Download Tax-dependent Displacement of Nucleosomes during

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 19, pp. 13075–13082, May 12, 2006
© 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
Tax-dependent Displacement of Nucleosomes during
Transcriptional Activation of Human T-Cell
Leukemia Virus Type 1*
Received for publication, November 14, 2005, and in revised form, March 17, 2006 Published, JBC Papers in Press, March 18, 2006, DOI 10.1074/jbc.M512193200
Isabelle Lemasson1,2, Nicholas J. Polakowski1,2, Paul J. Laybourn3, and Jennifer K. Nyborg
From the Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, Colorado 80523-1870
Human T-cell leukemia virus type 1 (HTLV-1)4 is the etiological
agent of adult T-cell leukemia and HTLV-1-associated myelopathy/
tropical spastic paraparesis (1– 4). Although not fully understood, the
cellular events leading to the onset of both diseases appear to be initiated
by the HTLV-1-encoded Tax protein (5). Tax functions as a potent
* This study was supported by NCI, National Institutes of Health Grants CA55035 (to
J. K. N.) and CA87540 (to P. J. L. and J. K. N.). The costs of publication of this article were
defrayed in part by the payment of page charges. This article must therefore be
hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
1
Both authors contributed equally to this work.
2
Current address: Dept. of Microbiology and Immunology, Brody School of Medicine,
East Carolina University, Greenville, NC 27834.
3
To whom correspondence should be addressed: Dept. of Biochemistry and Molecular
Biology, Colorado State University, Fort Collins, CO 80523-1870. Tel.: 970-491-5100;
E-mail: [email protected].
4
The abbreviations used are: HTLV-1, human T-cell leukemia virus type 1; CRE, cyclic
AMP-response element; CREB, cyclic AMP-response element-binding protein; CBP,
CREB-binding protein; RNAP II, RNA polymerase II; CHO, Chinese hamster ovary; Luc,
luciferase; ChIP, chromatin immunoprecipitation; PCAF, p300/CBP-associated factor;
LTR, long terminal repeat.
MAY 12, 2006 • VOLUME 281 • NUMBER 19
activator of HTLV-1 transcription in part via the formation of a complex with CREB (or other activiting transcription factor/CREB members) and the three CRE enhancer sequences located within the
HTLV-1 promoter (6 – 8). Tax contributes to the stability of the ternary
complex by binding directly to the GC-rich sequences flanking the
octanucleotide CREs (9 –12). These sequences, called viral CREs, are
absolutely required for strong Tax transcriptional activation of HTLV-1
(13–15). Once associated with the promoter, Tax and CREB form a
complex with the cellular coactivators CBP/p300 (16, 17). These coactivators are believed to participate in pre-initiation complex formation,
culminating in strong HTLV-1 transcriptional activation (18).
The HTLV-1 provirus is integrated into the genome of the infected
host cell and assembled into nucleosomes. This chromatin packaging
renders promoter DNA less accessible to the binding of transcription
factors and therefore represses transcription. One mechanism for overcoming this repression is acetylation of the amino-terminal tails of the
nucleosomal histones. This modification is proposed to increase the
accessibility of nucleosomal DNA for transcription factor binding (19 –
21). Additionally, this and other histone modifications can serve as a
platform for the binding of transcriptional regulatory proteins (22). Previous studies have demonstrated that histone deacetylase inhibitors
increase the level of HTLV-1 transcription and that Tax and histone
deacetylase complex occupancy are mutually exclusive (23, 24). It has
also been shown that an increase in histone tail acetylation on HTLV-1
promoter-associated nucleosomes correlates with an increase in viral
RNA in HTLV-1-infected T-cells. Among proteins that carry intrinsic
histone acetyltransferase activity, the coactivators CBP/p300 have been
shown to have an essential role in HTLV-1 transcriptional activation.
Our laboratories, as well as others, detected CBP/p300 at the integrated
HTLV-1 promoter in T-cells expressing high levels of Tax (23, 24). This
finding is consistent with several previous studies showing that Tax
directly facilitates the recruitment of CBP/p300 to the HTLV-1 promoter (16, 17, 25, 26). Furthermore, we and others have shown that the
histone acetyltransferase activity of p300 is essential for strong HTLV-1
transcription in a chromatin context (18, 27). Using chromatin assembled with core histones lacking their amino-terminal tails and using
specific inhibitors of CBP/p300, we have found that CBP/p300 participate in critical chromatin-specific, histone tail-independent acetylation
events during transcriptional activation by Tax (28). These data suggest
that, in addition to the core histone tails, another target of acetylation by
p300 functions in mediating strong Tax transactivation in a chromatin
environment.
In previous studies we have examined transcription factor binding
and histone modifications at the viral promoter in Tax-expressing,
HTLV-1-infected cells (23, 29). In this study, we sought to better define
the epigenetic changes that occur during Tax-dependent activation of
HTLV-1 LTR-directed transcription in vivo. These analyses were performed in cells carrying chromosomally integrated HTLV-1 LTR-lucif-
JOURNAL OF BIOLOGICAL CHEMISTRY
13075
Downloaded from www.jbc.org at Colorado State University, on April 22, 2011
The human T-cell leukemia virus type 1 (HTLV-1) is integrated
into the host cell DNA and assembled into nucleosomes. Within the
repressive chromatin environment, the virally encoded Tax protein
mediates the recruitment of the coactivators CREB-binding protein/p300 to the HTLV-1 promoter, located within the long terminal repeats (LTRs) of the provirus. These proteins carry acetyltransferase activity that is essential for strong transcriptional activation
of the virus in the context of chromatin. Consistent with this, the
amino-terminal tails of nucleosomal histones at the viral promoter
are acetylated in Tax-expressing cells. We have developed a system
in which we transfect Tax into cells carrying integrated copies of the
HTLV-1 LTR driving the luciferase gene to analyze changes in “activating” histone modifications at the LTR. Unexpectedly, Tax transactivation led to an apparent reduction of these modifications at the
HTLV-1 promoter and downstream region that correlates with a
similar reduction in histone H3 and linker histone H1. Micrococcal
nuclease protection analysis showed that less LTR-luciferase DNA
is nucleosomal in Tax-expressing cells. Furthermore, nucleosome
depletion correlated with RNA polymerase II recruitment and loss
of SWI/SNF. The M47 Tax mutant, deficient in HTLV-1 transcriptional activation, was also defective for nucleosome depletion.
Although this mutant formed complexes with CREB and p300 at the
HTLV-1 promoter in vivo, it was unable to mediate RNA polymerase II recruitment or SWI/SNF displacement. These results support
a model in which nucleosomes are depleted from the LTR and transcribed region during Tax-mediated transcriptional activation
and correlate RNA polymerase II recruitment with nucleosome
depletion.
Nucleosome Eviction by Tax
MATERIALS AND METHODS
Cell Culture and Transient Transfection Assays—CHOK1-Luc hamster ovary cells (27) were cultured in Dulbecco’s modified Eagle’s
medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine,
penicillin-streptomycin, and 500 ␮g of G418/ml (Geneticin; Invitrogen). For chromatin immunoprecipitation (ChIP) assays, cells were
electroporated as described previously (31). Briefly, 2 ⫻ 107 cells were
electroporated with a GenePulser Xcell electroporation device from
Bio-Rad in the presence of 20 ␮g of total DNA. The pSG-Tax and
pSG-Tax M47 expression plasmids have been described previously (30,
32). The cells were then harvested at 20 h for luciferase and ChIP analysis. For each experiment, luciferase activity was measured using the
Dual-Luciferase reporter assay system (Promega) with a Turner Designs
model TD 20-e luminometer. The electroporation transfection protocol used in this study produced transfection efficiencies approaching
50%. To enrich the transfected population in most experiments, cells
were selected using the MACSelect System (Miltenyi Biotec). Briefly,
the cells were co-transfected with pSG-Tax and pMACS 4.1 at a 2.5:1
molar ratio of pSG-Tax:pMACS 4.1. After 20 h, the cells were incubated
with magnetic beads conjugated to a monoclonal antibody against the
surface marker encoded by pMACS 4.1 and then passed through a magnetic field.
Antibodies—Antibodies against p300 (catalog number N-15), RNA
polymerase II (catalog number H-224), Brg1 (catalog number H-88) and
hBrm (catalog number N-19) were purchased from Santa Cruz Biotechnology. Antibodies against acetylated lysines 9/14 of histone H3 (catalog
number 06 –599), acetylated lysines 5/8/12/16 of histone H4 (catalog
number 06 – 866 or 06 –598), dimethylated lysine 4 of H3 (catalog number 07– 030), CREB (catalog number 06 – 863), and linker histone H1
(catalog number 05– 457) were purchased from Upstate Biotechnology.
The trimethylated lysine 4 of H3 (catalog number Ab 8580) and histone
H3 (catalog number Ab 1791) antibodies were purchased from Abcam.
Antibodies against acetylated lysine 9 of H3 (catalog number 9671) and
acetylated lysine 8 of H4 (catalog number 2594) were purchased from
13076 JOURNAL OF BIOLOGICAL CHEMISTRY
Cell Signaling Technology. Tax monoclonal antibody (hybridoma
168B17– 46-92) was obtained from the National Institutes of Health
Aids Research and Reference Reagent Program.
ChIP Assays, Real-time PCR, and Primers—ChIP assays, real-time
PCR, and data analysis were performed as previously described (23, 29).
PCR primers were as follows: HTLV-1 promoter (⫺349/⫺81), 5⬘-AATGACCATGAGCCCCA/GTGAGGGGTTGTCGTCA-3⬘; luciferase
proximal (⫹708/⫹804), 5⬘-ATTTATCGGAGTTGCAGTTGCGCC/
AACAAACACTACGGTAGGCTGCGA-3⬘; luciferase distal (⫹1527/
⫹1717), 5⬘-TGAAGCGAAGGTTGTGGATCTGGA/AGAAGTGTTCGTCTTCGTCCCAGT-3⬘; luciferase Region 2 (⫹799/⫹1041), 5⬘-CGCAGTATCCGGAATGATTTGATTGCCA/ACGGATTACCAGGGATTTCAGTCG-3⬘; pGL3 vector 5⬘ (Region 1), 5⬘-GATCGGTGCGGGCCTCTTCGCTATTA/TCGATAGAGAAATGTTCTGGCACCTGCACT-3⬘; pGL3 vector 3⬘ (Region 3), 5⬘-GGG AGGTGTGGGAGGTTT/ACCGTATTACCGCCTTTGAGTGAG-3⬘; ␤-globin promoter, 5⬘-TCACACACTTGACCCTGTGCCATA/TTATATGCCCTGTCCTGGCTCCTT-3⬘. Standard curves were generated for all primer
sets using 5-fold serial dilutions of CHOK1-Luc input DNA and were
included on each experimental plate. PCR efficiencies for all of the
primer sets ranged from 89 –112% with correlation coefficients of 0.99
or greater. Quantitation was done by comparing threshold cycle values
for co-immunoprecipitated DNA to the threshold cycle value for the
input DNA in each ChIP experiment as described previously (33).
Western Blot Analysis—CHOK1-Luc cells transfected with pSG-Tax
or pSG-M47 were resuspended in SDS sample dye. Proteins were separated on a 10% SDS-polyacrylamide gel and analyzed by Western blot
analysis with the indicated antibodies.
Micrococcal Nuclease/Dot Blot Assay—Segments of the LTR-luciferase construct indicated in Fig. 4A and the ␤-globin promoter were
amplified by standard PCR from CHOK1-Luc genomic DNA. The
primers used were (see Fig. 3B) (1) ⫺319/⫺102, 5⬘-GGCTTAGAGCCTCCCAGTGAAA/CTGAGGGCGGCTTGACAAACAT-3⬘; (2)
⫺67/⫹145, 5⬘-TCATGGCACGCATATGGCTGAA/CGGTCTCGACCTGAGCTTTAAACTTACC-3⬘; (5) ⫹799/⫹1041, 5⬘-TTTCGCGGTTGTTACTTGACTGGC/ACTGGGACGAAGACGAACACTTCT-3⬘; (4) ⫹1335/⫹1573, 5⬘-TGTCAATCAAGGCGTTGGTCGCTT/AGGGATACGACAAGGATATGGGCT-3⬘; (3) ⫹1607/⫹1863, 5⬘-CGCAGTATCCGGAATGATTTGATTGCCA/ACGGATTACCAGGGATTTCAGTCG-3⬘. A region of the HTLV-1 env gene, used as a control, was amplified from HTLV-1-infected SLB-1 genomic DNA (5⬘-ACTCTAACCTAGACCACATC/CGTTACCATTTAACTGGACC3⬘). PCR products were purified, spotted in triplicate onto a positively
charged nylon membrane (3 ␮g of DNA/spot), and hybridized with 25
ng of radiolabeled total mononucleosomal DNA from CHOK1-Luc
cells. Total mononucleosomal DNA was prepared by first isolating
nuclei from CHOK1-Luc cells that had been treated with formaldehyde
(1% final concentration at 37 °C for 10 m) as described previously (34).
Nuclei were exposed to micrococcal nuclease, and the nuclear DNA was
extracted and purified as described previously (35). Purified DNA
(found to be at least 80% mononucleosomal) was resolved on a 1.5%
agarose gel, and the band corresponding to mononucleosome-length
DNA was excised and the DNA purified from the gel slice. The mononucleosomal DNA was radiolabeled using the Random Primed Labeling
Kit (Roche Diagnostics) for hybridization with the dot blot membrane.
Following hybridization, membranes were exposed to a phosphorimaging screen and scanned using a Storm phosphorimaging device (Molecular Dynamics). Signal intensities for each triplicate were averaged, and
the average signal for HTLV-1 env was used for background subtraction. Values for LTR-luciferase segments were normalized to the value
VOLUME 281 • NUMBER 19 • MAY 12, 2006
Downloaded from www.jbc.org at Colorado State University, on April 22, 2011
erase constructs in the absence or presence of Tax. This approach
enabled direct correlation of histone modifications and transcription
factor occupancy with or without Tax expression. We characterized
histone H3 acetylation associated with the HTLV-1 promoter and
within the downstream coding region. This histone tail modification is
typically associated with active genes. Unexpectedly, we found that the
level of modified histones was reduced at the promoter and within the
luciferase coding region in the presence of Tax. We determined that this
reduction was a result of a Tax-dependent decrease in nucleosome
density.
To begin to investigate the mechanism of Tax-mediated nucleosome
depletion, we used the activation-deficient M47 Tax mutant (30). We
found that this mutant is also deficient in nucleosome depletion. However, it is fully competent for the formation of a complex with CREB and
p300 on the chromosomally integrated viral promoter. Prompted by the
Tax-dependent loss of nucleosomes from the coding region of the construct, we compared RNA polymerase II (RNAP II) binding at the viral
promoter in cells expressing wild type or M47 Tax. Significantly, we
found that M47 Tax is disabled for recruitment of RNAP II. Interestingly, we also found that the SWI/SNF chromatin remodeling complexes are displaced by wild type Tax and that M47 Tax is defective for
their displacement. These data correlate Tax-mediated SWI/SNF displacement and RNAP II recruitment with nucleosome depletion. We
propose that Tax, SWI/SNF, and RNAP II each plays a role in nucleosome eviction and transcriptional activation of HTLV-1 transcription.
Nucleosome Eviction by Tax
obtained for the ␤-globin promoter. We confirmed that ␤-globin DNA
was represented in the mononucleosomal DNA population by Southern
blot analysis of DNA from MNase-treated CHOK1-Luc cells (data not
shown).
RESULTS
Tax Expression Reduces Histone Tail Acetylation Associated with the
HTLV-1 Promoter and Transcribed Region—There are several lines of
evidence that link Tax-mediated HTLV-1 transcriptional activation
with amino-terminal tail acetylation on core histones occupying the
viral promoter (18, 23, 24). However, the precise role that Tax plays in
mediating these changes has not been examined. Therefore, we were
interested in directly comparing histone acetylation and methylation
patterns on HTLV-1 promoter nucleosomes in the absence and presence of Tax.
To perform these studies, we optimized a system in which we transfected a Tax expression plasmid into CHOK1-Luc cells that carried two
to four integrated copies of the HTLV-1 LTR driving expression of the
firefly luciferase gene (Fig. 1A) (27). Histone modifications at the viral
promoter and within the luciferase gene were analyzed using the ChIP
assay. Changes in acetylation were subsequently determined using realtime PCR with a primer set that specifically amplified a region of the
HTLV-1 promoter surrounding the three viral CREs and primer sets
that amplified a proximal and distal segment of the transcribed luciferase coding region (Fig. 1A). Data was quantified by comparing the signal
from the co-immunoprecipitated DNA to that of the input DNA in each
MAY 12, 2006 • VOLUME 281 • NUMBER 19
JOURNAL OF BIOLOGICAL CHEMISTRY
13077
Downloaded from www.jbc.org at Colorado State University, on April 22, 2011
FIGURE 1. Tax-dependent transcriptional activation of HTLV-1 causes a reduction in
the level of histone tail modifications over the viral promoter and within the luciferase gene. A, schematic representation of the integrated HTLV-1 LTR-luciferase construct in CHOK1-Luc cells. LTR and luciferase proximal and distal amplicons used in the
real-time PCR are indicated. B, quantification of relative H3 Lys-9/14 acetylation levels at
the integrated HTLV-1 promoter and a distal region of the luciferase gene. CHOK1-Luc
cells were transfected with pSG-Tax or pUC19 as control. ChIP analysis was performed
20 h following transfection, and real-time PCR was used to quantify the DNA in the
immunoprecipitations. Histone H3 acetylation levels in the presence of Tax were normalized to respective levels in the absence of Tax (set to 1). The ChIP experiments were
performed eight times for the LTR region and three times for the luciferase gene, and the
averages from all experiments is shown. C, transfection of Tax does not affect the global
level of Lys-9/14-acetylated H3 protein. Western blot using whole cell extract of CHOK1Luc cells transfected with pUC19 (control (⫺)) or pSG-Tax (20 h post-transfection). The
blot was probed with an antibody against H3 ac-Lys-9/14. The positions of the molecular
weight markers are indicated.
experiment. The CHOK1-Luc cells were initially developed to compare
activation from a transiently transfected versus an integrated HTLV-1
promoter, which demonstrated the importance of using chromosomally integrated promoter constructs (27). The integrated HTLV-1 promoter is the true physiological substrate for transcription factor binding
and Tax transactivation, as the provirus is packaged into nucleosomes
following integration into the host cell chromosome. We have used
these cells in a previous study to demonstrate mutually exclusive binding of Tax and histone deacetylase complexes at the HTLV-1 promoter
(29).
Using the quantitative ChIP assay, we measured a histone modification typically associated with active genes (acetylation at H3 Lys-9/14)
on nucleosomes present on the LTR-luciferase construct in CHOK1Luc cells. Many “activating” histone modifications were previously
identified on nucleosomes associated with the provirus in Tax-expressing HTLV-1 infected cells (23). CHOK1-Luc cells were transfected with
a Tax expression plasmid or a control plasmid, and samples were analyzed 20 h following transfection. Fig. 1B shows the results of this study.
Unexpectedly, we found that Tax expression led to a ⬎50% decrease in
the detection of H3 Lys-9/14 acetylation at the HTLV-1 promoter and
within the luciferase gene.
A similar decrease was observed in a time course experiment examining H3 acetylation levels following transfection of Tax (data not
shown). These results indicate that Tax recruitment to the HTLV-1
promoter directly correlates with the loss of histone acetylation at the
promoter and within the luciferase gene. We also looked at other activating modifications of H3 and H4 and obtained similar results (data not
shown). Fig. 1C shows that Tax expression did not produce a global
reduction in the H3 acetylation level in the transfected CHOK-Luc cells.
Loss of Chromatin Modifications during Tax-mediated Activation
Correlates with the Loss of Histone H3 and Linker Histone H1—The
decrease in histone acetylation at the HTLV-1 promoter upon Tax
transactivation was unexpected and is antithetical to widely accepted
models of chromatin modifications associated with transcriptional activation. Therefore, we hypothesized that the observed decline in histone
tail acetylation upon transcriptional activation by Tax was due to a loss
of histones from the integrated LTR-luciferase construct. To test this
hypothesis, we used the ChIP assay to analyze histone H3 binding in the
absence and presence of Tax. The antibody used in these experiments
recognizes the carboxyl-terminal region of histone H3, which lacks sites
of post-translational modification and should provide a constitutively
available epitope. Using this antibody, we showed that the level of histone H3 associated with the HTLV-1 promoter was reduced by nearly
50% during Tax transactivation (Fig. 2A). Furthermore, the level of histone H3 detected within the proximal region of the luciferase gene was
reduced in the presence of Tax. We also examined the binding of linker
histone H1 in parallel experiments. Similar to our observations with H3,
histone H1 binding at the HTLV-1 LTR and within the luciferase gene
decreased following transfection of Tax into the CHOK1-Luc cells (Fig.
2B). These data suggest that the observed Tax-dependent reduction in
activating histone modifications is because of a loss of core histones and
H1 and thus intact nucleosomes from the LTR-luciferase construct. Our
data do not support the replacement of H3 with the transcription-associated variant histone H3.3, as the H3 antibody recognizes both of these
histones. In these experiments, the data were standardized against histones H3 and H1 measured at the transcriptionally silent ␤-globin promoter. We found that Tax expression had no effect on the level of H3
and H1 at the ␤-globin promoter (Fig. 2C). This control was not feasible
in our examination of histone acetylation described in Fig. 1, as activat-
Nucleosome Eviction by Tax
ing modifications were undetectable at the ␤-globin promoter (data not
shown).
Micrococcal Nuclease and Dot Blot Analysis Shows Nucleosome Loss
in the Presence of Tax—The observed reduction in histone H3 from the
HTLV-1 LTR could be due to either a reduction in nucleosome occupancy or changes in the local chromatin architecture that result in
epitope masking. To distinguish between these two possibilities, we
asked whether Tax expression correlated with a decrease in the representation of LTR-luciferase DNA in nucleosome-protected MNase
fragments. We developed a hybridization assay in which we probed five
regions across the integrated HTLV-1 LTR-luciferase construct with
total mononucleosomal DNA from CHOK1-Luc cells that had been
transfected with Tax or control plasmid. Specific HTLV-1 LTR-luciferase regions were amplified from genomic DNA by standard PCR and
then bound to a membrane. The regions amplified are diagramed in Fig.
3A. The additional ␤-globin promoter amplicon and env gene amplicon
(from HTLV-1-positive SLB1 cells) served to standardize the signals in
each experiment and as background control, respectively. A Tax-mediated reduction in LTR-Luc-associated nucleosomes would cause the
DNA to become more accessible to digestion by MNase that, in turn,
would result in less representation of LTR-luciferase DNA in the total
population of mononucleosomal DNA. Therefore, less of this DNA
would hybridize to the LTR-luciferase amplicons (present in excess)
bound to the membrane. Fig. 3B shows that Tax expression led to a
reduction in the level of mononucleosomal DNA represented at all five
LTR-luciferase regions probed, averaging a 2-fold decrease for all
regions (Fig. 3C). The level of mononucleosomal DNA at the ␤-globin
promoter was unchanged (Fig. 3C, ␤-globin).
The relative differences in the amount of mononucleosomal DNA
associated with the LTR-luciferase construct show that Tax expression
produces an ⬃2-fold reduction in nucleosome occupancy over the LTR
and the downstream luciferase gene. These studies complement and
corroborate our ChIP assay data and indicate that Tax expression
results in nucleosome eviction and does not merely promote an architectural change in the chromatin that masks H3 and H1 epitopes. Furthermore, the resolution obtained with this assay, using mononucleosomal DNA as the probe, confirms that there is indeed a reduction in
nucleosome density over both the promoter and coding region.
13078 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 281 • NUMBER 19 • MAY 12, 2006
Downloaded from www.jbc.org at Colorado State University, on April 22, 2011
FIGURE 2. Tax expression correlates with a decrease in histone H3 and linker histone
H1 associated with the HTLV-1 LTR and the luciferase gene. Quantification of relative
histone levels at the integrated HTLV-1 LTR and the proximal luciferase gene (Luc.). ChIP
analyses were performed as described in the legend to Fig. 1. A, quantification of relative
histone H3 present at the integrated HTLV-1 promoter and the proximal luciferase gene.
The anti-H3 antibody was directed against the carboxyl-terminal domain of H3. B, quantification of relative histone H1 present at the integrated HTLV-1 promoter and the proximal luciferase gene. The graphs in A and B are each representative of three independent
ChIP experiments. Values obtained for the LTR and luciferase gene were standardized to
the value obtained for the ␤-globin promoter. Standardized values of histone levels in
the presence of Tax were normalized to respective standardized values of histone levels
in the absence of Tax (set to 1). C, quantification of relative histone H3 and H1 levels at the
transcriptionally silent ␤-globin promoter.
Nucleosome Loss Is Localized to the LTR and Transcribed Luciferase
Gene—To analyze the extent of the nucleosome loss, we conducted
ChIP and MNase/dot blot analysis at regions within the plasmid that
immediately flank the integrated LTR-Luciferase construct (Fig. 4A,
Regions 1 and 3). We used the ChIP assay to measure histone H3 binding
at these flanking sites and did not detect a significant change in H3
association in the absence or presence of Tax (Fig. 4B). MNase treatment followed by dot blot analysis corroborated these observations (Fig.
4, C and D). We also did not detect a change in accessibility at the
␤-globin promoter in the absence or presence of Tax (Fig. 4C). These
data indicate that the Tax-induced reduction in nucleosomes within the
LTR-luciferase construct was limited to this region and did not extend
upstream or downstream of these relevant sequences.
The Activation Domain of Tax Is Required for Nucleosome
Depletion—To begin to characterize the mechanism of nucleosome
depletion, we used the quantitative ChIP assay to compare wild type
Tax with a transcriptionally defective Tax mutant. Tax M47 carries a
double point mutation (L319R/L320S) in the activation domain of
the protein and has been shown to be defective for transcriptional
activation of HTLV-1 but not transcription via the NF-␬B pathway
(30). As expected, we found that transfection of CHOK1-Luc cells
with the M47 Tax expression plasmid produced a negligible increase
in luciferase activity when compared with wild type Tax (Fig. 5A).
We were next interested in determining whether M47 Tax promotes
nucleosome depletion from the LTR-luciferase construct. We used
the quantitative ChIP assay to compare the levels of histone H3 and
linker histone H1 at the HTLV-1 promoter in the presence of wild
type or M47 Tax. Fig. 5B shows that, in contrast to wild type Tax,
M47 Tax produced no significant reduction in total histone H3 or
H1. The level of histone H3 and H1 within the luciferase gene was
similarly unaffected by M47 Tax (data not shown). Paradoxically,
M47 Tax produced a reduction in H3 Lys-9/14 acetylation levels,
however, to a lesser degree than that observed with wild type Tax
(data not shown). Together, these data indicate that the M47 Tax
transcriptional activation defect correlates with a defect in nucleosome depletion.
Because such widespread nucleosome depletion from a mammalian
gene is unprecedented, it was important to ensure that the nucleosome
reduction at the HTLV-1 promoter was not due to a Tax-mediated
global reduction of histone proteins in the cell. Fig. 5C shows that neither wild type nor M47 Tax affected cellular histone H3 levels at the
time point following transfection, when cells were harvested for the
ChIP assay.
Nucleosome Depletion Correlates with Displacement of SWI/SNF and
Recruitment of RNA Polymerase II—Interestingly, quantitative ChIP
analyses showed that the binding of M47 Tax to the HTLV-1 LTR is
comparable with that observed with wild type Tax (Fig. 6A). Furthermore, CREB and p300 binding were also enhanced in the presence of
wild type and M47 Tax (Fig. 6A). These data show that M47 Tax is not
defective for complex formation with CREB and p300 on the HTLV-1
promoter in a chromatin environment. The fact that wild type and M47
Tax similarly and strongly recruit p300 to the HTLV-1 promoter indicates that the transcriptional and nucleosomal mobilization defect in
M47 Tax occurs in post-CREB and post-coactivator recruitment, consistent with in vitro binding data (26). We therefore conclude that
nucleosome depletion over the LTR-luciferase gene region is directly
coupled with the binding of transcriptionally competent Tax at the
HTLV-1 promoter.
Because a subset of chromatin remodeling complexes has been
shown to unfold nucleosomes, we were interested in determining if it
Nucleosome Eviction by Tax
FIGURE 4. Nucleosome depletion does not extend beyond the HTLV-1 LTR-luciferase
construct. A, schematic representation of the plasmid used to integrate the LTR-luciferase construct into CHOK1-Luc cells. The positions of the amplicons used in the ChIP (gray)
and dot blot (black) analyses are indicated by numbers. B, quantification of relative histone H3 present at the regions of the integrated LTR-luciferase construct shown in A. The
ChIP assay was performed as described in the legend to Fig. 1. The graph is representative of three independent ChIP experiments. Standardization was performed as
described in the legend to Fig. 2. C, MNase/dot blot analysis of LTR-luciferase flanking
regions was performed as described in the legend to Fig. 3B. The regions analyzed are
indicated in A. D, graphical representation of the experimental results shown in C. The
data analysis was performed as described in the legend to Fig. 3C. The graph shows
results from two independent experiments performed in triplicate.
was involved in nucleosome depletion from the HTLV-1 promoter.
Brg1 and Brm are the catalytic subunits of the ATP-dependent chromatin remodeling complexes SWI/SNF. Brg1 has been shown to interact
MAY 12, 2006 • VOLUME 281 • NUMBER 19
FIGURE 5. Nucleosome depletion is dependent on the activation domain of Tax.
A, the M47 Tax mutant is defective for HTLV-1 activation. CHOK1-Luc cells were transfected with pSG-Tax, pSG-Tax M47, or pUC19 as a control (⫺). Luciferase assays were
performed 20 h following transfection. B, quantification of relative endogenous histone
H3 and H1 levels at the integrated HTLV-1 LTR following transfection with control DNA
(pUC), pSG-Tax, or pSG-Tax M47. Histone H3 levels were standardized as described in the
legend to Fig. 2. The graph is representative of three independent ChIP experiments. C,
transfection of Tax or M47 Tax does not affect the global level of histone H3 protein.
Western blot using whole cell extract of CHOK1-Luc cells transfected with of pSG-Tax,
pSG-Tax M47, or pUC19 as a control. The blots were probed with antibodies against Tax
(upper panel), H3 (middle panel), and actin (lower panel). wt, wild type.
with Tax and function in HTLV-1 transcriptional activation (36).
Therefore, we used the ChIP assay to analyze SWI/SNF (Brg1 and Brm)
interactions with the LTR-luciferase construct in the absence or presence of Tax (Fig. 6B). In the absence of Tax, we were able to detect both
Brg1 and Brm at the promoter, but unexpectedly we found that Tax
JOURNAL OF BIOLOGICAL CHEMISTRY
13079
Downloaded from www.jbc.org at Colorado State University, on April 22, 2011
FIGURE 3. Tax expression leads to nucleosome depletion from the HTLV-1 promoter and luciferase gene. A, schematic representation of the integrated HTLV-1 LTR-luciferase
construct in CHOK1-Luc cells. The positions of the probes used in the dot blot analysis are indicated. B, CHOK1-Luc cells were transfected with pSG-Tax or control DNA (pUC19). Nuclei
from formaldehyde-treated cells were subjected to micrococcal nuclease digestion 20 h following transfection. Mononucleosome-length DNA was purified and used to probe
PCR-amplified regions of the LTR-luciferase construct spotted in triplicate onto a dot blot membrane. Boundaries for each amplicon with respect to the transcription start site are
indicated. The left and right membranes were probed with mononucleosome-length DNA from control-transfected or Tax-expressing cells, respectively. C, graphical representation
of the experimental results shown in B. The average signal from the HTLV-1 env gene region (negative control; absent in CHOK1-Luc cells) was subtracted from all other average
signals. Values for the LTR-luciferase regions were then standardized to that of the ␤-globin gene promoter. Values were normalized to the signal obtained in absence of Tax (set to
1). The weaker signal from the ␤-globin promoter (which should have been fully nucleosomal) was because of the shorter length of this amplicon (140 base pairs) relative to the
LTR-luciferase amplicons (212–257 base pairs). Use of the shorter ␤-globin amplicon was a consequence of the limited genomic sequence information available for hamster and
related species. Numbers correspond to the LTR-luciferase regions indicated in A. The graph shows results from two independent experiments performed in triplicate.
Nucleosome Eviction by Tax
FIGURE 6. The activation domain of Tax is dispensable for ternary complex formation and Brg1/BRM displacement. Quantification of relative transcriptional regulatory
protein binding at the integrated HTLV-1 LTR. CHOK1-Luc cells were transfected with
pSG-Tax, pSG-Tax M47, or pUC19 as a control. A, M47 Tax binds the HTLV-1 LTR and
recruits CREB and p300. The graphs are representative of four independent ChIP experiments for Tax and two for CREB and p300. B, M47 Tax is deficient in Brg1 and Brm
displacement. The graph is representative of two independent ChIP experiments. wt,
wild type.
expression resulted in the displacement of both chromatin remodeling
proteins from the LTR. In contrast, expression of M47 Tax increased
Brg1 and Brm occupancy at the viral promoter (Fig. 6B). These results
suggest that the function of Brg1 and Brm in HTLV-1 transcription is
related to maintaining the HTLV-1 proviral DNA assembled into chromatin in the absence of Tax. It is possible that SWI/SNF participate in
nucleosomal depletion upon Tax-mediated transcriptional activation
and are displaced in concert with the nucleosomes.
Finally, we were interested in determining whether RNAP II plays a
role in nucleosome depletion, because this process is associated with
strong transcriptional activation by Tax and occurs throughout the
LTR-luciferase construct. An antibody directed against a non-carboxylterminal domain portion of the largest subunit of the polymerase was
used in the quantitative ChIP assay to measure binding. We found that
RNAP II binding increased 4-fold at the HTLV-1 promoter upon wild
type Tax expression, whereas M47 Tax did not affect RNAP II enrichment at the promoter (Fig. 7A). These data indicate that the complex
formed with M47 Tax, CREB, p300, and possibly SWI/SNF at the
HTLV-1 promoter is not sufficient for RNAP II recruitment. Furthermore, RNAP II binding at the viral promoter correlates with nucleosome depletion. As a control, we measured the effect of Tax expression
on RNAP II occupancy at the ␤-globin promoter. As expected, Tax had
no effect on RNAP II recruitment to the transcriptionally inactive gene
(Fig. 7B).
DISCUSSION
In this study we have used the ChIP assay to characterize changes
in histone tail modifications on nucleosomes at chromosomally integrated copies of the HTLV-1 promoter during Tax-mediated transcriptional activation. Based on many studies showing an increase in
13080 JOURNAL OF BIOLOGICAL CHEMISTRY
histone acetylation on other promoters during transcriptional activation, we expected to observe an increase in activating histone
modifications at the HTLV-1 promoter upon Tax expression. Thus,
we were surprised to find that Tax expression correlated with a
decline in the levels of histone H3 acetylation at the HTLV-1 promoter and within the downstream luciferase gene. We found that the
basis for this Tax-mediated reduction was a general decrease in histone density within these regions. In addition, we have found that
less LTR-luciferase DNA is nucleosomal when Tax is expressed in
the cells. Importantly, we have also found that linker histone H1 is
associated with the LTR-luciferase construct in the absence of Tax
and is displaced from the DNA upon transcriptional activation by
Tax. Further, this displacement is localized to the LTR-luciferase
region and does not extend upstream or downstream of these
sequences. Together, these data indicate that Tax mediates a reduction in nucleosome occupancy at the HTLV-I promoter and coding
region.
Interestingly, previous studies demonstrated the presence of acetylated histones at the HTLV-1 promoter in the presence of Tax (18, 23,
24). Both Georges et al. (18) and Lu et al. (24) observed an increase in
p300-dependent histone acetylation at the HTLV-1 promoter in vitro
using histone acetyltransferase assays. However, these studies were carried out using purified, recombinant components; therefore RNAP II,
and possibly other regulatory factors that participate in chromatin
remodeling and nucleosome displacement, were not present in the
assays. In the work done by Lemasson et al. (23), histone modifications
have been examined at the LTR and coding region in the presence of
constitutively expressed Tax in HTLV-1 infected cells. Thus, histone
acetylation levels in the absence and presence of Tax have not been
compared. In the studies presented herein, we found that, relative to the
␤-globin promoter, activating histone modifications were readily
detectable at the LTR and downstream coding region following Tax
expression. These data indicate that the nucleosomes that remain following partial nucleosome displacement contain acetylated histones.
Interestingly, our data also show that the nucleosomes that reside in the
LTR-luciferase region contain acetylated histones prior to Tax transcriptional activation.
Nucleosome depletion has been shown to occur on a number of genes
in yeast and on two genes in Drosophila (37– 41). However, it has only
been conclusively demonstrated to occur in mammalian cells at the
VOLUME 281 • NUMBER 19 • MAY 12, 2006
Downloaded from www.jbc.org at Colorado State University, on April 22, 2011
FIGURE 7. Nucleosome depletion correlates with RNA polymerase II recruitment
and SWI/SNF displacement. A, M47 Tax is deficient in RNAP II recruitment. Quantification of relative RNAP II binding at the integrated HTLV-1 LTR. The graph is representative
of two independent ChIP experiments. B, quantitation of RNAP II recruitment to the
␤-globin and HTLV-1 promoter in the absence and presence of Tax. The absolute signal
obtained in the ChIP assay were plotted to compare relative recruitment at each locus. It
is important to note that, although we compared wild type and mutant Tax in parallel in
only two experiments as indicated, we have performed multiple experiments looking
individually at wild type or mutant Tax effects on factory binding, and the trends were
consistent.
Nucleosome Eviction by Tax
MAY 12, 2006 • VOLUME 281 • NUMBER 19
FIGURE 8. Schematic illustration of the HTLV-1 promoter in the absence of Tax and
in the presence of wild type and M47 Tax.
Tax in nucleosome depletion is correlated with the inability of this
mutant to recruit RNAP II. These results suggest that RNAP II is
involved, at least in part, in reducing the nucleosome density over the
LTR-luciferase construct. A model illustrating the results of our studies
is shown in Fig. 8.
Because p300 is recruited to the HTLV-1 promoter by both wild type
and M47 Tax, the mechanism of nucleosome depletion is unlikely to
directly involve p300-mediated histone tail acetylation. Further, previous data on Tax transactivation from chromatin templates in vitro (28)
reveal that histone tail acetylation is not the principal function of p300 in
HTLV-1 transcription. Although a previous study has shown that M47
Tax is defective for binding to p300/CBP-associated factor (PCAF) (50),
we were unable to analyze PCAF binding in this study. PCAF, which
carries histone acetyltransferase activity, interacts with Tax and augments transcription from a transiently transfected HTLV-1 promoter
(27, 51). However, we have been unable to detect PCAF binding at the
HTLV-1 promoter using the ChIP assay with various antibodies (23).
Therefore, it remains unclear as to whether PCAF plays a role in nucleosome depletion from the HTLV-1 LTR and coding region.
The inability of transcriptionally defective M47 Tax to recruit RNAP
II points to a role for the elongating enzyme in nucleosome reduction.
This idea is supported by the large increase in RNAP II on the LTR
promoter upon activation by Tax. However, we cannot rule out the
involvement of other factors in this process, because nucleosomes are
depleted upstream of the transcription start site as well as within the
coding region. Two models could explain how polymerase displaces
nucleosomes, each based on the ability of the elongating enzyme complex to traverse and reform nucleosomes in its wake. In the first model,
the considerable transcriptional activation by Tax could be linked to a
high density of elongating polymerase complexes on the DNA-inhibiting nucleosome reformation. This model has been proposed to account
for the loss of nucleosomes from the coding regions of the yeast GAL
genes (48). In the second model, Tax may be disrupting one or more of
the components in the polymerase complex that functions in nucleosome reformation. Both Spt6 and FACT (facilitates chromatin tran-
JOURNAL OF BIOLOGICAL CHEMISTRY
13081
Downloaded from www.jbc.org at Colorado State University, on April 22, 2011
proximal promoters of the interleukin-2 and granulocyte-macrophage
colony-stimulating factor genes during mouse T-cell activation (42).
Therefore, nucleosome depletion during Tax-mediated transcriptional
activation of the HTLV-1 promoter is surprising in that it appears to
represent, so far, a relatively rare event in mammalian cells. Furthermore, interleukin-2 and granulocyte-macrophage colony-stimulating
factor nucleosome depletion was limited to the promoter regions,
whereas we found that Tax mediated nucleosome depletion extending
at least 1.5 kb downstream of the transcription start site. Interestingly,
transcriptional activation from the retroviral mouse mammary tumor
virus LTR does not result in nucleosome displacement. Instead, studies
suggest that activation correlates with a loss of linker histone H1 and
possibly histones H2A and H2B (from nucleosome B) following hormone treatment (43– 45).
The approximate 2-fold reduction in nucleosome occupancy over the
LTR-luciferase construct is similar to that measured at some other
genes (46). Because in the majority of our experiments the transfected
cell population was enriched (see “Materials and Methods”), the incomplete loss of nucleosomes is unlikely to be a consequence of low transfection efficiency. The level of decrease in nucleosome density over the
PHO5 promoter has been attributed to an equilibrium between nucleosome eviction and reformation (38). This mechanism may account for
the partial nucleosome depletion over the LTR-luciferase construct.
Alternatively, incomplete nucleosome loss from the LTR-luciferase
construct may reflect the fact that we have examined an asynchronous
population of Tax-expressing cells, and nucleosome eviction from the
integrated construct may occur at a specific stage of the cell cycle that is
permissive to Tax-mediated transcriptional activation. Alternatively, or
in addition, some of the integrated LTR-Luc copies may be intractable
to full activation by Tax.
The factors involved in transcription-coupled nucleosome eviction
have begun to be elucidated in yeast. Genome-wide analyses have
revealed that nucleosomes are underrepresented in DNA regions with
multiple conserved transcription factor binding sites (37, 39). Together,
these results support a general model in which transcription factor
binding can preclude nucleosome assembly at promoter regions. However, some promoters may require additional or alternative processes
for nucleosome removal, as has been shown for the PHO5 and PHO8
promoters, which require the histone chaperone Asf1p for nucleosome
eviction (47). The level of activation from certain yeast promoters has
been correlated with the extent of histone loss from these promoters.
For the GAL genes and the HSP82 gene in yeast and for HSP70 gene in
Drosophila, RNAP II has been implicated in the reduction of nucleosomes from these genes (41, 48, 49). We propose that RNAP II also
functions in nucleosome depletion from the LTR-luciferase construct,
because similar to the above genes, nucleosomes are also removed from
the coding region.
To investigate the mechanism of Tax-mediated nucleosome depletion from the LTR and transcribed region, we performed ChIP assays
with cells expressing the transcriptionally impaired M47 Tax mutant
(30). We demonstrated that the binding of M47 Tax to the chromosomally integrated HTLV-1 promoter is comparable with the binding of
wild type Tax. Furthermore, wild type and M47 Tax similarly recruit
CREB and p300 to the HTLV-1 LTR in living cells. Our results extend
previous in vitro studies showing that M47 Tax forms a complex with
CREB, p300, and the viral CRE (8, 26). In contrast, we found that promoter binding by M47 Tax does not lead to a reduction in the level of
histone H3 associated with the LTR and luciferase gene. These results
indicate that M47 Tax does not mediate activator-dependent loss of
nucleosomes from the promoter. We found that the deficiency of M47
Nucleosome Eviction by Tax
scription) complex have been shown to be involved in this process (49,
52) and may be directly or indirectly targeted by Tax. We are currently
investigating which of these models best describes nucleosome depletion during Tax transactivation.
Acknowledgment—We are especially grateful to Dr. K.-T. Jeang for the
CHOK1-Luc cells.
REFERENCES
13082 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 281 • NUMBER 19 • MAY 12, 2006
Downloaded from www.jbc.org at Colorado State University, on April 22, 2011
1. Uchiyama, T., Yodoi, J., Sagawa, K., Takatsuki, K., and Uchino, H. (1977) Blood 50,
481– 492
2. Poiesz, B. J., Ruscetti, F. W., Gazdar, A. F., Bunn, P. A., Minna, J. D., and Gallo, R. C.
(1980) Proc. Natl. Acad. Sci. U. S. A. 77, 7415–7419
3. Gessain, A., Barin, F., Vernant, J. C., Gout, O., Maurs, L., Calender, A., and de The, G.
(1985) Lancet ii, 407– 410
4. Osame, M., Usuku, K., Izumo, S., Ijichi, N., Amitani, H., Igata, A., Matsumoto, M., and
Tara, M. (1986) Lancet 1, 1031–1032
5. Azran, I., Schavinsky-Khrapunsky, Y., and Aboud, M. (2004) Retrovirology 1, 20 – 43
6. Franklin, A. A., Kubik, M. F., Uittenbogaard, M. N., Brauweiler, A., Utaisincharoen, P.,
Matthews, M. A., Dynan, W. S., Hoeffler, J. P., and Nyborg, J. K. (1993) J. Biol. Chem.
268, 21225–21231
7. Goren, I., Semmes, O. J., Jeang, K. T., and Moelling, K. (1995) J. Virol. 69, 5806 –5811
8. Adya, N., and Giam, C. Z. (1995) J. Virol. 69, 1834 –1841
9. Kimzey, A. L., and Dynan, W. S. (1998) J. Biol. Chem. 273, 13768 –13775
10. Lenzmeier, B. A., Giebler, H. A., and Nyborg, J. K. (1998) Mol. Cell. Biol. 18, 721–731
11. Lenzmeier, B. A., Baird, E. E., Dervan, P. B., and Nyborg, J. K. (1999) J. Mol. Biol. 291,
731–744
12. Lundblad, J. R., Kwok, R. P., Laurance, M. E., Huang, M. S., Richards, J. P., Brennan,
R. G., and Goodman, R. H. (1998) J. Biol. Chem. 273, 19251–19259
13. Rosen, C. A., Sodroski, J. G., and Haseltine, W. A. (1985) Proc. Natl. Acad. Sci. U. S. A.
82, 6502– 6506
14. Rosen, C. A., Park, R., Sodroski, J. G., and Haseltine, W. A. (1987) Proc. Natl. Acad. Sci.
U. S. A. 84, 4919 – 4923
15. Brady, J., Jeang, K.-T., Duvall, J., and Khoury, G. (1987) J. Virol. 61, 2175–2181
16. Kwok, R. P., Laurance, M. E., Lundblad, J. R., Goldman, P. S., Shih, H., Connor, L. M.,
Marriott, S. J., and Goodman, R. H. (1996) Nature 380, 642– 646
17. Giebler, H. A., Loring, J. E., Van Orden, K., Colgin, M. A., Garrus, J. E., Escudero,
K. W., Brauweiler, A., and Nyborg, J. K. (1997) Mol. Cell. Biol. 17, 5156 –5164
18. Georges, S. A., Kraus, W. L., Luger, K., Nyborg, J. K., and Laybourn, P. J. (2002) Mol.
Cell. Biol. 22, 127–137
19. Hansen, J. C., and Wolffe, A. P. (1992) Biochemistry 31, 7977–7988
20. Hansen, J. C., and Wolffe, A. P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2339 –2343
21. Hansen, J. C., Tse, C., and Wolffe, A. P. (1998) Biochemistry 37, 17637–17641
22. Jenuwein, T., and Allis, C. D. (2001) Science 293, 1074 –1080
23. Lemasson, I., Polakowski, N., Laybourn, P. J., and Nyborg, J. K. (2002) J. Biol. Chem.
277, 49459 – 49465
24. Lu, H., Pise-Masison, C. A., Fletcher, T. M., Schiltz, R. L., Nagaich, A. K., Radonovich,
M., Hager, G., Cole, P. A., and Brady, J. N. (2002) Mol. Cell. Biol. 22, 4450 – 4462
25. Kashanchi, F., Duvall, J. F., Kwok, R. P., Lundblad, J. R., Goodman, R. H., and Brady,
J. N. (1998) J. Biol. Chem. 273, 34646 –34652
26. Harrod, R., Tang, Y., Nicot, C., Lu, H. S., Vassilev, A., Nakatani, Y., and Giam, C. Z.
(1998) Mol. Cell. Biol. 18, 5052–5061
27. Okada, M., and Jeang, K. T. (2002) J. Virol. 76, 12564 –12573
28. Georges, S. A., Giebler, H. A., Cole, P. A., Luger, K., Laybourn, P. J., and Nyborg, J. K.
(2003) Mol. Cell. Biol., 23, 3392–3404
29. Lemasson, I., Polakowski, N. J., Laybourn, P. J., and Nyborg, J. K. (2004) Mol. Cell. Biol.
24, 6117– 6126
30. Smith, M. R., and Greene, W. C. (1990) Genes Dev. 4, 1875–1885
31. van den Hoff, M. J., Christoffels, V. M., Labruyere, W. T., Moorman, A. F., and
Lamers, W. H. (1995) Methods Mol. Biol. 48, 185–197
32. Rousset, R., Desbois, C., Bantignies, F., and Jalinot, P. (1996) Nature 381, 328 –331
33. Frank, S. R., Schroeder, M., Fernandez, P., Taubert, S., and Amati, B. (2001) Genes
Dev. 15, 2069 –2082
34. Hager, G. L., and Fragoso, G. (1999) Methods Enzymol. 304, 626 – 638
35. Fragoso, G., and Hager, G. L. (1997) Methods 11, 246 –252
36. Wu, K., Bottazzi, M. E., de la Fuente, C., Deng, L., Gitlin, S. D., Maddukuri, A., Dadgar,
S., Li, H., Vertes, A., Pumfery, A., and Kashanchi, F. (2004) J. Biol. Chem. 279, 495–508
37. Bernstein, B. E., Liu, C. L., Humphrey, E. L., Perlstein, E. O., and Schreiber, S. L. (2004)
Genome Biol. 5, (suppl.) R62–R72
38. Boeger, H., Griesenbeck, J., Strattan, J. S., and Kornberg, R. D. (2003) Mol. Cell 11,
1587–1598
39. Lieb, J. D., Liu, X., Botstein, D., and Brown, P. O. (2001) Nat. Genet. 28, 327–334
40. Reinke, H., and Horz, W. (2003) Mol. Cell 11, 1599 –1607
41. Zhao, J., Herrera-Diaz, J., and Gross, D. S. (2005) Mol. Cell. Biol. 25, 8985– 8999
42. Chen, X., Wang, J., Woltring, D., Gerondakis, S., and Shannon, M. F. (2005) Mol. Cell.
Biol. 25, 3209 –3219
43. Bresnick, E. H., Bustin, M., Marsaud, V., Richard-Foy, H., and Hager, G. L. (1992)
Nucleic Acids Res. 20, 273–278
44. Nagaich, A. K., Walker, D. A., Wolford, R., and Hager, G. L. (2004) Mol. Cell 14,
163–174
45. Vicent, G. P., Nacht, A. S., Smith, C. L., Peterson, P. L. Dimitrov, S., and Beato, M.
(2004) Mol. Cell 16, 439 – 452
46. Boeger, H., Bushnell, D. A., Davis, R., Griesenbeck, J., Lorch, Y., Strattan, J. S., Westover, K. D., and Kornberg, R. D. (2005) FEBS Lett. 579, 899 –903
47. Adkins, M. W., Howar, S. R., and Tyler, J. K. (2004) Mol. Cell 14, 657– 666
48. Kristjuhan, A., and Svejstrup, J. Q. (2004) EMBO J. 23, 4243– 4252
49. Schwabish, M. A., and Struhl, K. (2004) Mol. Cell. Biol. 24, 10111–10117
50. Harrod, R., Kuo, Y. L., Tang, Y., Yao, Y., Vassilev, A., Nakatani, Y., and Giam, C. Z.
(2000) J. Biol. Chem. 275, 11852–11857
51. Jiang, H., Lu, H., Schiltz, R. L., Pise-Masison, C. A., Ogryzko, V. V., Nakatani, Y., and
Brady, J. N. (1999) Mol. Cell. Biol. 19, 8136 – 8145
52. Kaplan, C. D., Laprade, L., and Winston, F. (2003) Science 301, 1096 –1099