Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Integration of light and metabolic signals for stem cell activation at the shoot apical meristem Anne Pfeiffer1, Denis Janocha1, Yihan Dong2, Anna Medzihradszky1, Stefanie Schöne1, Gabor Daum1, Takuya Suzaki1*, Joachim Forner1, Tobias Langenecker3, Eugen Rempel1, Markus Schmid3#, Markus Wirtz2, Rüdiger Hell2, Jan U. Lohmann1 1 Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany 2 Department of Molecular Plant Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany 3 Department of Molecular Biology, Max Planck Institute for Developmental Biology, Tübingen, Germany *Current address: Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Japan 'Current address: Umeå Plant Science Centre, Department of Plant Physiology, Umeå University, Umeå, Sweden Mailing address of corresponding author: Jan U. Lohmann Department of Stem Cell Biology University of Heidelberg Im Neuenheimer Feld 230 PH: +49 6221 546269 D-69120 Heidelberg FX: +49 6221 546424 Germany EM: [email protected] 1 Abstract 2 A major feature of embryogenesis is the specification of stem cell systems, but in 3 contrast to the situation in most animals, plant stem cells remain quiescent until the 4 postembryonic phase of development. Here, we dissect how light and metabolic 5 signals are integrated to overcome stem cell dormancy at the shoot apical meristem. 6 We show on the one hand that light is able to activate expression of the stem cell 7 inducer WUSCHEL independently of photosynthesis and that this likely involves 8 inter-regional cytokinin signaling. Metabolic signals, on the other hand, are 9 transduced to the meristem through activation of the TARGET OF RAPAMYCIN 10 (TOR) kinase. Surprisingly, TOR is also required for light signal dependent stem cell 11 activation. Thus, the TOR kinase acts as a central integrator of light and metabolic 12 signals and a key regulator of stem cell activation at the shoot apex. 2 13 Introduction 14 Light is the sole energy source of plants and therefore one of the most important 15 environmental factors influencing plant development and physiology. Consequently, 16 several of the core developmental decisions during the lifecycle of a plant from 17 germination to seedling development and flowering are strongly influenced by light 18 conditions. After germination, higher plants undergo two distinct developmental 19 programs depending on the availability of light, termed skotomorphogenesis and 20 photomorphogenesis. Skotomorphogenesis, the dark adaptation program, is 21 characterized by an etiolated phenotype, including an elongated hypocotyl, closed 22 cotyledons, the formation of a hypocotyl hook and etioplast development. 23 Importantly, stem cells at the shoot and root tip remain dormant and thus growth in 24 etiolated seedlings is mainly dependent on cell elongation rather than cell division. In 25 contrast, photomorphogenesis, the developmental program triggered in light, leads to 26 seedlings with short hypocotyls, unfolded cotyledons and development of 27 chloroplasts. In the light, shoot and root meristems are activated, leading to root 28 growth and development of the first leaves by cell division and expansion (reviewed 29 in Nemhauser & Chory 2002). 30 Based on evolutionary evidence, photomorphogenesis is the default pathway, since 31 gymnosperms for example do not follow a strict skotomorphogenic development in 32 darkness (Wei, 1994). With the advance of land plants and resulting new 33 environmental challenges such as growth in dense canopy and germination in soil, 34 the evolution of the dark-adapted skotomorphogenesis program ensued an 35 advantage: It allowed plants to allocate the limited energy sources supplied by the 36 seed to maximally grow by elongation, in order to reach favorable light conditions 37 that will provide energy for further growth and development. To faithfully execute 38 these opposing developmental programs, plants have evolved complex mechanisms 39 to perceive light quality and quantity through a whole range of photoreceptors that 40 are mainly absorbing in the blue, red and far-red range of the spectrum. Activation of 41 the blue absorbing CRYPTOCHROMES (crys) and/or the red and far-red absorbing 42 PHYTOCHROMES (phys) overrides the skotomorphogenic program and plants 43 undergo photomorphogenesis within minutes after perception of a light stimulus 44 (reviewed in Chory 2010). On the molecular level, the activated light receptors inhibit 45 the function of the core repressor of photomorphogenesis, CONSTITUTIVE 46 PHOTOMORPHOGENESIS 1 (COP1), an E3 ubiquitin ligase that targets positive 47 regulators of photomorphogenesis for degradation in darkness (Yi & Deng, 2005). At 3 48 the same time, a group of potent transcription factors, the PHYTOCHROME 49 INTERACTING FACTORS (PIFs), which promote skotomorphogenesis in darkness, 50 are degraded upon light perception through the PHYTOCHROMES (Leivar & Quail, 51 2010). The activities of these pathways converge on the differential regulation of 52 thousands of genes resulting in a massive reprogramming of the transcriptome in 53 response to light (Ma et al., 2002; Tepperman et al., 2004; Peschke & Kretsch, 2011; 54 Pfeiffer et al., 2014). 55 Light not only activates the plant’s light receptors, it also fuels photosynthesis and 56 therefore leads to the production of a number of energy rich metabolites including 57 sugars. Plants are able to monitor their metabolic state with several signaling 58 systems (Lastdrager, Hanson & Smeekens, 2014) and recent studies have focused 59 on the evolutionary conserved TARGET OF RAPAMYCIN (TOR) kinase complex 60 (Dobrenel et al., 2016). In other eukaryotes, TOR functions as a central integrator of 61 nutrient, energy, and stress signaling networks. TOR regulates cell growth and 62 proliferation, ribosome biogenesis, protein synthesis, cell wall integrity and 63 autophagy (Díaz-Troya et al., 2008; Henriques et al., 2014; Lastdrager, Hanson & 64 Smeekens, 2014; Xiong & Sheen, 2014). While other eukaryotes possess two TOR 65 complexes, so far only a single complex has been identified in plants. It is comprised 66 of TOR, FKBP12, LST8 and RAPTOR (Mahfouz et al., 2006; Moreau et al., 2012) 67 and thus resembles the mammalian TOR complex 1 (mTORC1). AtTOR is 68 expressed in the embryo and endosperm and in meristematic regions of the adult 69 plant (Menand et al., 2002). While tor null mutants show premature arrest of embryo 70 development (Menand et al., 2002), knock down of TOR leads to growth reduction 71 and affects the carbohydrate and amino acid metabolism (Caldana et al., 2013). In 72 contrast, the presence of sugars in general promotes TOR kinase activity (Ren et al., 73 2012; Dobrenel et al., 2013; Xiong et al., 2013). So far, the only known direct 74 downstream targets of AtTOR kinase are S6 kinase 1 (S6K1) (Schepetilnikov et al., 75 2011, 2013; Xiong et al., 2013), TAP46 (Ahn et al., 2011; Ahn, Ahn & Pai, 2014) and 76 E2 promoter binding factor a (E2Fa) (Xiong et al., 2013). S6K1 plays an important 77 role in reinitiating translation (Schepetilnikov et al., 2011) as well as in the regulation 78 of the cell cycle (Henriques et al., 2010; Shin et al., 2012). Similarly, E2Fa is 79 associated with cell cycle control through the expression of S-phase genes (Polyn, 80 Willems & De Veylder, 2015). Though in plants little is known about how TOR is 81 activated on a molecular level, reports from the past decade suggest that TOR 82 functions as a central regulator of protein synthesis, cell proliferation and metabolism 83 in response to metabolic signals. 4 84 Several photomorphogenic responses, like the inhibition of hypocotyl elongation, 85 unfolding of the hypocotyl hook and cotyledons, as well as chloroplast development 86 can be triggered by a light signal alone, as displayed in dark-grown cop1 and 87 pif1/pif3/pif4/pif5 quadruple mutants (pifq) (Deng & Quail, 1991; Leivar et al., 2009). 88 However, root growth is not induced in cop1 mutants unless sucrose is supplied with 89 the growth medium. Photosynthetic assimilates dominantly promote growth in the 90 root where they can synergistically interact with photoreceptor-triggered light 91 signaling (Kircher & Schopfer, 2012). Recently, Xiong et al. showed that this 92 photosynthesis-driven growth and proliferation in the root is mediated by the TOR 93 kinase (Xiong et al., 2013). 94 Here, we analyzed the role of light and nutrients for post-germination stem cell 95 activation in the shoot apical meristem (SAM) of young seedlings. Stem cell control in 96 the SAM of Arabidopsis thaliana is based on the activity of the homeodomain 97 transcription factor WUSCHEL (WUS), which is expressed in the organizing centre 98 and necessary and sufficient to non-cell autonomously induce stem cell fate by 99 protein movement. Stem cells in turn express CLAVATA3 (CLV3), a short secreted 100 peptide, that acts via the CLV CORYNE (CRN) receptor system to limit the 101 expression of WUS in the OC (Schoof et al., 2000; Daum et al., 2014). The use of a 102 reporter system based on the regulatory regions of WUS and CLV3 allowed us to 103 quantitatively trace behavior of stem cells (pCLV3:mCHERRY-NLS) as well as cells 104 of the underlying organizing center (pWUS:3xVENUS-NLS). With the help of these 105 tools, we were able to genetically dissect the individual contribution of light signaling 106 and photosynthesis-driven nutrient sensing on the stem cell system of the SAM. We 107 show that both pathways ultimately converge at the level of TOR kinase activation, 108 revealing a role for TOR as a central regulator of stem cell activation in response to 109 environmental cues. 5 110 Results 111 Organogenic development is dependent on light and energy metabolites. 112 The SAM of Arabidopsis seedlings remains dormant during skotomorphogenesis and 113 therefore, plants are unable to advance to the organogenic stage in the absence of 114 light. However, since light acts as signal and energy source alike, we first asked 115 which of the two roles is dominant for SAM development. While supplementation of 116 sugar to wild-type seedlings grown in the dark is known to be inefficient to trigger 117 development (Figure 1A), activation of the light pathway alone, either physiologically 118 by low level illumination, or genetically by introduction of the cop1 mutation, was 119 shown to induce photomorphogenic development of the hypocotyl and cotyledons in 120 darkness (Deng & Quail, 1991). Despite this stark developmental transition, SAMs of 121 cop1 mutants were unable to produce organs when grown in the dark. However, the 122 SAM was activated and organogenesis initiated in 100% of the dark-grown cop1 123 mutants when supplemented with sugar as external energy source (Figure 1B, see 124 also McNellis et al., 1994; Nakagawa & Komeda, 2004). Conversely, the SAM of 125 light-grown wild-type seedlings remained dormant when photosynthesis was 126 compromised by the carotenoid biosynthesis inhibitor norflurazon. In line with our 127 observation of cop1 mutants, supplementing the growth medium of these plants with 128 sucrose rescued the dormant phenotype in approximately every third seedling 129 (Figure 1C). Thus, neither the availability of energy metabolites, nor light perception 130 alone was sufficient for SAM activation. In contrast, light and energy, likely in the 131 form of photosynthetic products, seemed to be sensed independently, and both 132 factors need to act cooperatively to trigger SAM development. 133 WUS expression is independently regulated by light and sucrose 134 Our phenotypic analysis suggested that light and metabolic signals synergize to 135 activate SAM development, and thus we asked which of the known components 136 underlying stem cell homeostasis might be the relevant cellular and molecular 137 targets. By using transcriptional reporters for stem cells (pCLV3:mCherry-NLS) and 138 niche cells (pWUS:3xVENUS-NLS) we found that stem cell identity was actively 139 maintained independently of growth conditions and was even observed in the 140 dormant state mediated by germination in the dark (Figure 1D). In contrast, 141 expression of the reporter for the stem cell inducing WUS transcription factor was 142 critically dependent on environmental signals and preceded meristem activity and the 6 143 initiation of organogenic development (Figure 1E). To test if our WUS reporter 144 faithfully recapitulated the behavior of the endogenous gene, we used in situ 145 hybridization and were able to confirm strong light dependent induction of WUS 146 mRNA (Figure 1 – figure supplement 1C and D). Since WUS protein exhibits 147 complex movement and a short lifetime (Daum et al., 2014), we furthermore 148 analyzed the behavior of WUS-GFP protein in vivo by recording the GFP signal in 149 our rescue line (pWUS:WUS-linker-GFP in wus mutant background (Daum et al., 150 2014)). Again, we observed a strong light- and sucrose-dependency of the WUS- 151 GFP signal in line with the observed activation of the WUS promoter and 152 accumulation of the endogenous WUS mRNA under these conditions (Figure 1G-I) 153 confirming that the simple pWUS:3xVenus-NLS reporter represents a faithful and 154 quantitative readout for WUS activity. Taken together, these findings on the one hand 155 suggested that CLV3 expression is at least partially independent of WUS and on the 156 other hand that the environmentally dependent transcriptional activation of WUS is 157 the trigger to overcome stem cell dormancy. 158 Using seedlings carrying both reporters grown under wave-length specific LED 159 illumination 160 (pWUS:3xVENUS-NLS) was below detection level in dark-grown seedlings. In 161 contrast, GFP signals were readily detectable in light-grown plants from three days 162 after germination onwards with the signal steadily increasing over time (Figure 1J). 163 Interestingly, WUS expression was also induced in the absence of light, when plants 164 were grown on sucrose-supplemented medium (Figure 1F, J) and when sucrose was 165 supplied to light-grown seedlings, the effect of light and sucrose on WUS expression 166 was additive (Figure 1J). Light and sucrose also had a similar effect on the regulation 167 of CLV3 expression (Figure 1D-I, K), however, since the CLV3 reporter was already 168 detectable in dark-grown seedlings, the induction of expression by light and sucrose 169 was less pronounced and mainly due to an enlargement of the CLV3 domain rather 170 than an increase of signal intensity in individual cells (Figure 1 figure supplement 1A 171 and B). In sum, development of the SAM required both, light signal transduction and 172 the availability of photosynthetic products, whereas WUS expression was induced 173 also by each signal individually. Thus, tracing WUS expression in the SAM of young 174 seedlings represented a sensitive model to decipher the contribution of upstream 175 signals to stem cell activation in a developmentally and physiologically relevant 176 setting. 177 7 and image quantification we found that the WUS reporter 178 Mechanisms of light dependent stem cell activation 179 Since the expression of the transcriptional WUS reporter showed an early and 180 dynamic response to environmental stimuli that mimicked both endogenous WUS 181 mRNA, as well as WUS-GFP protein, we used the intensity of the reporter signal in 182 four day-old seedlings as an easily quantifiable proxy for stem cell activation. First we 183 wanted to elucidate the molecular players involved in stem cell activation by light. To 184 this end, we irradiated seedlings with monochromatic light of low intensities (30 185 µmol*m-2*s-1) to analyze the effect of light signaling with minimal influence of 186 photosynthesis-derived metabolites. Even at low intensities, blue, as well as red light 187 were sufficient to robustly induce WUS expression (Figure 2A). In line with the well- 188 documented biochemistry of the photoreceptors, red-light-induced WUS activation 189 was specifically reduced in the phyB mutant background, while blue-light-induced 190 reporter activity was impaired in the cry1/cry2 double mutant background (Figure 191 2A). We thus concluded that light perceived through phyB as well as the crys 192 influences the developmental fate of the SAM. 193 We also tested WUS expression under far-red light, which is sensed by phyA and 194 found that reporter activity was only weakly induced by far-red light. Interestingly, 195 phyA mutants showed similar WUS promoter activity under far-red light and in 196 darkness (Figure 2 – figure supplement 1A). However, when we supplemented the 197 growth media with 1% sucrose we observed a clear induction of WUS expression in 198 response to far-red light, which was dependent on a functional copy of PHYA. Still, 199 phyA mutants displayed a basal level of WUS promoter activity already in darkness 200 even when grown on plates containing sucrose, suggesting a complex and so far 201 unknown regulatory role for phyA under these conditions. 202 The fact that plants grown in far-red light are photosynthetically inactive and required 203 an exogenous energy source for WUS activation, while plants under blue and red 204 light did not, raised the question whether minimal levels of photosynthetically derived 205 sugars might contribute to WUS expression in blue and red light, despite the low 206 fluence. Therefore, we tested whether the availability of photosynthetic products is a 207 prerequisite for light-induced WUS expression by chemical interference. However, 208 the inhibition of photosynthesis by either norflurazon or lincomycin, did not affect 209 WUS promoter activity in red or in blue light (Figure 2A). In the presence of 210 lincomycin, WUS expression was even slightly increased under both light conditions. 211 To avoid potential side effects of the pharmacological treatments we also tested the 212 effect of CO2 withdrawal on seedling development and WUS expression. Preventing 8 213 photosynthetic assimilation in a CO2-deficient atmosphere inhibited development of 214 seedlings even when grown in light. This phenotype could be rescued in one third of 215 the plants by adding 1% sucrose to the media, similar to what we observed using 216 norflurazon treatment (compare Figure 1C and Figure 2 - figure supplement 1C). 217 Importantly, WUS induction by red light was unaffected by CO2 reduction in the 218 atmosphere (Figure 2 - figure supplement 1B). Thus, photosynthetically derived 219 metabolites produced in a low light environment were not required for activation of 220 stem cells, confirming that light signaling alone was sufficient for WUS expression. 221 We next asked how the light signal perceived by PHYTOCHROMES and 222 CRYPTOCHROMES is relayed to the nucleus by testing the contribution of known 223 downstream signaling components, such as COP1 and HY5. The E3-ubiquitin ligase 224 COP1, which targets HY5 but also other factors for degradation in darkness, showed 225 robust 226 photomorphogenic development in darkness, which was accompanied by WUS 227 expression (Figure 2B). Furthermore, the repressive function of COP1 was prominent 228 under all conditions tested and cop1-4 seedlings displayed strongly elevated WUS 229 promoter activity compared to wild-type when grown in dark with or without sugar, 230 and also under low light conditions (Figure 2B). To confirm that these effects were 231 not caused by second site mutations present in the cop1-4 background or specific to 232 the allele tested, we used qRT-PCR to assay WUS expression in seedlings carrying 233 other cop1 loss-of-function alleles. However, since this approach lacked the spatial 234 resolution provided by microscopic quantification of the WUS reporter, it proofed to 235 be much less sensitive. Still, we were able to detect accumulation of endogenous 236 WUS mRNA in response to light in 7d old wild-type seedlings, as well as in cop1-4 237 mutants in the dark (Figure 2 - figure supplement 1D). Importantly, all three cop1 238 mutant alleles tested showed robust elevation of WUS mRNA levels when grown in 239 the dark (Figure 2 - figure supplement 1E), demonstrating that loss of COP1 function 240 leads to activation of WUS. 241 One of the main functions of COP1 is to target the transcription factor HY5, a positive 242 master regulator of photomorphogenesis, for degradation. Thus, we analyzed the 243 role of HY5 working under the hypothesis that in contrast to cop1 mutants, which had 244 shown elevated WUS reporter expression, hy5 mutants should suffer from a much 245 reduced meristem activity due to the absence of an important photomorphogenesis 246 stimulating activity. However, hy5 mutants were unaffected in activation of WUS 247 expression (Figure 2 – figure supplement 1F), suggesting that SAM stem cell 9 inhibitory effects on WUS expression. Cop1-4 mutants displayed 248 activation is dependent on another COP1-targeted transcriptional transducer, such 249 as HY5 HOMOLOG (HYH), or a so far unknown regulator. 250 Since the SAM is shielded from the environment especially in etiolated seedlings, 251 where it is buried between the closed cotyledons and protected by the apical hook of 252 the hypocotyl, it seemed questionable that the meristem itself is the site of light 253 perception. We therefore tested the competence of different tissues to perceive light 254 signals and translate them into a stem cell activating output. To this end, we 255 expressed a constitutive active form of phyB (Su & Lagarias, 2007) under different 256 tissue specific promoters (Figure 2 – figure supplement 1C, D). Expression of phyB 257 Y276H under an ubiquitous promoter (pUBI10) caused strong cop1-like phenotypes 258 and a substantial activation of the WUS promoter in the SAM showing that transgenic 259 activation of light signaling is sufficient to trigger stem cell activation in darkness 260 (Figure 2 – figure supplement 1G, H, J). In line with our hypothesis that light is likely 261 perceived by cells outside the SAM, vascular specific expression of phyB Y276H by 262 the pSUC2, or mesophyll specific expression by pCAB3 promoters (Ranjan et al., 263 2011) initiated constitutive photomorphogenic phenotypes and WUS expression in 264 dark-grown seedlings. Similar results were also obtained for the epidermal pML1 265 promoter, in lines showing high expression levels of phyB Y276H (Figure 2 – figure 266 supplement 1G-J). These results suggested that downstream of light perception the 267 stimulus can be transmitted between tissues by a mobile signal and raised the 268 question whether the SAM itself even has the ability to respond to light. To explore 269 this, we expressed phyB Y276H specifically in the SAM under the promoter of 270 At3g59270 (Yadav et al., 2009), but in contrast to expression outside of the SAM, we 271 observed fully etiolated seedlings without detectable WUS expression when these 272 plants were grown in the dark. Even when we drove PHYB Y276H expression in cells 273 surrounding the organizing center by the promoter of At1g26680 (Yadav et al., 2009), 274 we only observed a minor reduction in hypocotyl elongation in darkness compared to 275 wild-type and marginal WUS expression (Figure 2 – figure supplement 1G, H, J). We 276 therefore conclude that light is perceived by cells outside of the SAM, likely in the 277 cotyledons or the hypocotyl and that this stimulus is transmitted to the SAM by a so 278 far unidentified mobile signal. Amazingly, the SAM does not possess the competence 279 to perceive and/or translate the light stimulus into stem cell activation, but rather is 280 limited to responding to the signals that are transmitted from distant plant organs. 281 Mechanisms of hormonal stem cell activation 10 282 Since we had shown that light is perceived at a distance from the SAM, which also 283 for energy rich metabolites is not a source, but a sink tissue, we next asked how the 284 information for both environmental inputs is relayed to the stem cell system. Obvious 285 candidates for inter-regional signaling components are plant hormones and there are 286 a number of studies demonstrating their importance in regulating the shoot stem cell 287 niche, especially for cytokinin (CK) and auxin (reviewed in Murray et al. 2012). A 288 previous study had analyzed the environmental influence on organ initiation at the 289 SAM using transfer of light grown tomato plants to darkness as a model and found 290 that light is required for CK signaling and polarized membrane localization of the 291 auxin export carrier PIN1 (Yoshida, Mandel & Kuhlemeier, 2011). However, these 292 studies could not distinguish whether light was perceived as informational cue or 293 energy source. We therefore analyzed CK signaling activity using the pTCSn:GUS 294 cytokinin output sensor (Zürcher et al., 2013) as well as auxin flux directionality using 295 polarization of pPIN1:PIN1-GFP (Benková et al., 2003) as a proxy (Figure 3 A-K). In 296 line with the findings of Yoshida et al., CK signaling was strongly activated by light 297 when compared to etiolated seedlings (compare Figure 3H to G). Furthermore, we 298 also found that PIN1 polarly localized to the plasma membrane in a light dependent 299 manner (Figure 3A and B). Interestingly, sucrose treatment of etiolated seedlings did 300 not affect the localization of PIN1 (Figure 3C) but lead to a mild activation of the TCS 301 reporter also in the absence of light (Figure 3I), suggesting that there is specificity in 302 the hormonal response. 303 To test the light signaling response independently from impeding effects of 304 photosynthesis, we treated plants grown in light with the photosynthesis inhibitor 305 norflurazon. While PIN1 localization was still light responsive, no activity of the TCS 306 reporter was detectable under these conditions (Figure 3D, J). We also observed a 307 reduction of TCS signal when plants were grown in a CO2-deficient environment 308 (Figure 3 – figure supplement 1C). Since in both cases TCS reporter activity could be 309 restored by sucrose supplementation (Figure 3K and Figure 3 – figure supplement 310 1D), we concluded that CK signaling output is dependent on the availability of energy 311 metabolites. However, light signaling and photosynthesis together had a much 312 stronger effect on CK output than nutrient availability alone, suggesting that both 313 signals synergize to stimulate CK signaling at the SAM. In contrast, PIN1 localization 314 to the plasma membrane was fully dependent on light perception and could not even 315 be restored by the cop1 mutation (Figure 3E, F). 316 If CK signaling indeed integrates energy status and light perception, it may be 317 sufficient to activate SAM development. In line with this idea, the importance of CK in 11 318 light dependent SAM activation had already been demonstrated (Chory et al., 1994; 319 Skylar et al., 2010) and Yoshida et al. had shown that the application of CK to tomato 320 apices can induce organogenesis in the dark (Yoshida, Mandel & Kuhlemeier, 2011). 321 Consistently, etiolated Arabidopsis seedlings treated with CK produced leaf like 322 structures even in darkness (Figure 3L and Chory et al. 1994). However, this 323 developmental transition was strictly dependent on the presence of an external 324 energy source, similar to the behavior of cop1 mutants and in the absence of 325 sucrose, CK treated seedlings failed to develop leaves in the dark (Figure 3L). Thus, 326 our experiments were consistent with CK being an important component of, but not 327 the sole signal for environmental stem cell activation. 328 Since we had found WUS expression to be a much more sensitive readout for SAM 329 activation than organ development, we made use of our reporter system to dissect 330 the role of CK for overcoming stem cell dormancy. Using hormone treatment assays 331 we found that CK alone was sufficient to induce low levels of WUS expression even 332 in darkness in line with its known role in SAM regulation (Gordon et al., 2009; 333 Buechel et al., 2010). Interestingly, we observed the strongest stimulation of reporter 334 activity in plants on sucrose medium, whereas the light response was largely 335 unaffected by CK treatment (Figure 4A). These results suggested that application of 336 CK can at least partially replace the perception of light and thus supported a role for 337 CK as a mobile transducer for light signals upstream of WUS expression. However, 338 as demonstrated by our results using the TCS reporter, in the absence of energy 339 metabolites downstream CK signaling cannot be fully activated, resulting in a lack of 340 organ development. Having established an environment specific role for CK in the 341 initial steps leading up to stem cell activation, we wondered about the mechanism of 342 regulating endogenous hormone levels. We therefore mined the literature for light 343 responsive genes, expressed in the meristem and functionally related to CK 344 metabolism, perception, or signaling. Only CYTOKININ OXIDASE 5 (CKX5), which 345 codes for one of seven homologous cytokinin dehydrogenases involved in CK 346 catabolism in Arabidopsis met all criteria (Frebort et al., 2011). CKX5 is a direct 347 transcriptional target of several PHYTOCHROME INTERACTING FACTORs (PIFs) 348 and is highly expressed in etiolated seedlings as well as under shade conditions 349 (Hornitschek et al., 2012; Zhang et al., 2013; Pfeiffer et al., 2014). Similar to cop1 350 mutants, also pifq mutants form leaves in darkness when supplied with sugars 351 externally, therefore the PIFs are likely to play an important role in suppressing SAM 352 activation in darkness (Figure 4 – figure supplement 1A). CKX6, a close homologue 353 of CKX5, had already been described to limit primordia growth in response to shade 12 354 treatment (Carabelli et al., 2007) and both CKX5 and CKX6 had been shown to be 355 expressed around the shoot apex (Motyka et al., 2003; Bartrina et al., 2011). When 356 we tested the contribution of CKX5 and CKX6 to SAM activation by crossing the 357 single mutants to our reporter line, we found that loss of either did not promote WUS 358 activity in the dark as CK treatment. In contrast, the responses to sucrose and light 359 were robustly enhanced (Figure 4B), revealing that genetically removing etiolation 360 specific antagonists of CK accumulation is sufficient to replace one of the essential 361 environmental signals, but not both. Because CKX genes act partially redundantly 362 (Bartrina et al., 2011), we decided to remove CKX6 in the ckx5 mutant reporter 363 background by CRISPR/CAS9. Of 27 plants tested in T1, three were homozygous 364 ckx6 mutants, with either insertions or deletions at the 5´end of the CKX6 locus 365 leading to a shift in the reading frame (Figure 4 - figure supplement 1E). Seedlings of 366 all three independent ckx5/ckx6 mutant reporter lines were analyzed in the T2 367 generation and showed comparable effects on WUS expression (Figure 4B includes 368 data from one representative ckx5/ckx6 line, AP101.9). In contrast to either single 369 ckx mutant, ckx5/ckx6 double mutants showed basal WUS reporter activity in 370 darkness, similar to its behavior under CK treatment. Furthermore, we observed a 371 dramatic enhancement of the effect of sucrose on WUS activity and also light 372 dependent reporter induction was increased 2-fold over either single mutant, that 373 was also detectable by qRT-PCR (Figure 4 - figure supplement 1B). Based on these 374 results we concluded that CKX5 and CKX6 repress activation of the SAM by 375 degradation of the plant hormone CK in darkness. Interestingly, the levels of WUS 376 activation in the ckx5/ckx6 double mutant background were almost comparable to 377 those found in cop1 mutant plants (Figure 2B). However, in striking contrast to cop1, 378 the ckx5/ckx6 double mutant displayed a fully etiolated phenotype in darkness 379 (Figure 4 – figure supplement 1C and D), demonstrating that stem cell activation was 380 fully uncoupled from photomorphogenesis in these plants. Thus, CK can act as an 381 interregional transmitter of light signals specifically for WUS expression, but not for 382 general regulators of photomorphogenic growth, suggesting that the developmental 383 integration of light and metabolic signals might occur downstream of CK and locally 384 at the SAM. 385 Mechanisms of metabolic stem cell activation 386 In addition to light, seedling development and WUS expression both showed a strong 387 dependency on sucrose. Since sugars can not only act as energy source, but also as 388 signaling molecules, we first aimed to disentangle these functions for SAM activation. 13 389 To this end, plants were grown on plates supplemented with equimolar amounts (15 390 mM) of different sugars with diverse energy content for four days in darkness (Figure 391 5A). While mannitol, a non-metabolizable sugar, did not affect WUS activity, WUS 392 expression could be observed in etiolated seedlings in the presence of glucose and 393 sucrose, with sucrose being approximately twice as effective as glucose. Conversely, 394 palatinose, a non-metabolizable sugar structurally related to sucrose and able to 395 induce the sugar-dependent bud burst of roses in vitro (Rabot et al., 2012), was not 396 sufficient to induce WUS (Figure 5A). These findings strongly suggested that in the 397 context of stem cell activation, sugars do not act as signaling molecules directly, but 398 rather as energy source. In turn, the metabolic status of the plant seemed to be 399 sensed and translated into appropriate cell behavior by the SAM. 400 A key sensor of nutrient availability in plants is the TOR (TARGET OF RAPAMYCIN) 401 kinase and photosynthesis-mediated activation of the root meristem has recently 402 been described to be under the regulation of TOR (Xiong et al., 2013). Characteristic 403 expression changes that were described in response to glucose-TOR signaling 404 (Xiong et al., 2013) and E2Fa overexpression (Vandepoele et al., 2005; López-Juez 405 et al., 2008), namely affecting genes involved in ribosome biogenesis, protein 406 translation and cell proliferation have also been identified in microarray analyses of 407 shoot apex tissue derived from young seedlings (López-Juez et al., 2008). These 408 genes were rapidly and synchronously induced by photosynthetically active light 409 preceding organ growth, which lead us to hypothesize that stem cell activation in the 410 SAM might also be under control of the TOR kinase. 411 Since mutations in TOR are lethal, we used chemical interference to functionally test 412 its contribution to SAM activation. To efficiently inhibit TOR activity, we applied the 413 ATP-competitive TOR kinase inhibitor AZD-8055 (Montané & Menand, 2013) on 414 seedlings grown in liquid culture (Figure 5B-D). After an initial germination and 415 growth phase of three days in darkness, sugar, light and inhibitor treatments were 416 applied for another three days followed by microscopic analysis of the seedlings. In 417 line with our hypothesis that TOR is required for energy sensing in the SAM, AZD- 418 8055 inhibited the glucose-induced WUS expression in a dose dependent manner 419 (Figure 5B). Already 2-5 µM of AZD-8055 resulted in a considerable repression of 420 WUS promoter activity when compared to mock controls, and almost completely 421 suppressed the positive effect of glucose. 422 TOR acts as an integrator of light and metabolic signals for stem cell activation 14 423 Since TOR kinase has such a central function in the regulation of growth and 424 development, we wondered whether besides the well documented nutrient 425 availability pathway other stimuli, such as light signaling, might also depend on TOR 426 activity. Using the same experimental setup as described above for glucose we 427 indeed found that light-induced WUS expression was efficiently inhibited by AZD- 428 8055 (Figure 5C). This suggested that TOR kinase might play a specific role in light 429 signaling independent of energy production, since the plants were exposed to a 430 rather low light intensity of 30 µmol*m-2*s-1. To further test this, we analyzed TOR 431 dependency in the absence of photosynthesis and found that light dependent WUS 432 expression was repressed by the TOR inhibitor even under norflurazon treatment 433 (Figure 5 – figure supplement 1A). Consistently, even genetic activation of the light 434 signaling pathway through the cop1 mutation in the absence of a physiological 435 stimulus was sensitive to TOR inhibition by AZD-8055 (Figure 5D). 436 Since we could not exclude that our observations were caused by unspecific side 437 effects of the inhibitor AZD-8055, we wanted to monitor TOR activity in response to 438 sugars and light directly. Working under the hypothesis that TOR activity should 439 correlate with energy and light signals if the inhibitor results were meaningful, we 440 quantified the phosphorylation level of the direct TOR target S6K by a phospho- 441 specific antibody (Figure 5E and Figure 5 – figure supplement 1B). After transfer of 442 three-day-old etiolated seedlings to either light (60 µmol*m-2*s-1 of blue and red light 443 each) or 15 mM glucose for 24 h, we detected a substantial increase in 444 phosphorylation of S6K compared to seedlings that were kept in darkness (Figure 445 5E). Surprisingly, light treatment was even more efficient in activating TOR kinase 446 than supplying plants with external glucose. Consistently, cop1-4 mutant seedlings 447 displayed high S6K phosphorylation levels under all conditions, including the dark- 448 grown control. Also in this case we were able to detect a similar activation of the 449 TOR pathway in other cop1 alleles (Figure 5 - figure supplement 1C), supporting our 450 previous observation that the TOR pathway is repressed by the negative light 451 signaling component COP1 in darkness. Taken together, TOR kinase seems to play 452 a central and so far underestimated role not only for metabolic, but also for light 453 dependent activation of WUS and ultimately stem cells in the SAM. 454 Environment dependent metabolic reprogramming 455 After having shown that light and energy status converge to activate stem cells, we 456 wondered about the underlying metabolic changes in response to these 457 environmental cues. We were most interested to analyze metabolic re-programming 15 458 in response to light signaling because we hypothesized that TOR could be indirectly 459 activated following at least two scenarios: First, since in the wild light signaling and 460 photosynthesis usually go hand in hand, we were wondering whether signaling alone 461 would trigger a metabolic shift in expectation of photosynthesis derived energy 462 metabolites. And second, since COP1 regulates more than 20% of the Arabidopsis 463 genome (Ma et al., 2002), we speculated that this could also extend to the activity of 464 metabolic enzymes. In both cases the metabolic state of the seedlings, especially 465 with respect to glucose levels, could be affected by light signaling and this in turn 466 could indirectly trigger TOR. We therefore analyzed metabolites in seedlings that 467 were subjected to the same experimental workflow as for studying TOR activity 468 described above, namely wild-type and cop1-4 seedlings grown in darkness 469 compared to seedlings treated with either 15 mM glucose or light for 24 h before 470 harvest (Figure 5F-H; Figure 5 – figure supplement 1D-F; Supplementary File 1). A 471 Principal Component Analysis (PCA) plot clearly identified light signaling triggered by 472 the cop1 mutation (PC1) and energy availability caused by glucose supplementation 473 (PC2) as the two major components in our sample set, with light treated samples 474 being influenced by both components. Interestingly, glucose treatment only had a 475 mild effect on seedling metabolism. We detected slight increases of glucose, fructose 476 and sucrose as well as a clear increase of mannose levels in glucose treated 477 seedlings, while raffinose levels were reduced (Figure 5 F, H). The fact that under 478 these conditions TOR activity is markedly increased and WUS expression is robustly 479 detectable demonstrates that the energy sensing machinery must be exquisitely 480 sensitive to small changes in metabolite content, most likely glucose. To our surprise, 481 cop1 and light treated seedlings showed similar metabolic profiles that were clearly 482 different from the glucose treated samples. Since cop1 seedlings were grown in 483 darkness, the metabolic re-programming in cop1 and light treated seedlings is likely 484 caused by light signaling dependent transcriptional regulation of metabolic enzymes, 485 rather than simple photosynthesis dependent accumulation of sugars. We detected a 486 clear reduction of fructose and sucrose levels and a decrease in the cell wall 487 monosaccharides fucose, arabinose and galactose in both samples (Figure 5H). In 488 addition, ADP and ATP levels were slightly increased by light and cop1 mutation 489 (Figure 5G). Cop1 seedlings also displayed an accumulation of glyoxylate, an 490 intermediate of the glyoxylate cycle that allows plants to use lipids as carbon source 491 (Figure 5H). Another noteworthy exception from the similarity between cop1 and light 492 treated seedlings was glucose. Importantly, only the light- and glucose-treated 493 samples, but not cop1 seedlings showed an increase in glucose levels that might be 494 responsible for the observed activation of TOR kinase. However, since it is not 16 495 known how the TOR complex is activated in plants, we cannot exclude that the 496 obvious metabolic re-programming indirectly triggered TOR kinase activity in cop1 497 seedlings. Nevertheless, since cop1 seedlings showed an overall reduction of energy 498 rich metabolites, it seemed unlikely that the nutrient state was exclusively 499 responsible for activation of the TOR pathway in the cop1 background. 500 Interestingly, we saw a significant increase the levels of specific amino acids and 501 their derivatives especially in cop1 (Glu, Gln, His, Arg, ornithin, spermidine and 502 citrulline) that were all previously described to be reduced in amiR-tor seedlings 503 (Figure 5 - figure supplement 1F and Supplementary File 1). Conversely, time amino 504 acids whose levels were reported to be increased upon TOR repression (Thr, Tyr, 505 Val, Ile and Leu) were unchanged or reduced in cop1 (Caldana et al., 2013). The 506 inverse correlation of amino acid levels in cop1 and amiR-tor lines was not apparent 507 in the other samples, suggesting that the permanent de-regulation of the TOR 508 pathway during either cop1 or amiR-tor seedling development strongly affected the 509 metabolome while the short term nature of the glucose or light treatments was 510 insufficient for such a profound change. 511 17 512 Discussion 513 The life of a plant begins in many cases with skotomorphogenesis, which is 514 characterized by the elongation of the hypocotyl, formation of a hypocotyl hook, 515 unfolded cotyledons and the dormancy of the SAM. While most characteristics of 516 skotomorphogenesis can be revoked by the perception of light through the 517 photoreceptors alone, we showed that activation of the SAM in addition requires the 518 presence of energy metabolites. Thus, for stem cell activation, light not only acts as a 519 signal, but also needs to fuel the photosynthetic apparatus to produce sugars and 520 despite the dual role of a single environmental factor, both inputs are sensed 521 independently. Amazingly, it is not stem cell fate that is dependent on these signals, 522 but rather the expression of WUS, which defines the niche and at the same time acts 523 as a mobile stem cell activator. Thus, stem cell fate as defined by CLV3 promoter 524 activity can exist without WUS in a physiologically and developmentally relevant 525 setting, strongly suggesting that WUS is not the primary stimulating input for CLV3 526 expression. 527 For the sensing, transmission and integration of light and metabolic signals by the 528 stem cell system, evolution seems to have co-opted well studied regulators into a 529 novel and so far unsuspected regulatory network. On the one hand, the roles of the 530 phyB and cry photoreceptors for stem cell activation are fully in line with text book 531 photomorphogenesis, on the other hand phyA exhibits novel positive and negative 532 functions in far-red light regulation of WUS expression, which point to a re-wiring of 533 this core component of light signaling. Similarly, in light signal transduction, the 534 etiolation regulator COP1 plays a prominent part and cop1 mutations can substitute 535 for light in essentially all experiments, apart from PIN1 membrane localization. In 536 contrast, HY5, another core component of the photomorphogenesis network, does 537 not seem to have any apparent role in light dependent stem cell activation. This is 538 even more striking when taking into account the recently discovered role in shoot-to- 539 root signaling of HY5 (Chen et al., 2016), and our observation that the meristem 540 region itself does not possess the competence to perceive and process light signals. 541 However, we cannot exclude that the HY5 homolog HYH with partially overlapping 542 function but higher expression level in the shoot might mask the effect of hy5 on 543 WUS expression (Holm et al., 2002; Sibout et al., 2006). Since hy5/hyh mutants 544 showed deficiencies in development of the first leaves future experiments analyzing 545 such a double mutant in the context of our double reporter are required. 18 546 Interregional transmission of the light signal seems to depend on CK and with the 547 cytokinin dehydrogenases CKX5 and CKX6, we identified two potent regulators of 548 meristem activity that are highly responsive to environmental light conditions. Both 549 are direct targets of PIFs and have already been shown to accumulate in etiolated 550 seedlings (CKX5) and shade conditions (CKX6), respectively (Carabelli et al., 2007; 551 Pfeiffer et al., 2014), which ultimately leads to an inactivation of cytokinin under 552 unfavorable light conditions. Under open sun light PIFs are degraded, thus liberating 553 cytokinin from CKX mediated degradation, which in turn results in the activation of 554 stem cells. CKX5 is expressed in the rib zone below the stem cell niche and CKX6 555 additionally in the vasculature (Motyka et al., 2003; Bartrina et al., 2011), which might 556 explain the surprisingly high efficiency of our pSUC2:PHYB Y276H line in activating 557 WUS expression (Figure 2 – figure supplement 1G). We did not specifically activate 558 light signaling in the rib zone below the stem cell niche in our experiments and thus 559 the possibility remains that light perception in the immediate vicinity to the meristem 560 affects stem cell activity by short range CK signaling. 561 In parallel to light signals, WUS expression was strongly responsive to energy 562 availability. The effect of sucrose on cop1 and ckx5/ckx6 double mutants was much 563 stronger than the cumulative effect of light and sucrose treatments (Figure 2B and 564 4B). Also the activity of the CK output reporter pTCSn:GUS strictly depended on 565 sucrose, but could be further stimulated by light, suggesting that CK signaling mainly 566 acts to transmit light signals, but that elevation of CK levels genetically or by 567 treatment are insufficient to elicit the full developmental response. Based on these 568 results we suggest that light enhances CK levels by reducing the expression of CKX 569 genes, however we cannot rule out other explanations, such as stimulation of CK 570 biosynthesis. 571 Interestingly, the WUS paralog WOX9/STIMPY (STIP) also plays an important role in 572 light, sugar and CK crosstalk at the shoot apex. Meristems of weaker stip mutants 573 arrest at seedling stage but can be rescued by addition of sucrose to the medium 574 (Wu, Dabi & Weigel, 2005). STIP was further shown to integrate CK signals at the 575 meristem and STIP over-expression can partially overcome the deficits of CK 576 perception mutants (Skylar et al., 2010). In contrast to WUS, however, sugar acts 577 downstream of STIMPY, and it would be interesting to investigate whether the same 578 is true for light signals. 579 Our experiments suggested that light and metabolic signals converge downstream of 580 CK and locally at the SAM and consistently, we identified the TOR kinase to be an 19 581 integrator of both signaling pathways. Earlier reports had shown that glucose-TOR 582 signaling regulates photosynthesis-driven activation of the root meristem (Xiong et 583 al., 2013) and we demonstrated here that also shoot stem cell activation by 584 metabolizable sugars is dependent on TOR kinase. Intriguingly, TOR activity was not 585 only required for the response to energy availability, but also for WUS stimulation by 586 light signs. This activity was independent of photosynthesis, because the TOR 587 pathway was also activated under norflurazon treatment, in the absence of CO2 or 588 the suppression of COP1 function. The direct regulation of TOR kinase by light 589 signaling elegantly explains the recently discovered impact of phytochromes on the 590 metabolic state of the plant (Yang et al., 2016), but also represents another striking 591 example of a so far undiscovered re-wiring of a core regulatory component within the 592 stem cell network. Consistently, upstream regulators of TOR kinase found in other 593 organisms are not well conserved in plants (Dobrenel et al., 2016) and thus evolution 594 seems to have found alternative mechanisms to activate the TOR pathway in a 595 highly context dependent manner. Coupling light and energy sensing via TOR could 596 help 597 skotomorphogenesis to photomorphogenesis, which involves transcriptional re- 598 programming of almost a quarter of the genome (López-Juez et al., 2008). Light 599 dependent activation of TOR kinase could allow etiolated seedlings to build up the 600 photosynthetic apparatus, initiate ribosome biogenesis and prime stem cells via the 601 expression of WUS to efficiently shift gear towards organogenic growth and 602 development, once energy becomes available. plants to prepare for the dramatic developmental transition from 603 604 Material and Methods 605 Cloning 606 Double reporter: The pCLV3:mCHERRY (pMD149) construct was obtained by LR 607 reactions of the pDONR221-mCHERRY-NLS plasmid (pFK143) with pFK317, a 608 pGreen-IIS (Hellens et al., 2000; Mathieu et al., 2007) based binary vector with CLV3 609 1.4 kb promoter and 1.2 kb terminator sequences and kanamycin resistance 610 cassette. The pWUS:3xVENUS-NLS construct (pTS81) was generated accordingly, 611 using a pGREEN-IIS based binary vector with a 4.4 kb genomic WUS promoter 612 upstream of the ATG and 2.8 kb WUS terminator downstream of the stop codon 613 (pFK398) and a Basta resistance cassette. In both constructs the N7 NLS (Daum et 614 al., 2014) was used. 20 615 To 616 GCATGGTTCTTTTCCTGAGG and GAAGCTGCAGGTCTACAGTG targeting the 617 CKX6 locus were inserted in the plasmid pHEE401E as described by the authors 618 (Wang et al., 2015) to generate pAP101. 619 All other constructs are based on the GreenGate cloning system (Lampropoulos et 620 al., 2013). Details about the cloning of the modules and assembled plasmids for plant 621 transformation can be found in Supplementary File 2. 622 Plant material 623 All used plant lines were in the Col-0 background. Arabidopsis Col-0 was 624 transformed by floral dip (Clough & Bent, 1998) using the A. tumefaciens strain ASE 625 (pSOUP+) carrying the pGREEN-IIS and GreenGate based plasmids. The 626 Agrobacteria strain GV3101 was used for the transformation of plants with the 627 plasmid pAP101. 628 To select for the presence of the corresponding resistance markers, plants were 629 grown on plates supplemented with 5 mM D-Ala, 20 µg/µl Hygromycin B or 50 µg/ml 630 Kanamycin or grown on soil and sprayed with the herbicides Inspire (Syngenta Agro 631 AG, Dielsdorf, Switzerland) (7.6 µl/l) (Rausenberger et al., 2011) or Basta (0.02%) 1 632 week after germination. 633 The plasmids pMD149 and pTS81 were used to generate the reporter lines 634 pCLV3:mCHERRY-NLS and pWUS:3xVENUS-NLS, respectively. The double 635 reporter line is comprised of a cross of both lines. The WUS-GFP rescue line 636 (pWUS:WUS-linker-GFP in wus mutant background (Daum et al., 2014)) was also 637 crossed to the pCLV3:mCHERRY-NLS line. Both crossed lines were homozygous for 638 all loci. 639 The mutant cop1-4 (McNellis et al., 1994) was crossed to pPIN1:PIN1-GFP 640 (Benková et al., 2003) and the double reporter line was crossed to the mutants cop1- 641 4 (McNellis et al., 1994), phyA-211 (Reed et al., 1994), phyB-9 (Reed et al., 1993), 642 cry1-304/cry2-1 643 (SALK_064309) and ckx6-2 (SALK_070071) (Bartrina et al., 2011). All of these 644 crossed lines used in the manuscript were homozygous mutants and screened to be 645 also homozygous for carrying the pWUS:3xVENUS-NLS construct. Additional cop1 646 alleles, cop1-6 (McNellis et al., 1994) and cop1-19 (Favory et al., 2009), were used 647 for qRT-PCR and the TOR activity assay. 21 produce ckx6 mutants (Mockler et by al., CRISPR-CAS9 2003), hy5 the two (SALK_096651C), gRNAs ckx5-1 648 A homozygous double reporter/ckx5 line was transformed with the CRISPR/CAS9 649 plasmid pAP101 to create a ckx5/ckx6 double mutant in the double reporter 650 background. Genomic DNA of T1 plants was PCR-amplified using the oligos A05465 651 (ATCAAAAACCCTTTTCCATCCT) and A05466 (AGCCAACTTAAAGGCTATGCAG) 652 and the PCR product was digested with Eco81I to screen for homozygous ckx6 653 mutants at the locus of the first gRNA. The genomic region of T1 plants that 654 produced undigested PCR fragments was amplified with the oligos A05465 and 655 A05468 (ACTTGAGGGTCTCATGCAAAAT), and sequenced after subcloning the 656 PCR product into pGEM-T Easy (Promega, Madison, WI)) to confirm the mutation of 657 the CKX6 locus. T2 plants of homozygous T1 mutants were used in this manuscript. 658 659 Growth conditions 660 Seeds were sterilized with 70% ethanol and 0.1% Triton for 10 min and afterwards 661 washed twice with autoclaved water. All seeds were imbibed in water for 3 days at 662 4°C in darkness before plating 30-40 seeds on 0.5x MS (Duchefa, Haarlem, The 663 Netherlands), 0.8% Phytoagar in vented petri dishes that were sealed with micropore 664 tape (3M, Two Harbors, MN). Germination was induced by 150 µmol*m-2*s-1 of white 665 light for 6 h. Afterwards plants were either kept in white light, transferred to darkness 666 or to LED cabinets equipped with red (673 nm), far-red (745 nm) and blue (471 nm) 667 LEDs (floralLEDs StarterKit 2, CLF Plant Climatics, Wertingen, Germany). Unless 668 otherwise noted, constant red, far-red or blue light was applied with an intensity of 30 669 µmol*m-2*s-1. All white light treatments were carried out at 150 µmol*m-2*s-1 of 670 fluorescent white light with a 16-h-light/8-h-dark cycle. Starting with the light induction 671 of germination, plants were kept at 21-22°C. 0.5x MS plates were supplemented with 672 1% (30 mM) sucrose or 15 mM glucose only if mentioned explicitly. Growth in a CO2- 673 deficient environment was accomplished by growing unsealed vented petri dishes in 674 a sealed plastic bag with 5 g NaOH and 5 g CaO (Kircher & Schopfer, 2012). 675 4 day old seedlings that were harvested for protein extracts and metabolite 676 measurements were grown vertically on top of 100 µm nylon meshes (nitex 03/100- 677 44, Sefar, Heiden, Switzerland). For the glucose treatment in these experiments 678 seedlings were transferred with the mesh to plates containing 15 mM glucose. Light 679 treatments entailed irradiation with 60 µmol*m-2*s-1 of blue and red light each. Both 680 treatments were started 24 h before and continued until the harvest of the material. 681 To exclude ungerminated seeds and empty seed shells form the metabolite 22 682 measurements, only above root tissue was harvested. All seedlings were rinsed with 683 distilled water prior to harvest. 684 Liquid culture 685 About 30-40 seeds, that were imbibed as described above, were sown in 3 ml 0.5x 686 MS in petri dishes of 35 mm diameter. Plants were kept in darkness for 3 days after 687 the induction of germination by 6 h light treatment. The medium of 3 day old etiolated 688 seedlings was supplemented with 15 mM glucose and/or 0.5-2 µM AZD-8055 (Santa 689 Cruz Biotechnology, Dallas, TX). Stock solutions of 1000x concentrated AZD-8055 690 were diluted in DMSO, therefore control plants were mock treated with the same 691 volume of DMSO. 692 693 In situ hybridization 694 A detailed protocol of the in situ hybridization procedure was provided previously 695 (Medzihradszky, Schneitz & Lohmann, 2014). 696 RNA extraction and qRT-PCR 697 Total RNA was extracted from 100 mg 7 day old Arabidopsis seedlings with the Plant 698 RNA Purification Reagent (Invitrogen, Carlsbad, CA) according to the instructions of 699 the manufacturer, digested with TURBO DNAse (Ambion/ Thermo Fisher, Waltham, 700 MA) and purified with RNeasy Mini Kit (Quiagen, Hilden, Germany). Equal amounts 701 of RNA were used for oligo dT primed cDNA synthesis with the RevertAid First 702 Strand cDNA Synthesis Kit (Thermo Fisher, Waltham, MA). The qPCR reaction was 703 set up using the SG qPCR Master Mix (EURx, Gdansk, Poland) and run on a 704 Chromo4 Real-Time PCR System (Bio-Rad, Hercules, CA) with technical duplicates 705 each. The relative expression levels were calculated using the ddCt method with 706 PP2A expression as a reference. Results shown are the means of 2 independent 707 biological replicates. The following oligos were used: PP2A: A01067: TAA CGT GGC 708 CAA AAT GAT GC and A01068: GTT CTC CAC AAC CGC TTG GT; WUS: A00317: 709 TTA TGA TGG CGG CTA ACG AT and A00318: TTC AGT ACC TGA GCT 710 TGC ATG; PHYB total: A05986: AGC AAA TGG CTG ATG GAT TC and A05987: 711 GCT TGT CCA CCT GCT GCT AT; PHYB 3'UTR: A05984: GCG ACC ATT GTC 712 AAC TGC TA and A05985: CTC CGA CGT CGT TAG ACA CA. 713 Histochemical GUS staining 23 714 4 day old seedlings were harvested in 90% acetone and incubated at -20 °C for at 715 least 1h. Seedlings were washed with PBS and incubated in substrate buffer (1x 716 PBS (pH 7.0), 1 mM K3Fe(III)(CN)6, 0.5 mM K4Fe(II)(CN)6, 1 mM EDTA, 1% Triton X- 717 100, 1 mg/ml X-gluc) at 22°C over night. After staining, the seedlings were incubated 718 with 60% and 95% ethanol to remove chlorophyll. 719 Microscopy and fluorescence quantification 720 To image the fluorescent reporter activities in the SAM, seedlings were split in half by 721 pulling one cotyledon away from the SAM with forceps. The exposed meristem was 722 imaged with a Zeiss Imager M1, the Plan-APOCHROMAT 20x/0.8 objective (Zeiss, 723 Oberkochen, Germany) and YFP- and mCHERRY-specific filter sets. For the 724 quantification of VENUS and mCHERRY signal intensities the settings for the 725 intensity of the fluorescent lamp and exposure times were unchanged for each 726 channel. 16-bit B/W pictures of at least 20 SAMs per sample were analyzed by FIJI 727 (Schindelin et al., 2012), using the background subtraction (100 pixel rolling ball 728 radius) prior to measuring the mean gray value of a circular area surrounding the 729 SAM with a diameter of 51 µm (100 pixels) for WUS and 41 µm (80 pixles) diameter 730 for CLV3. Quantifications in each figure were normalized to the median of the 731 fluorescence levels of wild-type plants grown in red light for 4 days. Only exception: 732 in Figure 5A and B we used the glucose treated plants as a reference and in Figure 733 5D the cop1 mutant plants (second box in each box plot). For all these experiments 734 plants of one experimental set were always grown and analyzed in parallel to the 735 untreated (dark-grown) and the corresponding reference sample. 736 In situ sections were analyzed with the same microscope and a 40x/0.95 Plan- 737 APOCHROMAT objective (Zeiss, Oberkochen, Germany). Equipment and settings 738 used for confocal microscopy was described earlier (Daum et al., 2014). 739 TOR activity assay 740 Proteins were extracted from 50 mg materials in 250 µl 2x Laemmli buffer (0.25 mM 741 Tris-HCL pH 6.8, 8% SDS, 5% ß-mercaptoethanol, 20% glycerol) supplemented with 742 1.5% phosphatase inhibitor cocktail 2 (Sigma-Aldrich, St. Louis, MO). After adding 743 extraction buffer, samples were briefly mixed and heated at 95 °C for 10 min. Cellular 744 debris was removed by two centrifugation steps (10 min, 14000 rpm, 4°C). 20 µg 745 protein were separated on a 10% SDS gel and transferred to PVDF membrane. 746 Phospho-p70 S6 kinase (Thr(P)-389) polyclonal antibody (No.9205, Cell Signaling 24 747 Technology, Cambridge, UK) was used to detect S6K phosphorylation. S6K1/2 748 antibody (AS12-1855, Agrisera AB, Vännäs, Sweden) was used to detect total S6K1 749 and S6K2. 750 Metabolite measurements 751 3 biological replicates were harvested for and analyzed as described (Poschet et al., 752 2011) by the Metabolomics Core Technology Platform at the University of 753 Heidelberg. PCA was performed with statistical language R (version 3.3.1). For the 754 analysis all metabolite data except the amino acid measurements were used. 755 Acknowledgments 756 We thank Cornelia Klose and Roman Ulm for sharing photoreceptor and light 757 signaling mutants, Andreas Hiltbrunner for the plasmid for mPPO and Inspire, Qi-Jun 758 Chen for providing the CRISPR-CAS9 plasmids and the Metabolomics Core 759 Technology Platform at the University of Heidelberg. This work was supported by the 760 ERC grant (#282139) “StemCellAdapt” to JL and the German research foundation 761 (DFG) grants SFB873 to JL and grants HE 1848/15-1, WI 3560/1-1 and SFB 1036 to 762 RH and MW. AP is indebted to the Baden-Württemberg Stiftung for the financial 763 support of this research project by the Eliteprogramme for Postdocs. 25 764 References 765 766 767 Ahn, C.S., Han, J.-A., Lee, H.-S., Lee, S. & Pai, H.-S. 2011. The PP2A regulatory subunit Tap46, a component of the TOR signaling pathway, modulates growth and metabolism in plants. The Plant cell. 23(1):185–209. DOI: 10.1105/tpc.110.074005. 768 769 770 Ahn, C.S., Ahn, H. & Pai, H. 2014. Overexpression of the PP2A regulatory subunit Tap46 leads to enhanced plant growth through stimulation of the TOR signalling pathway. 1:1–14. DOI: 10.1093/jxb/eru438. 771 772 773 Bartrina, I., Otto, E., Strnad, M., Werner, T. & Schmülling, T. 2011. Cytokinin regulates the activity of reproductive meristems, flower organ size, ovule formation, and thus seed yield in Arabidopsis thaliana. The Plant cell. 23(1):69–80. DOI: 10.1105/tpc.110.079079. 774 775 776 Benková, E., Michniewicz, M., Sauer, M., Teichmann, T., Seifertová, D., Jürgens, G. & Friml, J. 2003. Local, Efflux-Dependent Auxin Gradients as a Common Module for Plant Organ Formation. Cell. 115(5):591–602. DOI: 10.1016/S0092-8674(03)00924-3. 777 778 779 Buechel, S., Leibfried, A., To, J.P.C., Zhao, Z., Andersen, S.U., Kieber, J.J. & Lohmann, J.U. 2010. Role of A-type ARABIDOPSIS RESPONSE REGULATORS in meristem maintenance and regeneration. European journal of cell biology. 89(2-3):279–84. DOI: 10.1016/j.ejcb.2009.11.016. 780 781 782 Caldana, C., Li, Y., Leisse, A., Zhang, Y., Bartholomaeus, L., Fernie, A.R., Willmitzer, L. & Giavalisco, P. 2013. Systemic analysis of inducible target of rapamycin mutants reveal a general metabolic switch controlling growth in Arabidopsis thaliana. The Plant Journal. 73(6):897–909. DOI: 10.1111/tpj.12080. 783 784 785 Carabelli, M., Possenti, M., Sessa, G., Ciolfi, A., Sassi, M., Morelli, G. & Ruberti, I. 2007. Canopy shade causes a rapid and transient arrest in leaf development through auxin-induced cytokinin oxidase activity. Genes & development. 21(15):1863–8. DOI: 10.1101/gad.432607. 786 787 788 Chen, X., Yao, Q., Gao, X., Jiang, C., Harberd, N.P. & Fu, X. 2016. Shoot-to-Root Mobile Transcription Factor HY5 Coordinates Plant Carbon and Nitrogen Acquisition. Current Biology. 26(5):640–646. DOI: 10.1016/j.cub.2015.12.066. 789 790 Chory, J. 2010. Light signal transduction: an infinite spectrum of possibilities. The Plant Journal. 61(6):982–991. DOI: 10.1111/j.1365-313X.2009.04105.x. 791 792 793 Chory, J., Reinecke, D., Sim, S., Washburn, T. & Brenner, M. 1994. A Role for Cytokinins in DeEtiolation in Arabidopsis (det Mutants Have an Altered Response to Cytokinins). Plant physiology. 104(2):339–347. DOI: 10.1104/pp.104.2.339. 794 795 796 Clough, S.J. & Bent, A.F. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant journal : for cell and molecular biology. 16(6):735–43. Available: http://www.ncbi.nlm.nih.gov/pubmed/10069079. 797 798 799 Daum, G., Medzihradszky, A., Suzaki, T. & Lohmann, J.U. 2014. A mechanistic framework for noncell autonomous stem cell induction in Arabidopsis. Proceedings of the National Academy of Sciences. 111(40):14619–14624. DOI: 10.1073/pnas.1406446111. 800 801 Deng, X. & Quail, P.H. 1991. Genetic and phenotypic characterization of cop 1 mutants of Arabidopsis thaliana. 2(1 992):83–95. 802 803 Díaz-Troya, S., Pérez-Pérez, M.E., Florencio, F.J. & Crespo, J.L. 2008. The role of TOR in autophagy regulation from yeast to plants and mammals. Autophagy. 4(7):851–65. DOI: 10.4161/auto.6555. 804 805 806 Dobrenel, T., Marchive, C., Azzopardi, M., Clément, G., Moreau, M., Sormani, R., Robaglia, C. & Meyer, C. 2013. Sugar metabolism and the plant target of rapamycin kinase: a sweet operaTOR? Frontiers in plant science. 4(April):93. DOI: 10.3389/fpls.2013.00093. 807 808 809 Dobrenel, T., Caldana, C., Hanson, J., Robaglia, C., Vincentz, M., Veit, B. & Meyer, C. 2016. TOR Signaling and Nutrient Sensing. Annual Review of Plant Biology. 67(1):annurev–arplant–043014– 114648. DOI: 10.1146/annurev-arplant-043014-114648. 810 811 812 Favory, J.-J., Stec, A., Gruber, H., Rizzini, L., Oravecz, A., Funk, M., Albert, A., Cloix, C., et al. 2009. Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis. The EMBO journal. 28(5):591–601. DOI: 10.1038/emboj.2009.4. 26 813 814 815 Frebort, I., Kowalska, M., Hluska, T., Frebortova, J. & Galuszka, P. 2011. Evolution of cytokinin biosynthesis and degradation. Journal of Experimental Botany. 62(8):2431–2452. DOI: 10.1093/jxb/err004. 816 817 818 819 Gordon, S.P., Chickarmane, V.S., Ohno, C. & Meyerowitz, E.M. 2009. Multiple feedback loops through cytokinin signaling control stem cell number within the Arabidopsis shoot meristem. Proceedings of the National Academy of Sciences of the United States of America. 106(38):16529–34. DOI: 10.1073/pnas.0908122106. 820 821 822 Hellens, R.P., Anne Edwards, E., Leyland, N.R., Bean, S. & Mullineaux, P.M. 2000. pGreen: A versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Molecular Biology. 42(6):819–832. DOI: 10.1023/A:1006496308160. 823 824 825 Henriques, R., Magyar, Z., Monardes, A., Khan, S., Zalejski, C., Orellana, J., Szabados, L., de la Torre, C., et al. 2010. Arabidopsis S6 kinase mutants display chromosome instability and altered RBR1-E2F pathway activity. The EMBO journal. 29(17):2979–93. DOI: 10.1038/emboj.2010.164. 826 827 828 Henriques, R., Bögre, L., Horváth, B. & Magyar, Z. 2014. Balancing act: matching growth with environment by the TOR signalling pathway. Journal of experimental botany. 65(10):2691–2701. DOI: 10.1093/jxb/eru049. 829 830 831 Holm, M., Ma, L.G., Qu, L.J. & Deng, X.W. 2002. Two interacting bZIP proteins are direct targets of COP1-mediated control of light-dependent gene expression in Arabidopsis. Genes and Development. 16(10):1247–1259. DOI: 10.1101/gad.969702. 832 833 834 835 Hornitschek, P., Kohnen, M. V, Lorrain, S., Rougemont, J., Ljung, K., López-Vidriero, I., Franco-Zorrilla, J.M., Solano, R., et al. 2012. Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling. The Plant journal : for cell and molecular biology. 1:699–711. DOI: 10.1111/j.1365-313X.2012.05033.x. 836 837 838 839 Kircher, S. & Schopfer, P. 2012. Photosynthetic sucrose acts as cotyledon-derived long-distance signal to control root growth during early seedling development in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America. 109(28):11217–21. DOI: 10.1073/pnas.1203746109. 840 841 842 Lampropoulos, A., Sutikovic, Z., Wenzl, C., Maegele, I., Lohmann, J.U. & Forner, J. 2013. GreenGate--a novel, versatile, and efficient cloning system for plant transgenesis. PloS one. 8(12):e83043. DOI: 10.1371/journal.pone.0083043. 843 844 Lastdrager, J., Hanson, J. & Smeekens, S. 2014. Sugar signals and the control of plant growth and development. Journal of experimental botany. 65(3):799–807. DOI: 10.1093/jxb/ert474. 845 846 Leivar, P. & Quail, P.H. 2010. PIFs: pivotal components in a cellular signaling hub. Trends in plant science. (September). DOI: 10.1016/j.tplants.2010.08.003. 847 848 849 850 Leivar, P., Tepperman, J.M., Monte, E., Calderon, R.H., Liu, T.L. & Quail, P.H. 2009. Definition of early transcriptional circuitry involved in light-induced reversal of PIF-imposed repression of photomorphogenesis in young Arabidopsis seedlings. The Plant cell. 21(11):3535–53. DOI: 10.1105/tpc.109.070672. 851 852 853 López-Juez, E., Dillon, E., Magyar, Z., Khan, S., Hazeldine, S., de Jager, S.M., Murray, J. a H., Beemster, G.T.S., et al. 2008. Distinct light-initiated gene expression and cell cycle programs in the shoot apex and cotyledons of Arabidopsis. The Plant cell. 20(4):947–68. DOI: 10.1105/tpc.107.057075. 854 855 856 Ma, L., Gao, Y., Qu, L., Chen, Z., Li, J., Zhao, H. & Deng, X.W. 2002. Genomic evidence for COP1 as a repressor of light-regulated gene expression and development in Arabidopsis. The Plant cell. 14(10):2383–98. DOI: 10.1105/tpc.004416. 857 858 859 Mahfouz, M.M., Kim, S., Delauney, A.J. & Verma, D.P.S. 2006. Arabidopsis TARGET OF RAPAMYCIN interacts with RAPTOR, which regulates the activity of S6 kinase in response to osmotic stress signals. The Plant cell. 18(2):477–490. DOI: 10.1105/tpc.105.035931. 860 861 862 Mathieu, J., Warthmann, N., Küttner, F. & Schmid, M. 2007. Export of FT Protein from Phloem Companion Cells Is Sufficient for Floral Induction in Arabidopsis. Current Biology. 17(12):1055–1060. DOI: 10.1016/j.cub.2007.05.009. 863 McNellis, T.W., von Arnim, a G., Araki, T., Komeda, Y., Miséra, S. & Deng, X.W. 1994. Genetic and 27 864 865 molecular analysis of an allelic series of cop1 mutants suggests functional roles for the multiple protein domains. The Plant cell. 6(4):487–500. DOI: 10.1105/tpc.6.4.487. 866 867 868 Medzihradszky, A., Schneitz, K. & Lohmann, J.U. 2014. Detection of mRNA expression patterns by nonradioactive in situ hybridization on histological sections of floral tissue. Methods in Molecular Biology. 1110:275–293. DOI: 10.1007/978-1-4614-9408-9-14. 869 870 871 872 Menand, B., Desnos, T., Nussaume, L., Berger, F., Bouchez, D., Meyer, C. & Robaglia, C. 2002. Expression and disruption of the Arabidopsis TOR (target of rapamycin) gene. Proceedings of the National Academy of Sciences of the United States of America. 99(9):6422–6427. DOI: 10.1073/pnas.092141899. 873 874 875 Mockler, T., Yang, H., Yu, X., Parikh, D., Cheng, Y., Dolan, S. & Lin, C. 2003. Regulation of photoperiodic flowering by Arabidopsis photoreceptors. Proceedings of the National Academy of Sciences of the United States of America. 100(4):2140–2145. DOI: 10.1073/pnas.0437826100. 876 877 878 Montané, M.-H. & Menand, B. 2013. ATP-competitive mTOR kinase inhibitors delay plant growth by triggering early differentiation of meristematic cells but no developmental patterning change. Journal of experimental botany. 64(14):4361–74. DOI: 10.1093/jxb/ert242. 879 880 881 882 Moreau, M., Azzopardi, M., Clément, G., Dobrenel, T., Marchive, C., Renne, C., Martin-Magniette, M.-L., Taconnat, L., et al. 2012. Mutations in the Arabidopsis homolog of LST8/GβL, a partner of the target of Rapamycin kinase, impair plant growth, flowering, and metabolic adaptation to long days. The Plant cell. 24(2):463–81. DOI: 10.1105/tpc.111.091306. 883 884 885 Motyka, V., Laucou, V., Smets, R. & Onckelen, H. Van. 2003. Cytokinin-Deficient Transgenic Arabidopsis Plants Show Functions of Cytokinins in the Regulation of Shoot and Root Meristem Activity. 15(November):2532–2550. DOI: 10.1105/tpc.014928. 886 887 888 Murray, J. a H., Jones, A., Godin, C. & Traas, J. 2012. Systems Analysis of Shoot Apical Meristem Growth and Development: Integrating Hormonal and Mechanical Signaling. The Plant cell. (October, 30):1–14. DOI: 10.1105/tpc.112.102194. 889 890 Nakagawa, M. & Komeda, Y. 2004. Flowering of Arabidopsis cop1 mutants in darkness. Plant and Cell Physiology. 45(4):398–406. DOI: 10.1093/pcp/pch047. 891 892 Nemhauser, J. & Chory, J. 2002. Photomorphogenesis. The Arabidopsis Book. 1:e0054. DOI: 10.1199/tab.0054. 893 894 895 Peschke, F. & Kretsch, T. 2011. Genome-wide analysis of light-dependent transcript accumulation patterns during early stages of Arabidopsis seedling deetiolation. Plant physiology. 155(3):1353–66. DOI: 10.1104/pp.110.166801. 896 897 898 Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y. & Quail, P.H. 2014. Combinatorial complexity in a transcriptionally centered signaling hub in Arabidopsis. Molecular plant. 7(11):1598–618. DOI: 10.1093/mp/ssu087. 899 900 Polyn, S., Willems, A. & De Veylder, L. 2015. Cell cycle entry, maintenance, and exit during plant development. Current Opinion in Plant Biology. 23:1–7. DOI: 10.1016/j.pbi.2014.09.012. 901 902 903 904 Poschet, G., Hannich, B., Raab, S., Jungkunz, I., Klemens, P.A.W., Krueger, S., Wic, S., Neuhaus, H.E., et al. 2011. A novel Arabidopsis vacuolar glucose exporter is involved in cellular sugar homeostasis and affects the composition of seed storage compounds. Plant physiology. 157(4):1664– 76. DOI: 10.1104/pp.111.186825. 905 906 907 Rabot, A., Henry, C., Ben Baaziz, K., Mortreau, E., Azri, W., Lothier, J., Hamama, L., Boummaza, R., et al. 2012. Insight into the role of sugars in bud burst under light in the rose. Plant & cell physiology. 53(6):1068–82. DOI: 10.1093/pcp/pcs051. 908 909 910 Ranjan, A., Fiene, G., Fackendahl, P. & Hoecker, U. 2011. The Arabidopsis repressor of light signaling SPA1 acts in the phloem to regulate seedling de-etiolation, leaf expansion and flowering time. Development. 138(9):1851–1862. DOI: 10.1242/dev.061036. 911 912 913 Rausenberger, J., Tscheuschler, A., Nordmeier, W., Wüst, F., Timmer, J., Schäfer, E., Fleck, C. & Hiltbrunner, A. 2011. Photoconversion and nuclear trafficking cycles determine phytochrome A’s response profile to far-red light. Cell. 146(5):813–25. DOI: 10.1016/j.cell.2011.07.023. 914 Reed, J.W., Nagpal, P., Poole, D.S., Furuya, M. & Chory, J. 1993. Mutations in the gene for the red/far- 28 915 916 red light receptor phytochrome B alter cell elongation and physiological responses throughout Arabidopsis development. The Plant cell. 5(2):147–57. DOI: 10.1105/tpc.5.2.147. 917 918 919 Reed, J.W., Nagatani, A., Elich, T.D., Fagan, M. & Chory, J. 1994. Phytochrome A and Phytochrome B Have Overlapping but Distinct Functions in Arabidopsis Development. Plant physiology. 104(4):1139– 1149. DOI: 10.1104/pp.104.4.1139. 920 921 922 Ren, M., Venglat, P., Qiu, S., Feng, L., Cao, Y., Wang, E., Xiang, D., Wang, J., et al. 2012. Target of rapamycin signaling regulates metabolism, growth, and life span in Arabidopsis. The Plant cell. 24(12):4850–74. DOI: 10.1105/tpc.112.107144. 923 924 925 Schepetilnikov, M., Kobayashi, K., Geldreich, A., Caranta, C., Robaglia, C., Keller, M. & Ryabova, L. a. 2011. Viral factor TAV recruits TOR/S6K1 signalling to activate reinitiation after long ORF translation. The EMBO journal. 30(7):1343–1356. DOI: 10.1038/emboj.2011.39. 926 927 928 Schepetilnikov, M., Dimitrova, M., Mancera-Martínez, E., Geldreich, A., Keller, M. & Ryabova, L. a. 2013. TOR and S6K1 promote translation reinitiation of uORF-containing mRNAs via phosphorylation of eIF3h. The EMBO journal. 32(8):1087–102. DOI: 10.1038/emboj.2013.61. 929 930 931 Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., et al. 2012. Fiji: an open-source platform for biological-image analysis. Nature methods. 9(7):676–82. DOI: 10.1038/nmeth.2019. 932 933 934 Schoof, H., Lenhard, M., Haecker, A., Mayer, K.F., Jürgens, G. & Laux, T. 2000. The stem cell population of Arabidopsis shoot meristems in maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell. 100(6):635–644. DOI: 10.1016/S0092-8674(00)80700-X. 935 936 937 Shin, Y.J., Kim, S., Du, H., Choi, S., Verma, D.P.S. & Cheon, C.I. 2012. Possible dual regulatory circuits involving AtS6K1 in the regulation of plant cell cycle and growth. Molecules and Cells. 33(5):487–496. DOI: 10.1007/s10059-012-2275-4. 938 939 940 Sibout, R., Sukumar, P., Hettiarachchi, C., Holm, M., Muday, G.K. & Hardtke, C.S. 2006. Opposite root growth phenotypes of hy5 versus hy5 hyh mutants correlate with increased constitutive auxin signaling. PLoS Genetics. 2(11):1898–1911. DOI: 10.1371/journal.pgen.0020202. 941 942 943 Skylar, A., Hong, F., Chory, J., Weigel, D. & Wu, X. 2010. STIMPY mediates cytokinin signaling during shoot meristem establishment in Arabidopsis seedlings. Development (Cambridge, England). 137(4):541–9. DOI: 10.1242/dev.041426. 944 945 946 Su, Y. -s. & Lagarias, J.C. 2007. Light-Independent Phytochrome Signaling Mediated by Dominant GAF Domain Tyrosine Mutants of Arabidopsis Phytochromes in Transgenic Plants. THE PLANT CELL ONLINE. 19(7):2124–2139. DOI: 10.1105/tpc.107.051516. 947 948 949 950 Tepperman, J.M., Hudson, M.E., Khanna, R., Zhu, T., Chang, S.H., Wang, X. & Quail, P.H. 2004. Expression profiling of phyB mutant demonstrates substantial contribution of other phytochromes to redlight-regulated gene expression during seedling de-etiolation. The Plant Journal. 38(5):725–739. DOI: 10.1111/j.1365-313X.2004.02084.x. 951 952 953 Vandepoele, K., Vlieghe, K., Florquin, K., Hennig, L., Beemster, G.T.S., Gruissem, W., Van de Peer, Y., Inzé, D., et al. 2005. Genome-wide identification of potential plant E2F target genes. Plant physiology. 139(1):316–328. DOI: 10.1104/pp.105.066290.316. 954 955 956 957 Wang, Z.-P., Xing, H.-L., Dong, L., Zhang, H.-Y., Han, C.-Y., Wang, X.-C. & Chen, Q.-J. 2015. Egg cellspecific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biology. 16(1):144. DOI: 10.1186/s13059-0150715-0. 958 959 960 Wei, N. 1994. Arabidopsis COP8, COP10, and COP11 Genes Are Involved in Repression of Photomorphogenic Development in Darkness. THE PLANT CELL ONLINE. 6(5):629–643. DOI: 10.1105/tpc.6.5.629. 961 962 963 Wu, X., Dabi, T. & Weigel, D. 2005. Requirement of homeobox gene STIMPY/WOX9 for Arabidopsis meristem growth and maintenance. Current biology : CB. 15(5):436–40. DOI: 10.1016/j.cub.2004.12.079. 964 965 Xiong, Y. & Sheen, J. 2014. The role of target of rapamycin signaling networks in plant growth and metabolism. Plant physiology. 164(2):499–512. DOI: 10.1104/pp.113.229948. 29 966 967 968 Xiong, Y., McCormack, M., Li, L., Hall, Q., Xiang, C. & Sheen, J. 2013. Glucose-TOR signalling reprograms the transcriptome and activates meristems. Nature. 496(7444):181–6. DOI: 10.1038/nature12030. 969 970 971 Yadav, R.K., Girke, T., Pasala, S., Xie, M. & Reddy, G.V. 2009. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. Proceedings of the National Academy of Sciences of the United States of America. 106(12):4941–6. DOI: 10.1073/pnas.0900843106. 972 973 Yang, D., Seaton, D.D., Krahmer, J. & Halliday, K.J. 2016. Photoreceptor effects on plant biomass , resource allocation , and metabolic state. Pnas. 1–6. DOI: 10.1073/pnas.1601309113. 974 975 Yi, C. & Deng, X.W. 2005. COP1 - from plant photomorphogenesis to mammalian tumorigenesis. Trends in cell biology. 15(11):618–25. DOI: 10.1016/j.tcb.2005.09.007. 976 977 Yoshida, S., Mandel, T. & Kuhlemeier, C. 2011. Stem cell activation by light guides plant organogenesis. Genes & development. 25(13):1439–50. DOI: 10.1101/gad.631211. 978 979 980 981 Zhang, Y., Mayba, O., Pfeiffer, A., Shi, H., Tepperman, J.M., Speed, T.P. & Quail, P.H. 2013. A quartet of PIF bHLH factors provides a transcriptionally centered signaling hub that regulates seedling morphogenesis through differential expression-patterning of shared target genes in Arabidopsis. PLoS genetics. 9(1):e1003244. DOI: 10.1371/journal.pgen.1003244. 982 983 984 Zürcher, E., Tavor-Deslex, D., Lituiev, D., Enkerli, K., Tarr, P.T. & Müller, B. 2013. A robust and sensitive synthetic sensor to monitor the transcriptional output of the cytokinin signaling network in planta. Plant physiology. 161(3):1066–75. DOI: 10.1104/pp.112.211763. 985 30 Figure Legends: 986 Figure 1 987 SAM development depends on light and sugar. (A-C) 5 week old plants grown on 988 media with (+) or without (-) sucrose. (A) Wild-type plants grown in darkness, (B) 989 cop1 mutant plants grown in darkness (B) and wild-type seedlings grown in light in 990 the presence of 0.5 µM photosynthesis inhibitor norflurazon (C). (D-I) Maximum 991 projections of SAMs of 4 day old seedlings; scale bar 20 µm. (D-F) 992 pCLV3:mCHERRY-NLS 993 pCLV3:mCHERRY-NLS 994 pWUS:3xVENUS-NLS 995 fluorescence intensity under different growth conditions (gray = darkness, red = red 996 light (30 µmol*m-2*s-1), solid box = w/o sucrose, hatched box = 1% sucrose, dag = 997 days after germination) 998 Figure 1 - figure supplement 1 999 (A-B) CLV3 expression in seedlings exposed to light and/or sucrose increases in 1000 size, but not intensity. Quantification of pCLV3:mCHERRY-NLS expression under 1001 different growth conditions (gray = darkness, red = red light (30 µmol*m-2*s-1), solid 1002 box = w/o sucrose, hatched box = 1% sucrose, dag = days after germination). (A) 1003 Quantification of the relative area in pictures of pCLV3:mCHERRY-NLS expressing 1004 meristems above a consistent gray value. (B) Quantification of the mean gray value 1005 within the area determined in (A). (C-D) WUS mRNA in situ hybridization on 1006 meristems of 6 day old wild-type seedlings grown in darkness and white light (150 1007 µmol*m-2*s-1), respectively (scale bar = 40 µm). 1008 31 together together (J) and with pWUS:3xVENUS-NLS. pWUS:WUS-linker-GFP. pCLV3:mCHERRY-NLS Quantification (K) expression (G-I) of by 1009 Figure 2 1010 Light induced WUS expression depends on photoreceptors and is repressed by 1011 COP1. Quantification of pWUS:3xVENUS-NLS expression by fluorescence intensity 1012 was measured in 4 day old seedlings with wild-type (WT) or mutant background 1013 under different growth conditions (gray = darkness, red = red light (30 µmol*m-2*s-1), 1014 blue = blue light (30 µmol*m-2*s-1), solid box = w/o sucrose, hatched box = 1% 1015 sucrose). (A) 0.5 mM lincomycin and 5 µM norflurazon, respectively were applied to 1016 the growth media of wild-type seedlings. (B) Impact of cop1-4 mutation on WUS 1017 expression. 1018 1019 Figure 2 - figure supplement 1 1020 Light regulation of WUS expression. (A) Induction of WUS expression in far-red light 1021 depends on phyA. (B) Growth in CO2-deficient environment does not affect light 1022 induced WUS expression in 4 day old seedlings, but inhibits the development of the 1023 first leaves unless 1% sucrose is added to the growth medium (C). Seedlings in (C) 1024 were grown in white light (150 µmol*m-2*s-1) and in absence of CO2 for 11 days. (D 1025 and E) Quantification of WUS expression by qRT-PCR in 7 day old seedlings grown 1026 in darkness (gray), 150 µmol*m-2*s-1 white light (yellow) or darkness in the presence 1027 of 1% sucrose (hatched gray). Expression levels were normalized to PP2A 1028 expression. Error bars show standard error of the mean of two biological replicates. 1029 (F) The hy5 mutation does not affect light induction of WUS expression. Tissue 1030 specific activation of light signaling can induce WUS expression in the meristem (G) 1031 and photomorphogenic growth (H, J) in dark-grown seedlings. Constitutively active 1032 phyB Y276H was expressed under different promoters: AP19: pAt1g26680; AP20: 1033 pAt3g59270; AP21: pSUC2; AP22: pUBQ10; AP87: pCAB3; AP88: pML1. Two 1034 independent lines were quantified each. (I) Phenotypic differences of pML1:PHYB 1035 Y276H lines correlate with the expression level of PHYB. Expression of the 1036 endogenous PHYB was determined by using a primer pair annealing in the 3' UTR of 1037 PHYB. Expression levels were normalized to PP2A expression. pWUS:3xVENUS- 1038 NLS expression (A, B, F and G) and hypocotyl length (H) were quantified in 4 day old 1039 seedlings that were exposed to different growth conditions (gray = darkness, red = 1040 red light (30 µmol*m-2*s-1), far red = far red light (30 µmol*m-2*s-1), blue = blue light 1041 (30 µmol*m-2*s-1), yellow = white light (150 µmol*m-2*s-1), solid box = w/o sucrose, 1042 hatched box = w/ 1% sucrose). 32 1043 Figure 3 1044 Hormonal control of the SAM. (A-F) Confocal images of 4 day old seedlings 1045 expressing pPIN1:PIN1-GFP in WT (A-D) or cop1-4 (E,F) background under diverse 1046 growth conditions. The lower row shows a magnification of the meristem area in the 1047 picture above. (G-K) GUS staining of 4 day old plants expressing pTCSn:GUS (light 1048 = white light (150 µmol*m-2*s-1), + suc = 1% sucrose, nor = 5 µM norflurazon, scale 1049 bar = 20 µm). (L) Wild-type seedlings after 20 days on plates containing CK (75 µM 1050 benzyladenine) supplemented with (+) or without (-) sucrose. 1051 1052 Figure 3 - figure supplement 1 1053 GUS staining of 4 day old plants expressing pTCSn:GUS (scale bar = 20 µm) grown 1054 under different growth conditions (light = white light (150 µmol*m-2*s-1), -CO2 = CO2- 1055 deficient, + suc = 1% sucrose) 33 1056 Figure 4 1057 Role of cytokinin signaling in WUS activation. Quantification of pWUS:3xVENUS- 1058 NLS expression in 4 day old seedlings. (A) Cytokinin was applied as 75 µM 1059 benzyladenine to wild-type (WT). (B) Ckx mutant lines display induced expression of 1060 the pWUS:3xVENUS-NLS reporter construct (growth conditions: gray = darkness, 1061 red = red light (30 µmol*m-2*s-1), solid box = w/o sucrose, hatched box = 1% 1062 sucrose). 1063 Figure 4 - figure supplement 1 1064 (A) PIFs repress development in darkness similar to COP1. Four-week-old pifq 1065 seedlings grown on 1% sucrose develop leaves in darkness. (B) Quantification of 1066 WUS expression by qRT-PCR normalized to PP2A in 7 day old seedlings grown in 1067 darkness on 1% sucrose. Error bars show standard error of the mean of two 1068 biological replicates. (C) CKX5 and CKX6 do not affect hypocotyl growth in darkness. 1069 Hypocotyl length of 4 day old etiolated ckx mutants that were analyzed in Figure 4B 1070 were compared to the corresponding background line. (D) ckx5/ckx6 double mutant 1071 grown on 1% sucrose in darkness for 2 weeks (scale bar = 20 µm). (E) Sequencing 1072 analysis of CKX6 locus in 3 homozygous T1 mutants that were induced by CRISPR- 1073 CAS9 (Reference genome in top row shows bases 1-60 and 380-440 of the CKX6 1074 coding sequence. gRNA and PAM in capital letters are highlighted in turquoise and 1075 blue, respectively. Deletions are represented as dots. All mutations are highlighted in 1076 magenta.). 34 1077 Figure 5 1078 The TOR pathway integrates metabolic and light signals upstream of WUS. (A) 1079 Activation of pWUS:3xVENUS-NLS in 4 day old dark-grown seedlings grown with 15 1080 mM of diverse sugars (+sug). (B-D) Activation of pWUS:3xVENUS-NLS in seedlings 1081 grown in liquid culture in the presence and absence of 15 mM glucose. (B) Effect of 1082 AZD-8055 TOR inhibitor on glucose treatment. (C) Effect of AZD-8055 TOR inhibitor 1083 on light treatment. (D) Effect of AZD-8055 TOR inhibitor on cop1-4 mutant seedlings. 1084 (growth conditions: gray = darkness, red = red light (30 µmol*m-2*s-1), solid box = w/o 1085 sugars added, hatched box = with sugar) (E) Quantification of S6K phosphorylation 1086 relative to total S6K levels based on western blots shown in Figure 5 - figure 1087 supplement 1B. (F-H) Metabolite measurements from 4 day old seedlings. Gray bars 1088 represent untreated seedlings; hatched bars represent 24 h treatment with 15 mM 1089 glucose; green bars represent 24 h light treatment (60 µmol*m-2*s-1 of red and blue 1090 light each); yellow bars represent cop1-4 mutant seedlings. Error bars show standard 1091 error of the mean; asterixs indicate significance tested by unpaired two-tailed oneway 1092 ANOVA Student-Newman-Keuls test: *p<0.05, **p<0.01, ***p<0.001; Glyox = 1093 glyoxylate; KG = ketoglutarate. (I) PCA based on metabolite measurements shown 1094 in Figure 5F-H and Figure 5 - figure supplement 1D, E. 1095 Figure 5 - figure supplement 1 1096 The TOR pathway is activated by light signal transduction. (A) The experiment 1097 shown in Figure 5C was repeated in the presence of 5 µM norflurazon (growth 1098 conditions: gray = darkness, red = red light (30 µmol*m-2*s-1)). (B and C) Western blot 1099 of WT and cop1 mutant seedlings using Phospho-p70 S6 kinase (Thr(P)-389) 1100 antibody to detect S6K phosphorylation (top row) and S6K1/2 antibody to detect total 1101 S6K1 and S6K2 (middle row). Lowest row shows Coomassie stained membrane to 1102 visualize total protein loaded. The same growth conditions as for the metabolite 1103 measurements were used (see below). AZD-8055 was applied at a concentration of 1104 2 µM within the growth medium while plants were treated with light for the last 24 h 1105 only (C). (D-F) Metabolite measurements from 4 day old seedlings. Gray bars 1106 represent untreated seedlings; hatched bars represent 24 h treatment with 15 mM 1107 glucose; green bars represent 24 h light treatment (60 µmol*m-2*s-1 of red and blue 1108 light each); yellow bars represent cop1-4 mutant seedlings. Error bars show standard 1109 error of the mean; asterixs indicate significance tested by unpaired two-tailed oneway 1110 ANOVA Student-Newman-Keuls test: *p<0.05, **p<0.01, ***p<0.001 1111 35 1112 Supplementary File 1 1113 Results of metabolomic analysis 1114 1115 Supplementary File 2 1116 Description of constructs and oligonucleotides used in this study 1117 To generate new Green Gate module plasmids PCR was carried out with Phusion 1118 polymerase and the oligos listed on Arabidopsis genomic DNA, cDNA or diluted 1119 plasmids. PCR product were gel purified, digested with Eco31I and ligated in empty 1120 entry vectors that were Eco31I digested and gel purified. All modules were checked 1121 by sequencing. 36