD or myogenin.
Macrophages were stimulated with IL-10 to drive them to an M2
phenotype or stimulated with both IFN-g and TNF-a to drive
them to an M1 phenotype before coculturing with C2C12 cells.
Western blot analysis of CD163 confirmed that IL-10 stimulation
promoted the M2 phenotype and showed that maximum induction
of CD163 was achieved by 10 ng/ml (Fig. 7D). Western blot
analysis of iNOS expression confirmed induction of the M1
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 5. Levels of expression of transcripts related to the Th2 cytokine response during muscle unloading and reloading. Expression levels of CD163
(A), IL-10 (B), IL-10R1 (C), and Arg1 (D) were elevated at 4-d of reloading in wild-type muscles, reflecting a Th2 cytokine response, although HMOX-1
(E) was not elevated at that stage. Null mutation of IL-10 attenuated the Th2 cytokine response at 4 d of reloading, reflected by significant decreases in
CD163 and Arg1. Each bar represents the mean and SEM for the muscles collected from six mice in each data set. All data in each set were normalized
relative to expression levels in ambulatory, wild-type muscles, which were set at 1.0. *p , 0.05, versus ambulatory control muscle of same genotype, xp ,
0.05 versus wild-type muscle under the same treatment conditions, #p , 0.05 versus 1-d reloaded muscle of same genotype.
3676
IL-10–ACTIVATED MACROPHAGES PROMOTE MUSCLE REGENERATION
Table I.
Primers used to assay expression levels of immune cell- and muscle cell-specific genes
Encoded Protein
Accession
Numbera
Arginase-1
NM_007482
CCL-2
NM_011333
CCR-2
NM_009915
CD68
NM_009853
CD163
NM_01170395.1
NM_010442
IL-4
NM_021283
IL-6
NM_031168
IL-10
NM_010548
IL-10R1
NM_008348
IL-10R2
NM_008349
IL-12
NM_008351
IRF-5
NM_012057
MyoD
NM_010866
Myogenin
NM_031189
TNFa
NM_013693
b-actin
NM_007393
59→39
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
Fwd
Rev
CAATGAAGAGCTGGCTGGTGT
GTGTGAGCATCCACCCAAATG
GCTCAGCCAGATGCAGTTAAC
CTCTCTCTTGAGCTTGGTGAC
CCTGTAAATGCCATGCAAGTTC
GTATGCCGTGGATGAACTGAG
CAAAGCTTCTGCTGTGGAAAT
GACTGGTCACGGTTGCAAG
GCAAAAACTGGCAGTGGG
GTCAAAATCACAGACGGAGC
CAGCATGCCCCAGGATTTG
CTCAGCATTCTCGGCTTGG
GGATGTGCCAAACGTCCTC
GAGTTCTTCTTCAAGCATGGAG
GAACAACGATGATGCACTTGC
CTTCATGTACTCCAGGTAGCTATGGT
CAAGGAGCATTTGAATTCCC
GGCCTTGTAGACACCTTGGTC
CAAGCCCTTCCTATGTGTGG
AGAAAGGCTCAGGCATTGTC
GGACAACTTACTGCATTC
CACCAGGACGGAGACTATG
CGCAGCACTTCAGAATCACA
TCTCCCACAGGAGGTTTCTG
GACAACACCATCTTCAAGGC
GTCACGGCTTTTGTTAAGGGC
GAGCGCATCTCCACAGACAG
AAATCGCATTGGGGTTTGAG
CCAGTACATTGAGCGCCTAC
ACCGAACTCCAGTGCATTGC
CTTCTGTCTACTGAACTTCGGG
CACTTGGTGGTTTGCTACGAC
CAACCGTGAAAAGATGACCC
GTAGATGGGCACAGTGTGGG
Amplicon Size
(bp)
153
153
165
140
164
76
126
154
157
166
157
129
120
178
163
163
157
a
National Center for Biotechnology Information.
macrophage phenotype (Fig. 7E). However, we found that neither
M1 nor M2 macrophages affected expression levels of MyoD or
myogenin (Fig. 7F).
Collectively, these findings indicate that the increase in myogenin expression that occurs in reloaded, IL-10–null mutant muscles
reflects the capacity of M2 macrophages to maintain myoblasts in
a proliferative state, preventing entry into the postmitotic stage of
myogenesis during which myogenin expression increases.
Discussion
The results of the present investigation show that IL-10 plays
a dominant role in regulating macrophage transition to a CD163+
M2 phenotype in regenerative muscle. In the absence of IL-10, no
significant increase in CD163 expression occurred in regenerative
muscle, and the increase in CD163+ M2 cells during the transition
from 1 to 4 d of reloaded muscle was nearly abolished. Our data
also indicate that IL-10 is required in regenerative muscle for
induction of Arg1 expression, another specific indicator of activation of the M2 phenotype. We also observed that the expression
of some transcripts associated with the M1 phenotype, in particular, CCL2 and IL-6, was greatly amplified by IL-10 ablation at
1 d of muscle reloading, indicating that IL-10 has a suppressive
effect on the Th1 cytokine response in injured muscle. The impact
on muscle of perturbing induction of the M2 macrophage phenotype was substantial; muscle fiber growth was significantly slowed,
muscle membrane lesions persisted, and muscle regeneration was
reduced, which emphasize the important role of IL-10–activated
macrophages in modulating muscle repair.
Previous observations already established that shifts in macrophage phenotype coincide with transitions in the stage of myogenesis
in regenerating muscle following acute injury. For example,
CD68high macrophages reach maximum numbers at ∼2 d following
muscle injury and then decline (7, 38). The number of CD163+ macrophages begins to increase in regenerative muscle at ∼2 d postinjury and reaches maximum levels at ∼4 d (7, 10). Suggestively,
that shift in macrophage phenotype coincides with changes in expression of myogenic regulatory transcription factors. Injection of
cardiotoxin into soleus muscle increases MyoD expression at
2 d postinjury (39), and myogenin expression is elevated in muscle
fibers at ∼1 d following the increase in MyoD (21). Other muscleinjury models show a similar time course in the increase in MyoD
at ∼2 d postinjury, followed by the elevated expression of other,
developmentally regulated transcripts (40).
The transition during myogenesis to a stage at which myogenin
expression is elevated is developmentally important, because it
represents the transition from a proliferative population of myogenic cells that is unable to undergo terminal differentiation to
a population that has permanently withdrawn from the cell cycle
and enters early stages of differentiation (41). We had anticipated
that if shifts in macrophage phenotype and the stage of myogenesis that occur in injured muscle in vivo were linked, then
disruptions in macrophage phenotype switching would prevent the
transition to early differentiation of myogenic cells that would be
reflected in lower myogenin expression. Although our findings
show that obstructing the shift to the M2 phenotype disrupts
normal patterns of muscle differentiation and slows muscle growth,
we unexpectedly found that amplifying the Th1 cytokine response
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
HMOX-1
Direction
The Journal of Immunology
at 1 d of reloading by ablating IL-10 expression increased the
number of myogenin-expressing satellite cells. In addition, our data
and previous findings (32) show that IL-10–stimulated M2 macrophages increase the proliferation of myoblasts in cocultures, also
indicating a role for M2 macrophages in promoting the proliferative
stage of myogenesis, rather than mediating the transition to early
differentiation. Furthermore, our data show that the significant reduction of myogenin expression that occurs between 1 and 4 d of
reloading in wild-type muscles coincides with the large increase in
CD163+ M2 macrophages and increase in IL-10 expression, supporting the interpretation that M2 macrophages suppress myogenin
expression in vivo. These findings contrast with a previous report
that showed that cocultures of muscle cells with macrophages that
had been activated with the corticosteroid dexamethasone together
with IL-10 caused no change in myoblast proliferation, but they
increased myogenin expression (18). Those findings suggest that the
FIGURE 7. MyoD and myogenin expression are unaffected by direct
stimulation with IL-10 or coculture with IL-10–stimulated M2 macrophages. (A) RT-PCR was used to confirm that C2C12 myoblasts can express both IL-10R1 and IL-10R2. The 18S ribosomal subunit was used as
a loading control. (B) Western blots of muscle cell extracts following
treatment with 10 ng/mg IL-10 shows that direct application of IL-10 for
24 h did not affect expression of MyoD or myogenin. Ponceau red staining
of membranes that were subsequently used for Ab incubations was used to
confirm uniform loading of the gels and transfer of proteins to the membrane (loading). The Western blots shown are representative of three independent experiments. (C) RT-PCR showed that muscle cells in vitro do
not express IL-10, suggesting that lack of treatment effect with exogenous
IL-10 was not attributable to saturation by endogenous IL-10. Lane 1
sample was obtained from 70% confluent cultures of proliferative muscle
cells. Lane 2 was from 100% confluent cultures. Lane 3 was obtained from
differentiated myotube (Myot.) cultures, 2 d after transfer to differentiation
medium. Lane 4 used RNA isolated from inflamed, dystrophic muscle from
mice in the mdx line as a positive control. The 18S ribosomal subunit is
used as a loading control. The results are representative of those obtained
from three independent experiments. (D) Western blot of extracts of
macrophages stimulated with IL-10 for 24 h. IL-10 induction of CD163
expression indicates increased activation to the M2 phenotype. The blot is
representative of three independent experiments. (E) Western blot of
extracts of macrophages stimulated with TNF-a and IFN-g for 24 h. Induction of iNOS indicates activation to the M1 phenotype. (F) Western blot
of extracts of myoblasts cultured in the absence of macrophages (Muscle
only), in the presence of M1 macrophages activated by TNF-a and IFN-g
(M1), in the presence of M2 macrophages stimulated with IL-10 (M2), or in
the presence of macrophages that were not treated with cytokines (Unstim.)
No detectable changes in the levels of expression of MyoD or myogenin
were observed in any coculture conditions compared with myoblasts alone.
The results are representative of those obtained from three independent
experiments. Ponceau red staining of the Western blot membranes (Loading) was used to confirm uniform loading and transfer of samples.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 6. IL-10 mutants experience reductions in muscle fiber repair,
regeneration, and growth during reloading. Cross-section of soleus muscles
from wild-type (A) or IL-10–null mutant (B) mice from 4-d reloaded mice
labeled with FITC-conjugated, anti-mouse IgG. The presence of IgG in the
muscle fiber cytosol (arrows) indicates the presence of membrane lesions
large enough to allow influx of IgG from the extracellular space. Scale
bars, 100 mm. (C) Quantification of the number of IgG+ muscle fibers in
unloaded (Unl.) and 1-d and 4-d reloaded muscles indicates that membrane
lesions caused by muscle reloading are repaired between days 1 and 4 of
reloading in wild-type, but not IL-10 mutant, muscles. (D) Quantification
of the proportion of central-nucleated muscle fibers in reloaded muscles
shows that the increase in regenerative muscle fibers that occurs in wildtype muscles between 1 and 4 d of reloading is diminished in IL-10–null
mutants. (E) Muscle fiber growth during reloading was assayed by measuring changes in cross-sectional area of the muscle fibers in soleus muscle
sections. Note that fiber size in ambulatory controls (Amb.) did not differ
between wild-type and IL-10 mutant muscles and that mutation of IL-10
did not affect the atrophy of fibers that occurred during unloading (Unl.).
However, fiber growth that occurred during 4 d of reloading did not occur
in IL-10 mutants. Each bar represents the mean and SEM for the muscles
collected from six mice in each data set. *p , 0.05 versus 1-d reloaded
muscle of the same genotype, #p , 0.05 versus 4-d reloaded wild-type
muscle.
3677
3678
IL-10–ACTIVATED MACROPHAGES PROMOTE MUSCLE REGENERATION
onset of muscle reloading (53), which coincides with an increase in
M2 macrophage populations.
The IL-10–mediated shift in macrophage phenotype in injured
muscle may be amplified by activation of MAPK, especially p38
MAPK, through signaling that is antagonized by MAPK phosphatase-1 (MKP-1). Although IL-10 can function as either a potent activator of p38 in macrophages (54) or inhibitor of p38 (55,
56), activation of p38 by IL-10 or IL-10–independent pathways
can cause further increases in IL-10 expression and contribute
to macrophage phenotype switch from the M1 to M2 phenotype.
For example, null mutation of MKP-1 caused supraphysiological
levels of p38 activity in macrophages that induced increased expression of IL-10 and TNF-a (57, 58), and the increased levels of
IL-10 and TNF-a are reduced by p38 inhibition (57). Furthermore,
null mutation of MKP-1 increased the number of M2 macrophages
in injured muscle, but that increase was reduced by MAPK inhibitor (59), indicating that p38 activation contributes to the
macrophage phenotype switch in injured muscle, which could
increase the production of IL-10 (60), creating positive feedback
for the phenotype switch. However, if IL-10 activation of p38
promotes the switch to the M2 phenotype during the regeneration
of wild-type muscle, the effect appears to be independent of
HMOX-1 induction. Although IL-10 can suppress the M1 macrophage phenotype by p38 activation of HMOX-1 (54), no changes
in HMOX-1 expression were observed in reloaded muscle in the
present investigation, even at 4 d of reloading when IL-10 expression was greatly increased.
Although this investigation illustrates that IL-10 is required for
normal growth and regeneration of muscle following injury, the
findings are not sufficient to show that further increases in IL-10 in
injured muscle will improve repair. As shown recently, direct injection of IL-10 into injured, wild-type muscle slowed the growth
of regenerative fibers (59). Thus, either the loss of IL-10 or the
application of superphysiological levels of IL-10 can impede
muscle growth and repair following injury. However, the negative
effect of supraphysiological levels of IL-10 may reflect the dose
dependency of IL-10 effects on leukocyte activation. For example,
IL-10 generally functions as an anti-inflammatory cytokine, but
supraphysiological levels of IL-10 administered during sepsis
exacerbate the inflammatory response (61); administration of exogenous IL-10 at low doses is protective against graft-versus-host
disease, whereas higher dosages promote lethality of the disease
(62). Thus, developing IL-10 treatments that are useful for promoting muscle repair and regeneration following injury will require identification of therapeutically appropriate dosing with
exogenous IL-10 or precise manipulations of the levels of IL-10
expression by leukocytes in vivo (63).
Disclosures
The authors have no financial conflicts of interest.
References
1. Tidball, J. G., and S. A. Villalta. 2010. Regulatory interactions between muscle
and the immune system during muscle regeneration. Am. J. Physiol. Regul.
Integr. Comp. Physiol. 298: R1173–R1187.
2. Smith, J. K., M. B. Grisham, D. N. Granger, and R. J. Korthuis. 1989. Free
radical defense mechanisms and neutrophil infiltration in postischemic skeletal
muscle. Am. J. Physiol. 256: H789–H793.
3. Nguyen, H. X., A. J. Lusis, and J. G. Tidball. 2005. Null mutation of myeloperoxidase in mice prevents mechanical activation of neutrophil lysis of muscle
cell membranes in vitro and in vivo. J. Physiol. 565: 403–413.
4. Nguyen, H. X., and J. G. Tidball. 2003. Null mutation of gp91phox reduces
muscle membrane lysis during muscle inflammation in mice. J. Physiol. 553:
833–841.
5. Nguyen, H. X., and J. G. Tidball. 2003. Interactions between neutrophils and
macrophages promote macrophage killing of rat muscle cells in vitro. J. Physiol.
547: 125–132.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
influence of dexamethasone on M2 macrophages overwhelmed the
influence of IL-10 on macrophage-mediated effects on muscle cells,
at least in the muscle coculture experiments.
The effect of IL-10 ablation on myogenin expression in injured
muscle in vivo may be mediated indirectly by changes in the
expression of other cytokines that can influence myogenin expression. For example, the large increase in myogenin expression
and increase in numbers of myogenin-expressing satellite cells that
we observed in IL-10 mutants at 1 d of reloading coincided with
large increases in IL-6 expression. However, the relationships
between IL-6 and myoblast proliferation and differentiation are
complex; IL-6 is well established as a muscle mitogen (25) that
plays a significant role in muscle fiber growth (42), but it can
also induce muscle wasting (43). Nevertheless, IL-6 treatment of
myoblasts in vitro was reported to increase myogenin expression
(44), and a recent investigation showed a strong, positive effect of
IL-6 on myogenin expression in vivo (45). Unlike in wild-type
mice, myogenin expression did not increase in skeletal muscle of
IL-6–null mutant mice at 1 d of muscle reloading (45), although
interpretation of the finding is complicated by the higher baseline
level of myogenin in the muscles of IL-6 mutants. Similarly, the
increase in myogenin expression in reloaded muscles of IL-10–null
mice may be attributable to the loss of increased TNF-a expression
in the injured muscles of mutants. Application of TNF-a to muscle
cells in vitro can greatly diminish myogenin expression (46–48) that
can result from activation of c-Jun N-terminal kinase (49).
The mechanism through which IL-10 promotes the shift in
muscle macrophages to the M2 phenotype is not known, although
several observations indicate that activation of phagocytosis may
be a component of the signaling pathway. Recent findings showed
that IL-10 stimulation of macrophages isolated from skeletal
muscles increases the phagocytic activity of macrophages (32), as
shown previously for circulating macrophages (50). Furthermore,
phagocytosis of cellular debris by M1 macrophages can promote
their transition to the M2 phenotype in vitro (18). In addition,
depletion of populations of phagocytic muscle macrophages in
vivo by the administration of clodronate-containing liposomes
specifically reduced the numbers of M2 macrophages (32), possibly reflecting a decrease in the M1-to-M2 phenotype switch
caused by the depletion of phagocytes. However, based on in vitro
observations by previous investigators, the induction of the M1-toM2 phenotype transition by phagocytosis may be greatly influenced by the identity of the phagocytosed material, so that
phagocytosis is not sufficient to drive the change in macrophage
phenotype. For example, if the debris to be phagocytosed was
generated by neutrophil lysis, then phagocytosis by macrophages
causes great increases in IL-10 production, reflecting a switch to
the M2 phenotype (51). However, an increase in IL-10 production
does not occur if the debris results from lymphocyte death (51).
These findings indicate that phagocytosis may promote the M2
macrophage phenotype during innate immune responses, which
occurs in injured muscle, but perhaps not in an acquired immune
response. Furthermore, phagocytosis of apoptotic neutrophils by
M1 macrophages increased production of the Th2 cytokine TGF-b
by the macrophages, while reducing expression of the Th1 cytokines IL-1b and TNF-a, reflecting a shift toward an M2 phenotype
(52). However, if the neutrophils were opsonized with anti-CD45,
their phagocytosis did not cause a shift in phenotype (52). Those
observations indicate that phagocytosis of apoptotic neutrophils
during an innate immune response can induce the M1-to-M2 phenotype switch in macrophages. Interestingly, these cues for macrophage phenotype switch are in place in reloaded skeletal muscle
at the time of the M1-to-M2 transition in vivo. The peak of apoptosis and phagocytosis of inflammatory cells occurs 2 d after the
The Journal of Immunology
32. Villalta, S. A., C. Rinaldi, B. Deng, G. Liu, B. Fedor, and J. G. Tidball. 2011.
Interleukin-10 reduces the pathology of mdx muscular dystrophy by deactivating
M1 macrophages and modulating macrophage phenotype. Hum. Mol. Genet. 20:
790–805.
33. Morey-Holton, E. R., and R. K. Globus. 2002. Hindlimb unloading rodent
model: technical aspects. J. Appl. Physiol. 92: 1367–1377.
34. Thomason, D. B., and F. W. Booth. 1990. Atrophy of the soleus muscle by
hindlimb unweighting. J. Appl. Physiol. 68: 1–12.
35. Hainsey, T. A., S. Senapati, D. E. Kuhn, and J. A. Rafael. 2003. Cardiomyopathic
features associated with muscular dystrophy are independent of dystrophin absence in cardiovasculature. Neuromuscul. Disord. 13: 294–302.
36. Munder, M., K. Eichmann, J. M. Morán, F. Centeno, G. Soler, and M. Modolell.
1999. Th1/Th2-regulated expression of arginase isoforms in murine macrophages and dendritic cells. J. Immunol. 163: 3771–3777.
37. Philippidis, P., J. C. Mason, B. J. Evans, I. Nadra, K. M. Taylor, D. O. Haskard,
and R. C. Landis. 2004. Hemoglobin scavenger receptor CD163 mediates
interleukin-10 release and heme oxygenase-1 synthesis: antiinflammatory
monocyte-macrophage responses in vitro, in resolving skin blisters in vivo, and
after cardiopulmonary bypass surgery. Circ. Res. 94: 119–126.
38. Frenette, J., B. Cai, and J. G. Tidball. 2000. Complement activation promotes
muscle inflammation during modified muscle use. Am. J. Pathol. 156: 2103–
2110.
39. Launay, T., A. S. Armand, F. Charbonnier, J. C. Mira, E. Donsez, C. L. Gallien,
and C. Chanoine. 2001. Expression and neural control of myogenic regulatory
factor genes during regeneration of mouse soleus. J. Histochem. Cytochem. 49:
887–899.
40. McLoon, L. K., L. T. Nguyen, and J. Wirtschafter. 1998. Time course of the
regenerative response in bupivacaine injured orbicularis oculi muscle. Cell Tissue Res. 294: 439–447.
41. Chargé, S. B., and M. A. Rudnicki. 2004. Cellular and molecular regulation of
muscle regeneration. Physiol. Rev. 84: 209–238.
42. Serrano, A. L., B. Baeza-Raja, E. Perdiguero, M. Jardı́, and P. Muñoz-Cánoves.
2008. Interleukin-6 is an essential regulator of satellite cell-mediated skeletal
muscle hypertrophy. Cell Metab. 7: 33–44.
43. Haddad, F., F. Zaldivar, D. M. Cooper, and G. R. Adams. 2005. IL-6-induced
skeletal muscle atrophy. J. Appl. Physiol. 98: 911–917.
44. Okazaki, S., H. Kawai, Y. Arii, H. Yamaguchi, and S. Saito. 1996. Effects of
calcitonin gene-related peptide and interleukin 6 on myoblast differentiation.
Cell Prolif. 29: 173–182.
45. Washington, T. A., J. P. White, J. M. Davis, L. B. Wilson, L. L. Lowe, S. Sato,
and J. A. Carson. 2011. Skeletal muscle mass recovery from atrophy in IL-6
knockout mice. Acta Physiol. (Oxf.) 202: 657–669.
46. Szalay, K., Z. Rázga, and E. Duda. 1997. TNF inhibits myogenesis and downregulates the expression of myogenic regulatory factors myoD and myogenin.
Eur. J. Cell Biol. 74: 391–398.
47. Layne, M. D., and S. R. Farmer. 1999. Tumor necrosis factor-alpha and basic
fibroblast growth factor differentially inhibit the insulin-like growth factor-I
induced expression of myogenin in C2C12 myoblasts. Exp. Cell Res. 249:
177–187.
48. Chen, S. E., B. Jin, and Y. P. Li. 2007. TNF-alpha regulates myogenesis and
muscle regeneration by activating p38 MAPK. Am. J. Physiol. Cell Physiol. 292:
C1660–C1671.
49. Strle, K., S. R. Broussard, R. H. McCusker, W. H. Shen, J. M. LeCleir,
R. W. Johnson, G. G. Freund, R. Dantzer, and K. W. Kelley. 2006. C-jun
N-terminal kinase mediates tumor necrosis factor-alpha suppression of differentiation in myoblasts. Endocrinology 147: 4363–4373.
50. Montoya, D., D. Cruz, R. M. Teles, D. J. Lee, M. T. Ochoa, S. R. Krutzik,
R. Chun, M. Schenk, X. Zhang, B. G. Ferguson, et al. 2009. Divergence of
macrophage phagocytic and antimicrobial programs in leprosy. Cell Host Microbe 6: 343–353.
51. Fadok, V. A., D. L. Bratton, L. Guthrie, and P. M. Henson. 2001. Differential
effects of apoptotic versus lysed cells on macrophage production of cytokines:
role of proteases. J. Immunol. 166: 6847–6854.
52. Fadok, V. A., D. L. Bratton, A. Konowal, P. W. Freed, J. Y. Westcott, and
P. M. Henson. 1998. Macrophages that have ingested apoptotic cells in vitro
inhibit proinflammatory cytokine production through autocrine/paracrine
mechanisms involving TGF-beta, PGE2, and PAF. J. Clin. Invest. 101:
890–898.
53. Tidball, J. G., and B. A. St Pierre. 1996. Apoptosis of macrophages during the
resolution of muscle inflammation. J. Leukoc. Biol. 59: 380–388.
54. Lee, T. S., and L. Y. Chau. 2002. Heme oxygenase-1 mediates the antiinflammatory effect of interleukin-10 in mice. Nat. Med. 8: 240–246.
55. Kontoyiannis, D., A. Kotlyarov, E. Carballo, L. Alexopoulou, P. J. Blackshear,
M. Gaestel, R. Davis, R. Flavell, and G. Kollias. 2001. Interleukin-10 targets p38
MAPK to modulate ARE-dependent TNF mRNA translation and limit intestinal
pathology. EMBO J. 20: 3760–3770.
56. Rajasingh, J., E. Bord, C. Luedemann, J. Asai, H. Hamada, T. Thorne, G. Qin,
D. Goukassian, Y. Zhu, D. W. Losordo, and R. Kishore. 2006. IL-10-induced
TNF-alpha mRNA destabilization is mediated via IL-10 suppression of p38
MAP kinase activation and inhibition of HuR expression. FASEB J. 20: 2112–
2114.
57. Chi, H., S. P. Barry, R. J. Roth, J. J. Wu, E. A. Jones, A. M. Bennett, and
R. A. Flavell. 2006. Dynamic regulation of pro- and anti-inflammatory cytokines
by MAPK phosphatase 1 (MKP-1) in innate immune responses. Proc. Natl.
Acad. Sci. USA 103: 2274–2279.
58. Zhao, Q., X. Wang, L. D. Nelin, Y. Yao, R. Matta, M. E. Manson, R. S. Baliga,
X. Meng, C. V. Smith, J. A. Bauer, et al. 2006. MAP kinase phosphatase 1
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
6. Villalta, S. A., H. X. Nguyen, B. Deng, T. Gotoh, and J. G. Tidball. 2009. Shifts
in macrophage phenotypes and macrophage competition for arginine metabolism
affect the severity of muscle pathology in muscular dystrophy. Hum. Mol. Genet.
18: 482–496.
7. St Pierre, B. A., and J. G. Tidball. 1994. Differential response of macrophage
subpopulations to soleus muscle reloading after rat hindlimb suspension. J. Appl.
Physiol. 77: 290–297.
8. Kasper, C. E. 1995. Sarcolemmal disruption in reloaded atrophic skeletal muscle. J. Appl. Physiol. 79: 607–614.
9. Krippendorf, B. B., and D. A. Riley. 1993. Distinguishing unloading- versus
reloading-induced changes in rat soleus muscle. Muscle Nerve 16: 99–108.
10. McLennan, I. S. 1993. Resident macrophages (ED2- and ED3-positive) do not
phagocytose degenerating rat skeletal muscle fibres. Cell Tissue Res. 272: 193–
196.
11. Warren, G. L., L. O’Farrell, M. Summan, T. Hulderman, D. Mishra, M. I. Luster,
W. A. Kuziel, and P. P. Simeonova. 2004. Role of CC chemokines in skeletal
muscle functional restoration after injury. Am. J. Physiol. Cell Physiol. 286:
C1031–C1036.
12. Warren, G. L., T. Hulderman, D. Mishra, X. Gao, L. Millecchia, L. O’Farrell,
W. A. Kuziel, and P. P. Simeonova. 2005. Chemokine receptor CCR2 involvement in skeletal muscle regeneration. FASEB J. 19: 413–415.
13. Shireman, P. K., V. Contreras-Shannon, O. Ochoa, B. P. Karia, J. E. Michalek,
and L. M. McManus. 2007. MCP-1 deficiency causes altered inflammation with
impaired skeletal muscle regeneration. J. Leukoc. Biol. 81: 775–785.
14. Contreras-Shannon, V., O. Ochoa, S. M. Reyes-Reyna, D. Sun, J. E. Michalek,
W. A. Kuziel, L. M. McManus, and P. K. Shireman. 2007. Fat accumulation
with altered inflammation and regeneration in skeletal muscle of CCR22/2
mice following ischemic injury. Am. J. Physiol. Cell Physiol. 292: C953–
C967.
15. Ochoa, O., D. Sun, S. M. Reyes-Reyna, L. L. Waite, J. E. Michalek,
L. M. McManus, and P. K. Shireman. 2007. Delayed angiogenesis and VEGF
production in CCR22/2 mice during impaired skeletal muscle regeneration. Am.
J. Physiol. Regul. Integr. Comp. Physiol. 293: R651–R661.
16. Sun, D., C. O. Martinez, O. Ochoa, L. Ruiz-Willhite, J. R. Bonilla,
V. E. Centonze, L. L. Waite, J. E. Michalek, L. M. McManus, and P. K. Shireman.
2009. Bone marrow-derived cell regulation of skeletal muscle regeneration.
FASEB J. 23: 382–395.
17. Lu, H., D. Huang, R. M. Ransohoff, and L. Zhou. 2011. Acute skeletal muscle
injury: CCL2 expression by both monocytes and injured muscle is required for
repair. FASEB J. 25: 3344–3355.
18. Arnold, L., A. Henry, F. Poron, Y. Baba-Amer, N. van Rooijen, A. Plonquet,
R. K. Gherardi, and B. Chazaud. 2007. Inflammatory monocytes recruited after
skeletal muscle injury switch into antiinflammatory macrophages to support
myogenesis. J. Exp. Med. 204: 1057–1069.
19. Collins, C. A., and T. A. Partridge. 2005. Self-renewal of the adult skeletal
muscle satellite cell. Cell Cycle 4: 1338–1341.
20. Cornelison, D. D., and B. J. Wold. 1997. Single-cell analysis of regulatory gene
expression in quiescent and activated mouse skeletal muscle satellite cells. Dev.
Biol. 191: 270–283.
21. Yablonka-Reuveni, Z., and A. J. Rivera. 1994. Temporal expression of regulatory
and structural muscle proteins during myogenesis of satellite cells on isolated
adult rat fibers. Dev. Biol. 164: 588–603.
22. Cantini, M., and U. Carraro. 1995. Macrophage-released factor stimulates selectively myogenic cells in primary muscle culture. J. Neuropathol. Exp. Neurol.
54: 121–128.
23. Merly, F., L. Lescaudron, T. Rouaud, F. Crossin, and M. F. Gardahaut. 1999.
Macrophages enhance muscle satellite cell proliferation and delay their differentiation. Muscle Nerve 22: 724–732.
24. Cantini, M., M. L. Massimino, A. Bruson, C. Catani, L. Dalla Libera, and
U. Carraro. 1994. Macrophages regulate proliferation and differentiation of
satellite cells. Biochem. Biophys. Res. Commun. 202: 1688–1696.
25. Cantini, M., M. L. Massimino, E. Rapizzi, K. Rossini, C. Catani, L. Dalla Libera,
and U. Carraro. 1995. Human satellite cell proliferation in vitro is regulated by
autocrine secretion of IL-6 stimulated by a soluble factor(s) released by activated
monocytes. Biochem. Biophys. Res. Commun. 216: 49–53.
26. Massimino, M. L., E. Rapizzi, M. Cantini, L. D. Libera, F. Mazzoleni,
P. Arslan, and U. Carraro. 1997. ED2+ macrophages increase selectively
myoblast proliferation in muscle cultures. Biochem. Biophys. Res. Commun.
235: 754–759.
27. Mantovani, A., A. Sica, S. Sozzani, P. Allavena, A. Vecchi, and M. Locati. 2004.
The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 25: 677–686.
28. Schaer, D. J., F. S. Boretti, A. Hongegger, D. Poehler, P. Linnscheid, H. Staege,
C. Müller, G. Schoedon, and A. Schaffner. 2001. Molecular cloning and characterization of the mouse CD163 homologue, a highly glucocorticoid-inducible
member of the scavenger receptor cysteine-rich family. Immunogenetics 53:
170–177.
29. Sulahian, T. H., P. Högger, A. E. Wahner, K. Wardwell, N. J. Goulding, C. Sorg,
A. Droste, M. Stehling, P. K. Wallace, P. M. Morganelli, and P. M. Guyre. 2000.
Human monocytes express CD163, which is upregulated by IL-10 and identical
to p155. Cytokine 12: 1312–1321.
30. Lang, R., D. Patel, J. J. Morris, R. L. Rutschman, and P. J. Murray. 2002.
Shaping gene expression in activated and resting primary macrophages by IL-10.
J. Immunol. 169: 2253–2263.
31. Tidball, J. G., and M. Wehling-Henricks. 2007. Macrophages promote muscle
membrane repair and muscle fibre growth and regeneration during modified
muscle loading in mice in vivo. J. Physiol. 578: 327–336.
3679
3680
IL-10–ACTIVATED MACROPHAGES PROMOTE MUSCLE REGENERATION
controls innate immune responses and suppresses endotoxic shock. J. Exp. Med.
203: 131–140.
59. Perdiguero, E., P. Sousa-Victor, V. Ruiz-Bonilla, M. Jardı́, C. Caelles,
A. L. Serrano, and P. Muñoz-Cánoves. 2011. p38/MKP-1-regulated AKT coordinates macrophage transitions and resolution of inflammation during tissue
repair. J. Cell Biol. 195: 307–322.
60. Foey, A. D., S. L. Parry, L. M. Williams, M. Feldmann, B. M. Foxwell, and
F. M. Brennan. 1998. Regulation of monocyte IL-10 synthesis by endogenous
IL-1 and TNF-alpha: role of the p38 and p42/44 mitogen-activated protein
kinases. J. Immunol. 160: 920–928.
61. Lauw, F. N., D. Pajkrt, C. E. Hack, M. Kurimoto, S. J. van Deventer, and T. van
der Poll. 2000. Proinflammatory effects of IL-10 during human endotoxemia.
J. Immunol. 165: 2783–2789.
62. Blazar, B. R., P. A. Taylor, A. Panoskaltsis-Mortari, S. K. Narula, S. R. Smith,
M. G. Roncarolo, and D. A. Vallera. 1998. Interleukin-10 dose-dependent regulation of CD4+ and CD8+ T cell-mediated graft-versus-host disease. Transplantation 66: 1220–1229.
63. Cope, A., G. Le Friec, J. Cardone, and C. Kemper. 2011. The Th1 life cycle:
molecular control of IFN-g to IL-10 switching. Trends Immunol. 32: 278–
286.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017