Download the pregnane x receptor binds to response elements in a genomic

0090-9556/04/3201-35–42$20.00
DRUG METABOLISM AND DISPOSITION
Copyright © 2004 by The American Society for Pharmacology and Experimental Therapeutics
DMD 32:35–42, 2004
Vol. 32, No. 1
1196/1111224
Printed in U.S.A.
THE PREGNANE X RECEPTOR BINDS TO RESPONSE ELEMENTS IN A GENOMIC
CONTEXT-DEPENDENT MANNER, AND PXR ACTIVATOR RIFAMPICIN SELECTIVELY
ALTERS THE BINDING AMONG TARGET GENES
Xiulong Song, Mingxing Xie, He Zhang,1 Yuxin Li, Karuna Sachdeva, and Bingfang Yan
Department of Biomedical Sciences, University of Rhode Island, Kingston, Rhode Island
(Received June 6, 2003; accepted September 8, 2003)
This article is available online at http://dmd.aspetjournals.org
ABSTRACT:
CYP3A4-ER6 reporter. This line responded to rifampicin and dexamethasone similarly as hepatocytes based on the relative potency
and activation kinetics. Contrary to the hypothesis, chromatin immunoprecipitation experiments showed that the genomic fragment harboring the proximal element was preferably precipitated
over the fragment containing the distant element in the CYP3A4
gene, but the opposite was true with the CYP3A7 gene. In addition,
the promoters from the MDR1 and CYP2B6 genes were abundantly
present in the PXR immunocomplexes from the vehicle-treated
cells. However, such abundant interactions were markedly diminished when cells were treated with PXR activator rifampicin. These
findings suggest that PXR binding is dependent on the genomic
context and PXR activators modulate such bindings.
Drug metabolism and efflux are two major pharmacokinetic determinants that contribute significantly to drug-drug interactions. The
cytochrome P450 (P4502) system is involved in the metabolism of
more than 90% drugs, whereas transporter proteins such as multidrug
resistance-1 (MDR1) are known to mediate xenobiotic efflux and thus
dictate absorption, presystemic elimination, and intracellular concentration of many therapeutic agents (Shou et al., 2001; Skatrud, 2002).
The pregnane X receptor (PXR) is a key regulator of genes encoding
several major types of P450 enzymes and transporter proteins (Goodwin et al., 2002). PXR structurally belongs to a superfamily of the
nuclear receptors and regulates target gene transcription in a ligand-
dependent manner. Unlike many other nuclear receptors, PXR has a
rather large ligand-binding pocket, which is spherical in shape, extremely hydrophobic, and expandable (Watkins et al., 2001). Such
structural features allow PXR to interact with a wide range of chemicals with dissimilar structure. These chemicals include prescription
drugs (e.g., rifampicin), herbal supplements (e.g., hyperforin), and
pesticides (e.g., trans-nonachlor) (Moore et al., 2000; Goodwin et al.,
2002). In addition, many endogenous compounds are also shown to
activate PXR, notably steroidal compounds (e.g., corticosterone) and
bile acids (e.g., lithocholic acid). Interestingly, both glucocorticoids
(e.g., dexamethasone) and antiglucocorticoids (e.g., pregnenolone
16␣-carbonitrile) are shown to activate PXR (Kliewer et al., 1998;
Goodwin et al., 2002).
In addition to the promiscuous nature on ligand interactions, PXR
exhibits a broad binding activity toward varying DNA elements
(Geick et al., 2002; Goodwin et al., 2002; Kast et al., 2002; Toell et
al., 2002). Most elements contain a half-site AG(G/T)TCA; however,
several distinct but related half-sites also form PXR response elements
(PXREs) that effectively interact with PXR-RXR␣ heterodimers
(Goodwin et al., 2002). These half-sites are arranged into various
configurations such as direct, inverted, and everted repeats that are
spaced by different numbers of nucleotides. In some PXR target
genes, more than one PXRE is located (Goodwin et al., 1999; Pascussi
et al., 1999; Bertilsson et al., 2001). For example, the CYP3A4 gene,
encoding the most abundant P450 enzyme, has one PXRE located in
the proximal promoter region (proximal PXRE) and a second one
This work was partially supported by Grant R01GM61988 from the National
Institute of General Medical Sciences and a grant from the Center of Alternatives
to Animal Testing, Johns Hopkins University.
1
Present address: Yale Medical School, Section of Neuropathology, 310
Cedar Street, New Haven, CT 06510.
2
Abbreviations used are: P450, cytochrome P450; MDR1, multidrug resistance-1; PXR, pregnane X receptor; PXRE, PXR response element; RXR␣, retinoid
X receptor-␣; kb, kilobase; CHIP, chromatin immunoprecipitation; ER6, everted
repeat spaced by six nucleotides; PCR, polymerase chain reaction; DMSO,
dimethyl sulfoxide; PBS, phosphate-buffered saline; RIPA, radioimmunoprecipitation assay; DR3, direct repeat spaced by three nucleotides; RAR, retinoic acid
receptor.
Address correspondence to: Dr. Bingfang Yan, Department of Biomedical
Sciences, University of Rhode Island, 41 Lower College Road, Kingston, RI
02881. E-mail: [email protected]
35
Downloaded from dmd.aspetjournals.org at ASPET Journals on August 3, 2017
The pregnane X receptor (PXR) is a key regulator of genes encoding several major types of cytochrome P450 enzymes and transporters (e.g., multidrug resistance-1, MDR1); therefore, PXR contributes significantly to drug-drug interactions. PXR binds to
response elements and confers transactivation. Several target
genes such as CYP3A4 and 3A7 contain two PXR elements (distant
and proximal) that are separated by more than 7000 nucleotides in
the genome. Disruption of the distant element causes a 73% decrease of the reporter activity, whereas inactivation of the proximal
element decreases by only 53%. This study was undertaken to test
the hypothesis that PXR differentially binds to the elements with
the distant enhancer being bound to a higher extent. To test this
hypothesis, a stable transfected line (hPXR-HRE) was prepared to
constitutively express human PXR and harbor a chromatinized
36
SONG ET AL.
Materials and Methods
Supplies and Plasmid Constructs. Human liver cDNA library, cDNA
positive selection kit, LipofectAMINE, and culture medium were purchased
from Invitrogen (Carlsbad, CA); rifampicin, dexamethasone, FLAG-tagged
vector, the anti-FLAG monoclonal antibody, and its agarose-bead conjugates
were obtained from Sigma-Aldrich (St. Louis, MO); kits for luciferase detection and the pRL-TK plasmid were purchased from Promega (Madison, WI).
Delipidated and normal fetal bovine sera were from Hyclone Laboratories
(Logan, UT). Unless otherwise indicated, all other reagents were purchased
from Fisher Scientific Co. (Pittsburgh, PA). Full-length cDNA encoding human PXR was isolated from a cDNA library by a cDNA-trapping procedure
with a biotinylated oligonucleotide ACAGTGGCTGTGAGCTTCCAG as described previously (Hu and Yan, 1999; Zhang et al., 1999). The coding
sequence was amplified by PCR and subcloned to the FLAG-cytomegalovirus
vector to express the FLAG-hPXR. The CYP3A4-ER6 reporter was constructed by inserting two copies of CYP3A4 response element (5⬘-GATCAGACAGTTCATGAAGTTCATCTAGATC-3⬘) into the pGL3 promoter luciferase vector. Two additional reporters were prepared with the pGL3 basic
vector to contain the proximal element alone (⫺362 to ⫹ 53, CYP3A4-P) or
the proximal fused to the distal element (⫺362 to ⫹ 53 and ⫺7836 to ⫺7208,
CYP3A4-DP) (Goodwin et al., 1999). The fragments harboring these elements
were amplified by PCR with primers that were extended to include appropriate
endonucleases to facilitate subsequent ligation. All constructs were subjected
to sequencing analyses.
Transient Cotransfection Experiment. Cells (CV-1 and HEK293T) were
plated in 24-well plates in Dulbecco’s modified Eagle’s medium supplemented
with 10% delipidated fetal calf serum at a density of 8 ⫻ 104 cells per well.
Transfection was conducted by lipofection with LipofectAMINE as described
previously (Li et al., 2003). Transfection mixtures contained 200 ng of hPXR
plasmid, 100 ng of reporter plasmid, and 10 ng of pRL-TK plasmid. Cells were
transfected for 4 h, and the medium was replaced with fresh medium. After
24 h, media were changed again with the same media containing rifampicin or
solvent DMSO. The transfected cells were incubated for an additional 24 h and
washed once with PBS and collected by scraping. The collected cells were
subjected to two cycles of freeze/thaw. The reporter enzyme activities were
assayed with a dual-luciferase reporter assay system as described by the
manufacturer. This system contained two substrates, which were used to
determine the activity of two luciferases sequentially. The firefly luciferase
activity, which represented the reporter gene activity, was initiated by mixing
an aliquot of lysates (10 ␮l) with luciferase assay reagent II. Then the firefly
luminescence was quenched, and the Renilla luminescence was simultaneously
activated by adding Stop & Glo reagent to the sample tube. The firefly
luminescence signal was normalized based on the Renilla luminescence signal,
and the ratio of rifampicin to DMSO treatment served as fold induction.
Stable Transfection. Stable transfection lines were prepared with 293T
cells to constitutively express hPXR and harbor the CYP3A4-ER6 reporter in
the genome. To facilitate the selection of genomic integration, the FLAGhPXR construct was modified by inserting a Zeocin-resistant gene, whereas the
CYP3A4-ER6 reporter construct was altered by a blasticidin-resistant gene.
The initial transfection was conducted with the FLAG-hPXR expression plasmid, whereas the subsequent transfection was performed with the CYP3A4ER6 reporter construct. Cells were seeded at 50% confluence and transfected
by LipofectAMINE as described previously (Li et al., 2002b). The transfected
cells were cultured in full media for 24 h and split into fresh media. The split
cells were seeded to 10% confluence and cultured in media containing Zeocin
(300 ␮g/ml). Positive foci resistant to Zeocin were picked up, expanded, and
assayed for their ability to respond to rifampicin on activating the CYP3A4ER6 reporter by cotransfection experiments. One subline exhibiting a high
responsiveness was transfected again with the CYP3A4-ER6 reporter construct. The selection was performed against both blasticidin (5 ␮g/ml) and
Zeocin (300 ␮g/ml). Blasticidin was designed to select stable transfectants of
the CYP3A4-ER6 reporter construct, whereas Zeocin was designed to maintain
the integration of the previously transfected FLAG-hPXR construct. The
resultant sublines containing both transfected constructs were tested for their
ability to respond to PXR ligand-mediated activation. In this case, only the
firefly luminescence signal was determined and normalized based on the
amount of the protein used.
Immunocytochemistry. Stable transfected cells were seeded in chamber
slides at ⬃40% confluence and cultured overnight. Media were replaced with
fresh media containing rifampicin, dexamethasone, or DMSO. After an additional 24-h incubation, cells were fixed in ice-cold 10% acetone for 10 min,
then air-dried. The chambers were removed, and the entire slide was immersed
in PBS for rehydration. The slides were then incubated in 1% goat serum for
2 h to block nonspecific binding followed by incubation in the anti-FLAG
monoclonal antibody (1:1000 dilution with PBS) for 30 min. The slide was
washed five times with PBS. Subsequently, the slide was incubated with
fluorescent isothiocyanate-conjugated anti-mouse IgG antibody for an additional 30 min. The slide was mounted and visualized by a confocal microscope
(Xie et al., 2003).
Formaldehyde Cross-Linked Chromatin Preparation. The dual transfected line (hPXR-HRE), highly responding to rifampicin stimuli, was cultured
in a 75-ml flask to an 80% confluence and treated with DMSO or rifampicin
(10 ␮M) for 24 h. The cells were then cross-linked for 10 min at room
temperature with formaldehyde solution (11% formaldehyde, 50 mM HEPES,
pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA). The cross-linking was
terminated by adding glycine to a final concentration of 125 mM. The fixed
cells were washed three times with ice-cold PBS and collected in lysis buffer
(10 mM Tris-HCl, pH 8.0, 0.25% Triton X-100, 1 mM EDTA, 0.5 mM EGTA,
10 mM sodium butyrate, 100 mM NaCl, 20 mM ␤-glycerophosphate, 100 ␮M
sodium orthovanadate, and protease inhibitors A and B). After a 10-min
incubation on ice, the cell suspensions were centrifuged at 3000 rpm for 4 min
under refrigeration. The nuclear pellets were resuspended in wash buffer (lysis
buffer minus Triton X-100) and centrifuged again. The resultant pellets were
resuspended in 1.5 ml of wash buffer and sonicated with a Branson Sonifier
250 (Branson Ultrasonics Corporation, Danbury, CT) with an output of 40 at
20% cycle for 30 s. The sonications were repeated five times. To the sonicated
chromatins, SDS was added to a final concentration of 1%, and the chromatin
solutions were rotated at room temperature for 1 h. The soluble supernatant
Downloaded from dmd.aspetjournals.org at ASPET Journals on August 3, 2017
(distal PXRE) located ⬃8 kb upstream of the transcription initiation
site (Goodwin et al., 1999). Transient cotransfection experiments with
reporter constructs demonstrate that both elements are required for
maximum activation. Selective disruption of the distant or proximal
element causes decreases in responding to PXR-mediated transactivation by 73 and 53%, respectively (Goodwin et al., 1999). A minimal
promoter (containing the proximal element), although supporting the
basal transcription, shows little ability to confer PXR-mediated induction (Goodwin et al., 1999). These findings suggest that both
elements work in a coordinated manner and the distal but not the
proximal element is the primary target for PXR interaction. The distal
and proximal elements are also located in the CYP3A7 gene, which
encodes a major fetal P450 enzyme (Pascussi et al., 1999; Bertilsson
et al., 2001).
This study was undertaken to test the hypothesis that PXR differentially binds to the proximal and distal elements with the distant
element being bound to a higher extent. To test this hypothesis, a
stable transfected line (hPXR-HRE) was prepared with human PXR;
chromatin immunoprecipitation (CHIP) was performed with an antibody specific to the transfected PXR; and the immunoprecipitates
were analyzed for the relative abundance of genomic fragments containing the PXR elements among several target genes. In the CYP3A4
gene, the proximal element-containing fragment was precipitated to a
markedly higher extent than the fragment containing the distant element, whereas the opposite was true with the CYP3A7 gene. In the
absence of rifampicin, the promoter fragments from the MDR1 and
CYP2B6 genes were abundantly precipitated. However, such abundant interactions were markedly diminished when cells were treated
with rifampicin. These findings suggest that PXR binding is dependent on the genomic context and PXR activators modulate such
bindings. These findings also provide a molecular explanation on the
widely observed differential inducibility of the target genes by PXR
activators.
37
PXR DIFFERENTIALLY BINDS TO ITS RESPONSE ELEMENTS
TABLE 1
PCR primer sequences and the predicted size of the products
Primer
Sequence
Predicted Size
Accession No.
CYP2B6-F
CYP2B6-R
CYP3A4D-F
CYP3A4D-R
CYP3A4P-F
CYP3A4P-R
CYP3A7D-F
CYP3A7D-R
CYP3A7P-F
CYP3A7P-R
MDR1-F
MDR1-R
DEC2-F
DCE2-R
PGL3-F
PGL3-R
5⬘-ctgcaatgagcacccaatctt-3⬘
5⬘-acacatcctctgacagggtca-3⬘
5⬘-agagacaagggcaagagagag-3⬘
5⬘-ctctttgctgggctatgtgca-3⬘
5⬘-gagatggttcattcctttcat-3⬘
5⬘-atgctcttataccttcttagt-3⬘
5⬘-acagccatagagacaagagga-3⬘
5⬘-ctgtttgctgggctgtgtgtg-3⬘
5⬘-cctcttggaacttcatgcccg-3⬘
5⬘-gataatattcaactcccattc-3⬘
5⬘-accaactgttcattggtctgc-3⬘
5⬘-gcaatcagcttagtacctggatg-3⬘
5⬘-aggctcagaacgcggcagagt-3⬘
5⬘-ttcgtccgttgttacggtgca-3⬘
5⬘-gagctattccagaagtagtga-3⬘
5⬘-agttcatgatcagtgcaattg-3⬘
319
AF081569
329
AF185589
376
AF185589
327
AF329900
529
AF329900
587
AC002475
553
AC022509
660
U47298
Results
Transactivation of CYP3A4 Enhancer and Promoter Reporters
in CV-1 and 293T Cells. To study intracellular interactions between
PXR and its response elements as a function of PXR-mediated transactivation, stable transfectants were prepared to constitutively express
human PXR and to harbor a CYP3A4 reporter in the genome. The
initial effort was made to select the type of reporters (e.g., enhancer
and native promoter) for stable transfection. Three reporters were
tested, including CYP3A4-ER6, CYP3A4-P, and CYP3A4-DP. The
CYP3A4-ER6 reporter contained two copies of the ER6 element in
the proximal promoter of the CYP3A4 gene; the CYP3A4-P contained the proximal promoter (⫺362 to ⫹ 53); and the CYP3A4-DP
had the DR3-containing fragment (⫺7836 to ⫺7208) fused to the
proximal promoter. Both wild-type and FLAG-tagged PXR constructs
were tested for the ability to transactivate these reporters.
The reporter activities in response to rifampicin are summarized in
Fig. 1A. In both CV-1 and 293T, the CYP3A4-ER6 and CYP3A4-PD
reporters were markedly transactivated, with the CYP3A4-ER6 showing a slightly higher activity (⬃4- versus 3-fold). In contrast, the
CYP3A4-P reporter, although containing the ER6 element, exhibited
little activity. The insignificant responsiveness of the CYP3A4-P
reporter was not due to an insufficient amount of this construct, since
little activation was consistently observed even though two times as
much as the other reporters were used (data not shown). These
findings are consistent with previous reports that the proximal ER6
element in the CYP3A4 native promoter has no inherent ability to
respond to PXR-mediated transactivation but coordinates the distal
element-mediated activity (Goodwin et al., 1999, 2002). In addition,
the FLAG-tagged PXR was slightly less active than the wild-type
PXR toward all reporters. Generally, CV-1 cells supported a somewhat higher transactivation than 293 cells, although both cell lines
were derived from the kidney (monkey and human, respectively).
We next examined whether the slightly higher activation in CV-1
cells was due to higher expression of the transfected PXR. Western
analyses were performed with both nuclear and cytosolic fractions. In
contrary to the prediction, both nuclear and cytosolic PXR were
readily detected in 293T but not in CV-1 cells (Fig. 1B). In fact, no
cytosolic PXR was detected in CV-1 cells. Even in the nucleus, the
level of PXR in 293T cells was more than 20 times of that in CV-1
cells (Fig. 1B). The levels of ␤-actin, however, were comparable,
suggesting that CV-1 cells indeed support lower expression of the
transfected PXR or the transfection efficiency is lower in CV-1 cells
under the conditions used. In addition, treatment with rifampicin
caused no changes on the expression of PXR or the relative abundance
between the nuclear and cytoplasmic compartments (data not shown).
Stable Transfectants Exhibited Same Activation Profiles as
Primary Cultured Hepatocytes. Transient transfection experiments
are widely used to determine reporter activity (Goodwin et al., 2002;
Li et al., 2003); however, many factors are shown to affect the overall
transactivation activity, such as the copy number of the inserted
response element. Recently, transiently introduced and chromatinized
reporters are found to differentially respond to ligands of RAR and
RXR␣, two receptors that are structurally related to PXR (Lefebvre et
al., 2002). We next tested chromatinized CYP3A4 reporter in re-
Downloaded from dmd.aspetjournals.org at ASPET Journals on August 3, 2017
chromatins were prepared by centrifuging at room temperature for 30 min
(13,000g). After the cross-linking was reversed, the soluble chromatins were
analyzed by agarose gel electrophoresis to ensure that the average size of the
chromatins was ⬃1.5 kb.
Chromatin Immunoprecipitation. The chromatin solutions were diluted
10-fold to reduce the concentration of SDS to 0.1% in RIPA buffer (10 mM
Tris-HCl, pH 8.0, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM EDTA,
0.5 mM EGTA, 10 mM sodium butyrate, 140 mM NaCl, 20 mM ␤-glycerophosphate, 100 ␮M sodium orthovanadate, and protease inhibitor cocktails).
The diluted chromatin solutions (one fourth) were mixed with 50 ␮l of
anti-FLAG-coated agarose beads preincubated with bovine serum albumin and
sonicated lambda phage DNA. As a negative control, the agarose beads were
preincubated with lysates from non-cross-linked cells. The chromatin/agarose
beads were rotated at room temperature for 4 h and centrifuged at 1000g for 30
min. The beads were washed as follows: 3 ⫻ 1 ml of RIPA buffer; 3 ⫻ 1 ml
of RIPA plus 500 mM NaCl; 3 ⫻ 1 ml of RIPA containing 250 mM LiCl, 1%
NP40, and 1% sodium deoxycholate; and 3 ⫻ 1 ml of Tris-EDTA, pH 7.5,
containing 10 mM sodium butyrate, 20 mM ␤-glycerophosphate, and protease
inhibitor cocktails. The antibody bound chromatins were eluted by TE washing
buffer containing 1.5% SDS. The input, unbound, and antibody bound chromatins were incubated at 65°C for 7 h to reverse the cross-linking. The DNA
was precipitated with ethanol, resuspended in water, and treated with RNase A
(50 ␮g/ml) for 1 h at 37°C followed by proteinase K treatment (100 ␮g/ml) in
the presence of 0.25% SDS at 37°C overnight. The DNAs were subjected to
phenol-chloroform extraction once and chloroform extraction once, precipitated with ethanol in the presence of glycogen (10 ␮g), and redissolved in
water. The presence of the genomic fragments containing PXR elements in the
CYP2B6, 3A4, 3A7, and MDR1 genes was analyzed by PCR with primers
listed in Table 1.
Other Assays. Protein concentration was determined with a BCA protein
assay kit (Pierce Chemical, Rockford, IL) as described by the manufacturer.
Western analyses were performed as described previously (Xie et al., 2002).
Data are presented as mean ⫾ S.D. of at least three separate experiments,
except where results of blots are shown in which case a representative experiment is depicted in the figures. Comparisons between two values were made
with Student’s t test at p ⬍ 0.05.
38
SONG ET AL.
A, activation of reporters. CV-1 and 293T cells were transiently transfected by
LipofectAMINE with construct mixtures containing 200 ng of PXR or FLAG-PXR
plasmid, 100 ng of reporter plasmid (3A4-ER6, 3A4-DP, or 3A4-P), and 10 ng of
pRL-TK plasmid (reference). After a 12-h incubation, the transfected cells were
treated with rifampicin (10 ␮M) or vehicle DMSO for 24 h. Cell lysates were
prepared and assayed for luciferase activities with a dual-luciferase reporter assay
system. The firefly luminescence signal was normalized based on the Renilla
luminescence signal, and the ratio of rifampicin over DMSO treatment served as
fold induction. Data represent the mean of assays in triplicate ⫾ S.D. B, Western
analyses. Nuclear and cytosolic fractions from the cells assayed for luciferase
activity (transfected with the FLAG-PXR construct only) were prepared with a kit
from Active Motif, Inc. (Carlsbad, CA). Nuclear or cytosolic proteins (25 ␮g) were
subjected to SDS-polyacrylamide gel electrophoresis and transferred electrophoretically to a Transblot nitrocellulose membrane. The immunoblots were blocked in 5%
nonfat dry milk and then incubated with the anti-FLAG and anti-␤-actin antibodies
(10 ␮g/ml). The primary antibodies were located by alkaline phosphatase-conjugated goat anti-mouse IgG. Lysates (25 ␮g) from vector-transfected cells were also
analyzed.
sponse to PXR activators. Cells (293T) were transfected stably to
express hPXR, and clones responding to rifampicin were stably transfected again with the CYP3A4-ER6 reporter. The resultant dually
Downloaded from dmd.aspetjournals.org at ASPET Journals on August 3, 2017
FIG. 1. CYP3A4 enhancer and promoter reporters were differentially activated
in CV-1 and 293T cells.
transfected clones, designated hPXR-HRE cells, were tested for the
ability to respond to rifampicin and dexamethasone, two prototypical
CYP3A inducers that have a different potency toward human PXR
(Pascussi et al., 2001). Figure 2A shows the representative results
from hPXR-HRE cells. Both rifampicin and dexamethasone caused a
concentration-dependent activation of the reporter. At higher concentrations (ⱖ5 ␮M), rifampicin caused a significantly higher activation
than dexamethasone, with the highest activity being ⬃7- and 4-fold,
respectively. In contrast, at nanomolar concentrations (0.05 and 0.1
␮M), dexamethasone caused higher activation than rifampicin. Overall, dexamethasone caused a biphasic activation pattern, whereas
rifampicin caused a monophasic activation pattern (Fig. 2A). The
differences on the activation profiles and relative potency between
dexamethasone and rifampicin were similar to those reported on the
induction of CYP3A4 in primary hepatocytes (Pascussi et al., 2001).
In addition, the stable transfected cells supported a higher activation
than transient cotransfection (3.5- versus 5.8-fold at 10 ␮M of rifampicin) (Figs. 1A and 2A).
Several investigators reported that the biphasic induction of
CYP3A4 by dexamethasone in hepatocytes is achieved through
two distinct mechanisms: initial induction of PXR (phase I) and
subsequent activation of this receptor (phase II) (Huss and Kasper.,
2000; Pascussi et al., 2000, 2001). Next we examined whether
dexamethasone increases the expression of the FLAG-tagged PXR
in the stably transfected cells as seen with the PXR endogenous
gene in hepatocytes. The samples used for assaying reporter activities (10 ␮M shown only) were subjected to Western analyses
with an anti-FLAG antibody. As shown in Fig. 2B, cells treated
with rifampicin expressed similar levels of PXR as DMSO-treated
cells. In contrast, dexamethasone-treated cells expressed two times
as much. Such an increased expression was detected in both
nuclear and cytosolic fractions. Consistent with the immunoblotting analyses, immunocytochemical studies visualized by confocal
microscope revealed that dexamethasone-treated cells exhibited a
generally brighter staining than cells treated with rifampicin or
DMSO. Although some cells showed higher staining than others,
the overall distribution of PXR between the nucleus and cytoplasm
was comparable among all treatments (Fig. 2C). The confocal
images were obtained with a chamber slide, which was immunochemically stained in a single container to ensure that cells in
different chambers were uniformly processed. The experiments
were repeated four times and consistent results were obtained. No
staining was observed in the vector-transfected cells or when the
primary antibody was replaced with control IgG (data not shown).
PXR Bindings Are Dependent on the Genomic Context, and
Rifampicin Modulates Such Bindings. The hPXR-HRE cells responded to rifampicin and dexamethasone similarly as cultured hepatocytes in terms of relative potency and activation profiles (Pascussi et
al., 2001), suggesting that these cells provide a valid model to study
intracellular interactions between PXR and its response elements. We
next performed CHIP to determine whether promoters targeted by
PXR were selectively precipitated by an anti-FLAG antibody (recognizing the transfected PXR). Several target genes were chosen including CYP2B6, CYP3A4, CYP3A7, and MDR1. The promoters of these
genes contain one or more PXREs (e.g., DR3, ER6) and have been
shown to respond to PXR-mediated transactivation by cotransfection
experiments (Goodwin et al., 2001, 2002; Geick et al., 2002; Kast et
al., 2002; Toell et al., 2002). The hPXR-HRE cells were treated with
DMSO or rifampicin (10 ␮M), and a small portion of the cells was
collected for assaying reporter activity (data not shown), whereas the
remaining cells were cross-linked with formaldehyde. The nuclei were
isolated, and the chromatins were sonicated. The sonicated chromatins
PXR DIFFERENTIALLY BINDS TO ITS RESPONSE ELEMENTS
39
Downloaded from dmd.aspetjournals.org at ASPET Journals on August 3, 2017
FIG. 2. Activation of the chromatinized CYP3A4-ER6 reporter by rifampicin and dexamethasone and their effect on the expression of the transfected PXR.
A, activation of the chromatinized CYP3A4-ER6 reporter. The stable transfected cells (hPXR-HRE) were seeded in 24-well plates in Dulbecco’s modified Eagle’s
medium supplemented with 10% delipidated fetal calf serum. After a 12-h incubation, cells (⬃80% confluence) were treated for 24 h with various concentrations (0.005–50
␮M) of rifampicin, dexamethasone, or the same volume of DMSO. Cells were harvested in passive lysis buffer (Promega), and lysates (10 ␮l) were assayed for firefly
luciferase activity. The luminescence signal was normalized based on the amount of protein, and the ratio of rifampicin or dexamethasone over DMSO treatment served
as fold induction. Data represent the mean of assays in triplicate ⫾ S.D. ⴱ, significantly different between rifampicin and dexamethasone treatments according to Student’s
t test (p ⬍ 0.05). B, Western analyses. Nuclear and cytosolic fractions (10 ␮g) from hPXR-HRE cells treated with DMSO, dexamethasone (10 ␮M), or rifampicin (10 ␮M)
were analyzed for the abundance of transfected PXR with the anti-FLAG antibody. The same blots were also detected with the anti-␤-actin antibody. C, immunocytochemical analyses. hPXR-HRE cells were seeded in chamber slides at ⬃40% confluence and treated with rifampicin (10 ␮M), dexamethasone (10 ␮M), or the same volume
of DMSO. After a 24-h incubation, cells were fixed in ice-cold 10% acetone for 10 min, then air-dried. The chambers were removed, and the entire slide was stained for
the expression of the transfected PXR as described under Materials and Methods. The slide was analyzed by confocal microscope. The images were obtained with 50⫻
magnification.
were subjected to centrifugation to remove large DNA fragments and
analyzed by agarose gel electrophoresis to ensure that the sonicated
chromatins in the supernatants had an average length of ⬃1.5 kb (data
not shown). The resultant chromatins were subjected to immunoprecipitation with an anti-FLAG antibody-coated agarose beads and
analyzed by PXR for the relative abundance of genomic fragments
targeted by PXR.
The results of the CHIP experiments are summarized in Fig. 3A.
For all target genes, PCR amplifications with DNA input as the
template resulted in a product with a predicted size (Table 1). The
relative intensities of the amplified products were comparable among
the target sequences, suggesting that the genes analyzed have a similar
copy number in the hPXR-HRE cells (Fig. 3A). In contrast, the
relative intensities varied markedly among the amplified products
40
SONG ET AL.
TABLE 2
PXR response elements in CYP2B6, CYP3A4, CYP3A7, and MDR1
Element
Configuration
Sequence
Reference
CYP2B6
CYP3A4-P
CYP3A4-D
CYP3A7-P
CYP3A7-D
MDR1
DR4
ER6
DR3
ER6
DR3
DR4
GGGTCAggaaAGTACA
TGAACTcaaaggAGGTCA
TGAACTtgcTGACCC
TTAACTcaatggAGGTCA
TGAACTtgcTGACCC
TGAACTaactTGACCT
Goodwin et al., 2001
Goodwin et al., 1999
Goodwin et al., 1999
Pascussi et al., 1999
Bertilsson et al., 2001
Geick et al., 2002
Finally, a master tube containing all components except the primers
was prepared and equally distributed among all PCR tubes to minimize intertube variations. These controls ensured the specificity of the
CHIP experiments.
Discussion
when the immunocomplexed DNA was used as the template (Fig. 3A,
middle and bottom). The genomic fragments containing the CYP2B6,
CYP3A4-P, MDR1, or the integrated CYP-ER6 element were amplified to a markedly higher extent than those containing the CYP3A4-D,
CYP3A7-P, or CYP3A7-D element. Interestingly, when the precipitated DNA from the rifampicin-treated cells was used as the template,
the abundant amplification of MDR1 and CYP2B6 sequences was
markedly diminished (Fig. 3). It should be emphasized that more PCR
cycles were performed with precipitated than input DNA (32 versus
40).
Several control experiments were conducted to validate the CHIP
experiments. The DEC2 fragment, derived from a gene that is not a
PXR target based on transient cotransfection experiments (Li et al.,
2003), was detected only when the DNA input was used as the
template. The anti-FLAG-coated beads, saturated by FLAG-tagged
PXR lysates before being used for CHIP, failed to precipitate chromatins even with excessive cycles of PCR amplification (data not
shown). The PCR analyses were performed with more than one pair
of primers on each target gene, and consistent results were obtained.
Downloaded from dmd.aspetjournals.org at ASPET Journals on August 3, 2017
FIG. 3. Intracellular interaction of PXR and its response elements.
A, chromatin immunoprecipitation. The soluble chromatins from DMSO- or
rifampicin-treated cells were subjected to immunoprecipitation with the anti-FLAG
antibody. The precipitated chromatins were eluted and incubated at 65°C for 7 h to
reverse the cross-linking. The DNA (5% input) prior to immunoprecipitation
(DMSO-treated cells only) and PXR-immunoprecipitated DNA from DMSO or
rifampicin-treated cells were analyzed for the abundance of the genomic fragment
harboring the CYP2B6, CYP3A4 distal (3A4-D), CYP3A4 proximal (3A4-P),
CYP3A7 distal (3A7-D), CYP3A7 proximal (3A7-P), MDR1 PXR element, as well
as the genomic fragment from the DEC2 gene. A master tube containing all
components including the DNA template except the primers was prepared and
equally distributed among all PCR tubes to minimize intertube variations. B,
normalized relative intensity. The PCR-amplified fragments were quantified by
densitometry. The intensities of the PCR fragments amplified from the precipitated
chromatins (both DMSO- and rifampicin-treated cells) were expressed as ratios over
the intensities of the corresponding fragments amplified from the input DNA. Three
individual experiments were performed, and the intensities were normalized based
on the molecular marker.
This study reports the intracellular interactions of PXR with its
varying response elements in the presence or absence of rifampicin, a
potent PXR activator. A stable transfected line hPXR-HRE, constitutively expressing human PXR and harboring the CYP3A4-ER6 reporter in the genome, responds to rifampicin and dexamethasone
similarly as cultured hepatocytes in terms of relative potency and
activation kinetics (Pascussi et al., 2001). CHIP experiments with
input DNA produce comparable PCR amplifications among the target
genes analyzed. In contrast, CHIP experiments with PXR-complexed
DNA results in markedly differential amplifications, suggesting that
this receptor differentially interacts with its response elements intracellularly. The proximal element in the CYP3A4 gene is preferably
bound over the distal element, whereas the opposite is true with the
CYP3A7 gene.
The binding preference toward the CYP3A4-ER6 (proximal) over
the CYP3A4-DR3 (distal) element is likely due to the difference on
the genomic context rather than the binding affinity. Electrophoretic
mobility shift assays have demonstrated that in vitro translated PXRRXR␣ heterodimers bind comparably to both elements, and the binding of radiolabeled ER6 element is equally competed by unlabeled
CYP3A4-DR3 or -ER6 element, suggesting that PXR has a similar
binding affinity toward both elements (Goodwin et al., 1999). In this
study, the CYP3A4-ER6-containing fragment is consistently precipitated preferably over that of the CYP3A4-DR3 element by a ratio of
5:1 (Fig. 3A), and the regions harboring these two elements exhibit
little sequence identity, suggesting that the difference on the genomic
contexts is responsible for such differentially intracellular interactions. The precise mechanism on the preferable binding of CYP3A4ER6 remains to be determined. It is likely that the CYP3A4-ER6
element is located in the region where the basal transcriptional apparatus is present (Goodwin et al., 1999), which provides a platform for
better interactions with nuclear proteins.
The CYP3A7 elements (distal and proximal), in contrast to their
CYP3A4 counterparts, exhibit an opposite binding preference, although the overall interactions are markedly diminished in the
CYP3A7 gene (Fig. 3). The CYP3A7-DR3 is identical to the
CYP3A4-DR3 element, whereas the CYP3A7-ER6 differs from the
CYP3A4-ER6 (Table 2). Two forms (ER6-Itoh and ER6-jmp) of the
CYP3A7-ER6 element have been reported with the ER6-Itoh having
a single base deletion in the 3⬘-half-site of the element (Itoh et al.,
1992). Even in the case of the CYP3A7-ER6-jmp, a single nucleotide
substitution is located compared with the CYP3A4-ER6 element
(TTAACT versus TGAACT) (Goodwin et al., 1999; Pascussi et al.,
1999). In vitro translated PXR-RXR␣ heterodimers are shown to
effectively bind to the CYP3A7-ER6-jmp but not the CYP3A7-ER6Itoh. However, such a binding is readily displaced by the CYP3A4-
PXR DIFFERENTIALLY BINDS TO ITS RESPONSE ELEMENTS
(Gonzalez and Carlberg, 2002). Finally, it has been well established
that many hormone receptors such as thyroid hormone receptor,
structurally related to PXR, exert repressive activity in the absence of
a ligand (Li et al., 2002a). Therefore, the availability of corepressors,
coactivators, and ligands (exogenous and endogenous) collectively
determines the overall transactivation activity mediated by PXR.
The biphasic activation on the reporter by dexamethasone but not
rifampicin suggests that this steroid acts on more than one pathway to
regulate the expression of PXR target genes. In primary hepatocytes
and some hepatic cell lines, dexamethasone causes a biphasic pattern
of CYP3A4 induction (Huss and Kasper, 2000; Pascussi et al., 2000,
2001). It has been proposed that the initial phase of CYP3A induction
is due to induction of PXR, and the induced PXR in turn interacts with
unknown ligand and causes induction of CYP3A. In this study, the
stable transfected hPXR-HRE cells constitutively express high levels
of PXR, and such an abundant expression is sufficient to confer even
higher activation. In support of this notion, rifampicin causes higher
activation than dexamethasone but does not increase the PXR expression (Fig. 2). Interestingly, we have not observed such a biphasic
activation with a transiently transfected reporter (data not shown),
suggesting that chromatin environment is responsible for the biphasic
activation in the stable transfected cells. Similar observation has been
made with RAR and RXR␣, two receptors structurally related to PXR.
A transiently introduced reporter supports continuous, cooperative
activation of transcription by RAR and RXR ligands, whereas a
chromatinized reporter exhibits a complex biphasic activation pattern
(Lefebvre et al., 2002).
In summary, our work points to several important conclusions.
First, PXR elements (e.g., CYP3A4-ER6 and -DR3), even with similar affinity toward this receptor, are differentially bound by PXR
intracellularly, suggesting that the genomic context plays an important
role in PXR-DNA interactions. Second, PXR-mediated constitutive
binding (e.g., MDR1) can be modulated by a PXR ligand, providing
an additional mechanism by which PXR regulates its target genes.
Third, the relative abundance of an element present in the PXRprecipitated chromatins from rifampicin-treated cells is correlated
well with the sensitivity to PXR-mediated induction among the genes
analyzed, suggesting that PXR plays an essential role in determining
induction specificity and magnitude. Fourth, dexamethasone but not
rifampicin causes a biphasic activation in the chromatinized reporter,
suggesting that this steroid acts on more than one pathway to regulate
the expression of PXR target genes (probably by modulating chromatin environment). Given the fact that PXR is found to regulate an
increasing number of genes in assays such as transient cotransfection,
the findings presented in this study provide important molecular
insight that only the intracellular complexes between a liganded PXR
and its element likely confer transcription activation.
References
Bertilsson G, Berkenstam A, and Blomquist P (2001) Functionally conserved xenobiotic responsive enhancer in cytochrome P450 3A7. Biochem Biophys Res Commun 280:139 –144.
Geick A, Eichelbaum M, and Burk O (2002) Nuclear receptor response elements mediate
induction of intestinal MDR1 by rifampin. J Biol Chem 276:14581–14587.
Gonzalez MM and Carlberg C (2002) Cross-repression, a functional consequence of the physical
interaction of non-liganded nuclear receptors and POU domain transcription factors. J Biol
Chem 277:18501–18509.
Goodwin B, Hodgson E, and Liddle C (1999) The orphan human pregnane X receptor mediates
the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module. Mol
Pharmacol 56:1329 –1339.
Goodwin B, Moore LB, Stoltz CM, McKee DD, and Kliewer SA (2001) Regulation of the human
CYP2B6 gene by the nuclear pregnane X receptor. Mol Pharmacol 60:427– 431.
Goodwin B, Redinbo MR, and Kliewer SA (2002) Regulation of cyp3a gene transcription by the
pregnane x receptor. Annu Rev Pharmacol Toxicol 42:1–23.
Greuet J, Pichard L, Bonfils C, Domergue J, and Maurel P (1996) The fetal specific gene
CYP3A7 is inducible by rifampicin in adult human hepatocytes in primary culture. Biochem
Biophys Res Commun 225:689 – 694.
Hu M and Yan B (1999) Isolation of multiple distinct cDNAs by a single cDNA-trapping
procedure. Anal Biochem 266:233–235.
Downloaded from dmd.aspetjournals.org at ASPET Journals on August 3, 2017
ER6, suggesting that the CYP3A7-ER6, even in the form of ER6-jmp,
represents a lower affinity-binding site for PXR (Pascussi et al.,
1999). Given the importance of the ER6 element on CYP3A induction
(Goodwin et al., 1999), the markedly less intracellular interactions of
the CYP3A7-ER6 established by the CHIP experiments provide a
molecular explanation that CYP3A4 is a more sensitive target of PXR
than CYP3A7 (Rae et al., 2001).
It is interesting to notice that rifampicin modulates the overall PXR
binding among its target genes, particularly on the MDR1 gene. In the
absence of rifampicin, the MDR1 promoter shows the most PXR
binding; however, such an abundant binding is markedly diminished
in cells treated with rifampicin (Fig. 3). This drastic reduction is likely
due to the clustered elements in the MDR1 gene (Geick et al., 2002).
In the distal regulatory region, a PXR-binding cluster (only 48 nucleotides long) is located to include three DR4 elements, one DR3, and
one ER6. These elements overlap at least by one half-site. Gel
mobility shift assays show that several of the elements bind to PXRRXR␣ heterodimers, although the binding affinity varies from element to element (Geick et al., 2002). Nevertheless, the clustered
elements likely increase the likelihood to interact with PXR, resulting
in an abundant presence of the MDR1 promoter in the PXR-complexed chromatins from the DMSO-treated cells. However, mechanisms for rifampicin-induced reduction on the interactions remain to
be determined. It is likely that interactions between PXR and clustered
elements are weak and may not tolerate conformation changes as a
result of dissociation or recruitment of cofactors initiated by the
PXR-ligand binding. In addition to MDR1, CYP2B6 has exhibited the
rifampicin-induced reduction on the interactions. Interestingly, among
the target genes analyzed, only MDR1 and CYP2B6 contain DR4
elements (Table 2).
The most intracellular interactions of the CYP3A4-ER6 detected by
CHIP in the presence of rifampicin are highly consistent with numerous reports that the CYP3A4 gene is the most sensitive target of PXR
among the genes analyzed (Greuet et al., 1996; Schuetz et al., 1996;
Rae et al., 2001), suggesting that the presence of a liganded PXR in
the promoter determines induction specificity and magnitude. However, overexpression of PXR does not necessarily change the equation
toward a higher induction. As a matter of fact, in some cases, high
levels of PXR expression cause even lower transactivation. In this
study, 293T cells support markedly higher expression of transfected
PXR than CV-1 cells; however, the overall activation is inversely
correlated with the PXR levels (3.6- versus 4.3-fold) (Fig. 1A). Even
in 293T cells, dexamethasone but not rifampicin markedly increases
the expression of the transfected PXR; however, rifampicin causes a
higher activation (5.7 versus 3.8 at 10 ␮M) (Fig. 2A). The precise
mechanisms remain to be determined on such a disproportional relationship. It is likely that high levels of the cytoplasmic PXR in 293T
cells are readily accessible to PXR ligands and thus decrease the
amount of ligands for the nuclear PXR. Alternatively, free PXR
molecules (e.g., unbound to a DNA element) retain the ability to
interact a ligand, and such PXR-ligand complexes recruit then deplete
coactivators (e.g., steroid receptor coactivator-1), which are required
for PXR-mediated transcription activation (Kliewer et al., 1998).
Unliganded PXR, if bound to a DNA element, may actually exert
repressive activity. Several lines of evidence support this possibility.
First, mice selectively lacking functional PXR have higher mRNA
levels of CYP3A than the corresponding wild-type mice, providing
direct evidence that unliganded PXR represses basal transcription of
its target genes (Xie et al., 2000; Staudinger et al., 2001). Second,
PXR and its functionally related protein constitutive androstane receptor have been recently shown to interact with Pit-1 in the absence
of a ligand, and such an interaction is transcriptionally repressive
41
42
SONG ET AL.
Pascussi JM, Jounaidi Y, Drocourt L, Domergue J, Balabaud C, Maurel P, and Vilarem MJ
(1999) Evidence for the presence of a functional pregnane X receptor response element in the
CYP3A7 promoter gene. Biochem Biophys Res Commun 260:377–381.
Rae JM, Johnson MD, Lippman ME, and Flockhart DA (2001) Rifampin is a selective,
pleiotropic inducer of drug metabolism genes in human hepatocytes: studies with cDNA and
oligonucleotide expression arrays. J Pharmacol Exp Ther 299:849 – 857.
Schuetz EG, Beck WT, and Schuetz JD (1996) Modulators and substrates of P-glycoprotein and
cytochrome P4503A coordinately up-regulate these proteins in human colon carcinoma cells.
Mol Pharmacol 49:311–318.
Shou M, Lin Y, Lu P, Tang C, Mei Q, Cui D, Tang W, Ngui JS, Lin CC, Singh R, et al. (2001)
Enzyme kinetics of cytochrome P450-mediated reactions. Curr Drug Metab 2:17–36.
Skatrud PL (2002) The impact of multiple drug resistance (MDR) proteins on chemotherapy and
drug discovery. Prog Drug Res 58:99 –131.
Staudinger JL, Goodwin B, Jones SA, Hawkins-Brown D, MacKenzie KI, LaTour A, Liu Y,
Klaassen CD, Brown KK, Reinhard J, et al. (2001) The nuclear receptor PXR is a lithocholic
acid sensor that protects against liver toxicity. Proc Natl Acad Sci USA 98:3369 –3374.
Toell A, Kroncke KD, Kleinert H, and Carlberg C (2002) Orphan nuclear receptor binding site
in the human inducible nitric oxide synthase promoter mediates responsiveness to steroid and
xenobiotic ligands. J Cell Biochem 85:72– 82.
Watkins RE, Wisely GB, Moore LB, Collins JL, Lambert MH, Williams SP, Willson TM,
Kliewer SA, and Redinbo MR (2001) The human nuclear xenobiotic receptor PXR: structural
determinants of directed promiscuity. Science (Wash DC) 292:2329 –2333.
Xie M, Matoney L, and Yan B (2003) Rat NTE-related esterase is a membrane-associated
protein, hydrolyzes lipophilic esters and interacts with diisopropylfluorophosphate through
serine catalytic machinery. Arch Biochem Biophys 416:137–146.
Xie M, Yang D, Liu L, Xue B, and Yan B (2002) Human and rodent carboxylesterases:
immunorelatedness, overlapping substrate specificity, differential sensitivity to serine enzyme
inhibitors and tumor-related expression. Drug Metab Dispos 30:541–547.
Xie W, Barwick JL, Downes M, Blumberg B, Simon CM, Nelson MC, Neuschwander-Tetri BA,
Brunt EM, Guzelian PS, and Evans RM (2000) Humanized xenobiotic response in mice
expressing nuclear receptor SXR. Nature (Lond) 406:435– 439.
Zhang H, LeCluyse E, Liu L, Hu M, Matoney L, and Yan B (1999) Rat pregnane X receptor:
molecular cloning, tissue distribution and xenobiotic regulation. Arch Biochem Biophys
368:14 –22.
Downloaded from dmd.aspetjournals.org at ASPET Journals on August 3, 2017
Huss JM and Kasper CB (2000) Two-stage glucocorticoid induction of CYP3A23 through both
the glucocorticoid and pregnane X receptors. Mol Pharmacol 58:48 –57.
Itoh S, Yanagimoto T, Tagawa S, Hashimoto H, Kitamura R, Nakajima Y, Okochi T, Fujimoto
S, Uchino J, and Kamataki T (1992) Genomic organization of human fetal specific P-450IIIA7
(cytochrome P-450HFLa)-related gene(s) and interaction of the regulatory factor with its DNA
element in the 5⬘ flanking region. Biochim Biophys Acta 1130:133–138.
Kast HR, Goodwin B, Tarr PT, Jones SA, Anisfeld AM, Stoltz CM, Tontonoz P, Kliewer S,
Willson TM, and Edwards PA (2002) Regulation of multidrug resistance-associated protein 2
(ABCC2) by the nuclear receptors pregnane X receptor, farnesoid X-activated receptor and
constitutive androstane receptor. J Biol Chem 277:2908 –2915.
Kliewer SA, Moore JT, Wade L, Staudinger JL, Watson MA, Jones SA, McKee DD, Oliver BB,
Willson TM, Zetterstrom RH, et al. (1998) An orphan nuclear receptor activated by pregnanes
defines a novel steroid signaling pathway. Cell 92:73– 82.
Lefebvre B, Brand C, Lefebvre P, and Ozato K (2002) Chromosomal integration of retinoic acid
response elements prevents cooperative transcriptional activation by retinoic acid receptor and
retinoid X receptor. Mol Cell Biol 22:1446 –1459.
Li X, Kimbrel EA, Kenan DJ, and McDonnell DP (2002a) Direct interactions between corepressors and coactivators permit the integration of nuclear receptor-mediated repression and
activation. Mol Endocrinol 16:1482–1491.
Li Y, Zhang H, Xie M, Ge S, Hu M, Yang D, Wan Y, and Yan B (2002b) DEC1/STRA13/
ShARP2 is abundantly expressed in colon carcinoma, antagonizes serum deprivation-induced
apoptosis and selectively inhibits the activation of procaspases. Biochem J 367:413– 422.
Li Y, Xie M, Song X, Gragen S, Sachdeva K, Wan Y, and Yan B (2003) DEC1 negatively
regulates the expression of DEC2 through binding to the E-box in the proximal promoter.
J Biol Chem 278:16899 –16907.
Moore LB, Goodwin B, Jones SA, Wisely GB, Serabjit-Singh CJ, Willson TM, Collins JL, and
Kliewer SA (2000) St. John’s wort induces hepatic drug metabolism through activation of the
pregnane X receptor. Proc Natl Acad Sci USA 97:7500 –7502.
Pascussi JM, Drocourt L, Fabre JM, Maurel P, and Vilarem MJ (2000) Dexamethasone induces
pregnane X receptor and retinoid X receptor-alpha expression in human hepatocytes: synergistic increase of CYP3A4 induction by pregnane X receptor activators. Mol Pharmacol
58:361–372.
Pascussi JM, Drocourt L, Gerbal-Chaloin S, Fabre JM, Maurel P, and Vilarem MJ (2001) Dual
effect of dexamethasone on CYP3A4 gene expression in human hepatocytes. Sequential role
of glucocorticoid receptor and pregnane X receptor. Eur J Biochem 268:6346 – 6358.