Download Short Communication Highly sensitive detection of cancer cells

Short Communication
Highly sensitive detection of cancer cells based on the DNA barcode assay
and micro-capillary electrophoretic analysis
Soyi Chung, Minkyung Cho, Jae Hwan Jung, and Tae Seok Seo*
Department of Chemical and Biomolecular Engineering (BK21 Program), Korea Advanced Institute of Science
and Technology (KAIST), Daejeon 305-701, Republic of Korea
*
Correspondence: Professor Tae Seok Seo, Department of Chemical and Biomolecular Engineering (BK21
Program), Korea Advanced Institute of Science and Technology (KAIST), 291 Daehak-ro, Yuseong-gu, Daejeon
305-701, Korea, E-mail: [email protected], Fax: +82-42-350-3933
Reagents
DMEM, leibovitz’s (L-15 medium), 0.25% trypsin-EDTA, fetal bovine serum (FBS),
and penicillin streptomycin were obtained from Gibco by Life Technologies (Grand Island,
NY, USA). Magnetic particles (Dynabeads® MyOne™ Streptavidin T1, diameter 1 μm and
Dynabeads® M-280 Tosylactivated, diameter 2.8 μm) were purchased from Invitrogen™ by
Life Technologies (Oslo, Norway). Polystyrene particle (ProActive® Streptavidin Coated
Microspheres, diameter 1 μm) was supplied by Bangs Laboratories, Inc. (Fishers, IN, USA).
EZ-Link™ Sulfo-NHS-LC Biotinylation kit was obtained from Thermo Scientific (Rockford,
IL, USA) to label monoclonal antibodies with biotins. Monoclonal epithelial cell adhesion
molecule (EpCAM) antibody and biotinylated polyclonal EpCAM antibody were purchased
from Millipore Corporation (#MAB4444, Temecula, CA, USA) and R&D systems (BAF960,
Minneapolis, MN, USA), respectively. Biotinylated polyclonal CDX2 was purchased from
Bioss Inc. (bs-1620R-Biotin, Boston, MA, USA). Oligonucleotides were synthesized by
Bioneer Corporation (Seoul, Korea) or Neoprobe (Daejeon, Korea). PBS powder and boric
acid were supplied by Sigma Aldrich (St.Louis, MO, USA) and hydroxyl PEG Biotin (BiotinPEB-OH) with 2000 molecular weight was obtained from Nanocs Inc. (Boston, MA, USA).
Cell culture
Breast carcinoma cell lines MCF-7, and colorectal carcinoma cell lines SW620 were
used as replacement of circulating tumor cells. All cell lines were purchased from Korean
Cell Line Bank (KCLB, Seoul, Korea). MCF-7 was cultured using DMEM while SW620 was
cultured in leibovitz’s (L-15 medium). Culture media were supplemented with 10% FBS, and
1% penicillin streptomycin. The cell lines were grown as an adherent monolayer in a T75
culture flask and incubated at 37°C under 5 % CO2 and 90% humidity conditions. We
changed cell media for every 2 to 3 days. The cell lines were washed by a PBS solution and
detached by 2 mL of 0.25% trypsin-EDTA at 37°C and 5 % CO2 incubation for 3 min,
followed by centrifugation of 1300 rpm for 3 min. The cells were resuspended in the culture
media and used for the cell detection experiment.
Synthesis of magnetic particle probes
Two types of magnetic particle probes were synthesized; anti-EpCAM monoclonal
antibody labeled MMPs (anti-EpCAM MMPs) and 15 bp and 45 bp bracket ladder DNA
labeled MMPs (15 bp MMPs and 45 bp MMPs). Anti-EpCAM MMPs were synthesized by
covering the monoclonal antibody on the surface of the streptavidin coated magnetic particles.
To prepare anti-EpCAM MMPs, monoclonal EpCAM antibodies were first biotinylated using
a biotinylation kit according to manufacturer’s protocol. Then, the biotinylated monoclonal
antibodies were linked to the streptavidin coated magnetic particles (Dynabeads® MyOne™
Streptavidin T1) using a recommended protocol. Briefly, 100 μL of the micro-magnetic
particle (MMP) solution containing about 7 to 10  108 beads (approximately 1 mg) was
washed three times with a 0.01 M PBS buffer. The tube containing the magnetic particle
solution was placed in a magnet holder for 2 min and the supernatant was discarded. The
resulting magnetic pellet was resupended with 20 μg of biotinylated monoclonal antibodies in
a 0.01 M PBS buffer for 30 min at room temperature using a Dynabeads® Sample Mixer.
After the incubation, the antibody conjugated MMPs were placed on an external magnet and
washed two times. Subsequently, the MMPs were incubated for 30 min in a 0.032 mg/mL
hydroxyl PEG Biotin (Biotin-PEG-OH) solution to block the non-specific binding of
biomolecules on the surface of MMPs. The magnetic separation step was repeated twice to
remove the unreacted Biotin-PEG-OH. Finally, the magnetic probes were resuspended in a 1
mL 0.01 M PBS buffer and stored at 4 °C prior to use. The coupling efficiency was calculated
to be 90% based on the UV absorbance at 280 nm before and after the conjugation reaction.
In addition, 15 bp MMPs and 45 bp MMPs were synthesized to conjugate the double
strand DNA over the surface of tosyl magnetic particles. Tosyl-activated magnetic beads
(Dynabeads® M-280 Tosyl-activated) were linked to the amine-functionalized double
stranded bracket ladder DNAs (15 bp and 45 bp) according to the previously reported
protocol. [1] 100 μL of a tosyl micro-magnetic particle (tosyl MMP) solution (2  108 beads,
~3 mg) were washed three times with 1 mL of a 0.1 M borate buffer. The resulting solution
was resuspended with the double stranded DNA solution. Complementary single stranded
DNAs (see Table S1) were hybridized by denaturing at 95 °C for 1 min followed by gradient
cooling of 0.1 °C/s down to 25 °C. The conjugation of the amino-functional group of the
double stranded DNA to the tosyl group of the tosyl MMPs was carried out at 37 °C for 48 h
under vortex. The double stranded DNA conjugated tosyl MMPs were then washed twice
time with a 0.01 M PBS. Then, the tosyl MMPs were passivated by adding 1 mL of a 0.5 %
BSA solution at 37 °C for 4 h. The tosyl MMPs were magnetically separated and washed
with a 0.01 M twice. Eventually, the tosyl MMPs were resuspended in 1 mL of a 0.01 M PBS
buffer and stored at 4 °C prior to use.
Synthesis of polystyrene particle probes
In order to prepare anti-EpCAM polyclonal antibody and 20 bp barcode DNA labeled
polystyrene microparticles (anti-EpCAM & 20 bp PMPs) and anti-CDX2 polyclonal antibody
and 30 bp barcode DNA labeled PMPs (anti-CDX2 & 30 bp PMPs), coupling chemistry
between streptavidin and biotin was employed. 200 μL of an aqueous streptavidin coated
PMP (about 2 mg) solution was washed by 1 mL of a 0.01 M PBS buffer under the
centrifugation at 13,000 rpm for 3 min and the supernatant was removed. The resulting
polystyrene pellet was resuspended with 60 μg of biotinylated polyclonal antibodies in a 0.01
M PBS buffer at room temperature for 30 min using a Dynabeads® Sample Mixer. After the
incubation, a washing step was repeated three times with 1 mL of a 0.01 M PBS solution and
the resulting pellet was resuspended with a double stranded biobarcode DNA solution. FAM
labeled single stranded DNAs were hybridized with biotin labeled DNAs (see Table S1), to
form the FAM and biotin labeled double stranded DNAs. Hybridization was conducted by
denaturing at 95 °C for 1 min followed by gradient cooling of 0.1 °C/s down to 25 °C. The
DNA solution was incubated with the polyclonal antibody coated PMPs for 30 min to
conjugate the double stranded biobarcode DNAs to the PMPs. Conjugation efficiency was
almost 100% due to the rapid and strong biotin and streptavidin interaction. The antibody and
DNA modified PMPs were washed twice under the centrifugation at 13,000 rpm for 3 min.
The synthesized anti-EpCAM & 20 bp PMPs and anti-CDX2 & 30 bp PMPs were passivated
by adding 1 mL of a 0.032 mg/mL PEG solution, followed by the washing step using the
centrifugation at 13000 rpm for 3 min. Finally, the produced PMPs were resuspended in 1 mL
of a 0.01 M PBS buffer and stored at 4 °C in a dark container to reduce photobleaching of the
fluorophore.
Table S1. Information of DNA biobarcode sequences
Sequence (5’  3’)
Name
Amine – ACGTGGGGCACACAG
15bp
FAM – CTGTGTGCCCCACGT
Biotin – GAGGTACATCGAGGTAAGCA
20bp
FAM – TGCTTACCTCGATGTACCTC
Biotin - ATAAGAAACAACTAATACCACATCATCCAT
30bp
45bp
FAM - ATGGATGATGTGGTATTAGTTGTTTCTTAT
Amine - TTAATTACAAATTCATACAATTTTTCAATACTAATTAACATATCG
FAM - CGATATGTTAATTAGTATTGAAAAATTGTATGAATTTGTAATTAA
Table S2. Calculation of relative elution time ratio of barcode DNAs
15 bp
20 bp
30 bp
45 bp
Absolute elution time (Top panel)
109.394 s
113.574 s
123.456 s
134.883 s
* Relative elution time ratio
0.000
0.164
0.552
1.000
Absolute elution time (Middle panel)
99.932 s
103.707 s
123.284 s
* Relative elution time ratio
0.000
0.162
1.000
Absolute elution time (Bottom panel)
95.664 s
107.850 s
117.887 s
* Relative elution time ratio
0.000
0.549
1.000
* Calculation = ( Elution time between a sample and a 15 bp peak) / ( Elution time between a 45 bp peak and
a 15 bp peak)
References :
[1]
Hill, H.D. and C.A. Mirkin, Nat Protoc 2006, 1, 324-336.