Download RT-PCR and Sequencing Protocols for the Molecular

RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
OIE/FAO World Reference Laboratory for Foot-and-Mouth Disease
Molecular Epidemiology Group
RT-PCR and Sequencing Protocols for the
Molecular Epidemiology of Exotic Virus
Diseases of Animals*
N.J. Knowles and A.R. Samuel
Institute for Animal Health, Pirbright Laboratory, Ash Road,
Pirbright, Woking, Surrey, GU24 0NF, United Kingdom
6 December 1998
*Originally entitled: “RT-PCR and Sequencing Protocols for Molecular
Epidemiology of Virus Diseases”, 12th September 1996
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 1
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
CONTENTS
Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
Protocol 1: Extraction of Virus RNA using RNeasy Spin-Columns . . . . . . . . . . . . . . . . . . . 5
Protocol 2: Reverse Transcription of Virus RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
Protocol 3: PCR Amplification of Reverse Transcribed RNA . . . . . . . . . . . . . . . . . . . . . . . . 7
Protocol 4: Agarose Gel Electrophoresis of PCR Products . . . . . . . . . . . . . . . . . . . . . . . . . 8
Protocol 5: Purification of PCR Products using Promega Wizard Preps™ . . . . . . . . . . . . . . 9
Protocol 6: End-Labelling of Oligonucleotide Primers using T4 Polynucleotide Kinase . . . 10
Protocol 7: Cycle Sequencing using the Promega f-mol® Kit . . . . . . . . . . . . . . . . . . . . . . . 11
Protocol 8: Polyacrylamide Gel Electrophoresis of Cycle Sequencing Products . . . . . . . . . 13
Sequence Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
Specific Applications 1: Molecular Epidemiology of Foot-and-Mouth Disease types O, A, C and
Asia 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
Specific Applications 2: Molecular Epidemiology of Foot-and-Mouth Disease types SAT 1, SAT
2 and SAT 3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
Specific Applications 3: Molecular Epidemiology of Swine Vesicular Disease . . . . . . . . . . 22
Specific Applications 4: Molecular Epidemiology of Encephalomyocarditis Virus Infections
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
Appendix I: Reagents for Acrylamide Gel Fractionation . . . . . . . . . . . . . . . . . . . . . . . . . . . 24
Appendix II: Polymerase Chain Reaction Amplification and Cycle Sequencing of the 1D (VP1)
Gene of Foot-and-Mouth Disease Viruses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
Appendix III: Recent Developments in the Epidemiology of Foot-and-Mouth Disease: Genetic
Relationships Determined by Nucleotide Sequence Analysis . . . . . . . . . . . . . . . . . . 35
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 2
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
ACKNOWLEDGEMENTS
We would like to thank the following staff members and visiting workers who have assisted
in the development and application of the techniques described in this manual: David Ansell,
Gang Zhang, Lin Fengsheng, Vladimir Drygin and Alexei Sherbakov. The technical
assistance of Nicola Dickinson and Ginette Wilsden is also gratefully acknowledged.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 3
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
INTRODUCTION
Figure 1 shows the strategy employed in the OIE/FAO World Reference Laboratory for Footand-Mouth Disease (WRLFMD) for the generation of sequence data for molecular
epidemiological studies.
Preferred route
Sample arrives in WRLFMD
Typing by ELISA
Alternative route
Preparation of 10% epithelium susp.
Inoculation of 10% susp. onto cell cultures
Typing by ELISA
Molecular Epidemiology Group
vRNA extraction
Reverse transcription of vRNA
PCR
Analysis by agarose gel electorphoresis
Wizard Prep purification of PCR amplicon
Automated cycle sequencing
Manual (radioactive) cycle sequencing
Sequence reading and entry onto WRLFMD database
Comparison with other sequences on database
Production of phylogenetic tree using selected sequences
Fig. 1. . Flow chart showing the RT-PCR/sequence analysis strategy employed by the WRLFMD Molecular Epidemiology Group.
Subsequent chapters present the protocols used for RNA extraction, reverse transcription,
polymerase chain reaction amplification and nucleotide sequencing. Additionally references (and
abstracts, where available) are given in which the application of these techniques has been applied
to the study of foot-and-mouth disease virus (FMDV), swine vesicular disease virus (SVDV) and
encephalomyocarditis virus (EMCV).
At the moment the chapter on sequence analysis only contains references to software which
is of use for this work; this subject will be expanded upon in a later edition of this manual.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 4
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Protocol 1: Extraction of Virus RNA using RNeasy Spin-Columns
1. Put 460 µl of your sample into a 1.5 ml tube.
Add an equal volume of Lysis buffer RLT (containing 1% 2-mercaptoethanol) to your sample
and mix by vortexing.
2. Add 460 µl 70% ethanol and mix by vortexing.
3. Apply to RNeasy spin column (700 µl maximum loading volume).
Spin in a microfuge for 15 sec at 10,000 rpm.
Discard flowthrough and reuse collection tube.
Repeat with remaining volume.
4. Wash with 700 µl wash buffer RW1.
Centrifuge as before.
5. Wash with 500 µl wash buffer RPE.
Centrifuge as above.
6. Repeat wash with 500 µl wash buffer RPE.
Centrifuge at max speed for 2 min to dry membrane.
7. Elute RNA with 50 µl DEPC-H2O into a new clean collection tube.
Spin in a microfuge for 60 sec at 10,000 rpm.
8. Store in clean tube at -20°C. Label the tube clearly with “RNA”, the virus name, today’s date
and your name.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 5
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Protocol 2: Reverse Transcription of Virus RNA
1. In a sterile 0.75 ml eppendorf tube prepare the following mixture (depending on the number
of RNAs to be reverse transcribed).
Reagent
No. of RNA preps
1
2
3
4
5
10 mM dNTPs
2.5*
5
7.5
10
12.5
5× RT Buffer (with DTT)
5
10
20
25
MMLV (200 U/µl)
0.5
1
1.5
2
2.5
RNasin (3.3 U/µl)
1
2
3
4
5
DEPC-H2O
1
2
3
4
5
Primer (25 pmol/µl)
1
2
3
4
5
Total
11
22
33
44
55
15
* amount in µl
2. Add 11 µl of the mixture to 14 µl of each RNA template giving at total volume of 25 µl.
3. Spin briefly in microfuge.
4. Heat at 42°C for 60 min and then at 94°C for 10 min (either in a waterbath or in the
thermocycler).
5. Store at -20°C. Label the tube with “RT product”, the virus name, today’s date and your
name.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 6
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Protocol 3: PCR Amplification of Reverse Transcribed RNA
1. Into a sterile 0.75 ml tube add the following. Take care to use sterile tips and avoid cross
contamination.Use new tips for each reagent and template.
Reagent
Concentration Amount (µl)
25 mM MgCl2
1.5 mM
3
10 mM dNTPs
200 µM
1
1x
5
primer 1 (10-25 pmol/µl)
02.-0.5 pmol/µl
1
primer 2 (10-25 pmol/µl)
02.-0.5 pmol/µl
1
10× buffer
Taq DNA polymerase (5 U/µl)
2.5 U
RT product (template)
0.5
5
DEPC-H2O
33.5
Total volume:
50
2. Add 20 µl of mineral oil to the top of mixture, spin.
3. Run on Thermocycler as follows:
Temperature
Time
No. of cycles
94°C
4 min
1
94°C
60 sec
55°C
60 sec
72°C
90 sec
72°C
5 min
30
1
4. Take 5 µl of PCR product and check it on an agarose gel.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 7
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Protocol 4: Agarose Gel Electrophoresis of PCR Products
Note: Take care ethidium bromide is harmful, gloves should be worn at all times.
1.
Prepare 60 ml of 2% agarose in 1x TBE buffer.
2.
Either heat in microwave for ~2 min on full power or place in beaker of boiling water until
melted.
3.
Allow to cool to about 45°C and add 1 µl ethidium bromide (stock=5 mg/µl) per 10 ml,
giving a final concentration of 0.5 µg/ml. This can be increased to 1 µg/ml if no ethidium
bromide is added to the buffer (see below).
4.
Pour gel and insert well former (comb). Allow to set on a flat surface for about 15 min.
5.
Pour buffer 1x TBE (containing 0.5 µg/ml ethidium bromide, i.e. 1 µl of 5 mg/ml stock to
every 10 ml of buffer) into tank and remove comb from gel.
6.
Prepare samples in tubes, a multiwell plate or on parafilm.
1 µl loading buffer
5 µl PCR product
7.
Prepare molecular weight marker.
0.5 µl molecular weight marker VI (Boehringer)
1 µl loading buffer
4.5 µl H2O
8.
Load samples into the wells formed in the gel. It is often useful to load the molecular weight
markers in both the first and last lanes.
9.
Electrophorese at 100 volts for 20 min (minimum) or 10 volts overnight.
10. View and photograph the gel on an UV-transilluminator. Use UV-safety spectacles.
6x Loading Buffer
PROTOCOL.WPD
Reagent
Final conc.
Amount (µl)
Glycerol
30%
300
10% bromophenol blue
0.25%
25
10% xylene cyanol
0.25%
25
H2O
650
Total
1000
WRL-FMD: Molecular Epidemiology Group
Page 8
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Protocol 5: Purification of PCR Products using Promega Wizard Preps™
Note:- It is advisable to prepare all tubes/columns and syringes before use.
1. Transfer PCR reaction (after checking on a agarose gel) to a 1.5 ml tube (take care not to take
up any mineral oil) .
2. a) Add 100 µl Direct Purification Buffer.
b) Mix.
3. a) Add 1 ml of Resin.
b) Mix 3 times over 1 min.
4. Prepare one Wizard Prep mini-column for each PCR product.
a) Remove the plunger from a 2 ml disposable syringe.
b) Attach syringe to mini-column (lock together).
c) Rest on the top of a 1.5 ml tube which has had its lid removed.
5. a) Pipette the Resin/PCR mix into the syringe barrel (from step 3).
b) Insert the syringe plunger slowly and push the mix into the mini-column, letting liquid go
to waste.
6. a) Remove syringe from mini-column and remove plunger (this is to stop you pulling the mix
back out of the mini-column).
b) Reattach syringe to the mini-column.
c) Pipette 2 ml of 80% isopropanol into the syringe.
d) Insert the syringe plunger and push the isopropanol through the mini-column to waste.
7. Remove the syringe and centrifuge for 20 sec at 12,000 rpm to dry resin.
8. a)
b)
c)
d)
Transfer mini-column to new 1.5 ml tube.
Add 50 µl DEPC-H2O.
Leave for 1+ min (30 min maximum).
Microfuge for 20 sec at 12,000 rpm.
9. Store -20oC in 0.75 ml tube.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 9
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Protocol 6: End-Labelling of Oligonucleotide Primers using T4 Polynucleotide Kinase
1. Prepare the following mixture in an eppendorf tube:
Reagent
Amount (µl)
Primer (24 pmol/µl)
1
32
5
P -ATP (1.85 MBq)
10x PNK Buffer
3
T4 polynucleotide kinase (10 U/µl)
2
DEPC-H2O
19
Total
30
2. Spin briefly in a microfuge and incubate as indicated below:
Temperature
Time
37°C
30-60 min
90°C
5 min
3. Use 1.2 pmol of primer (1.5 µl) per sample (i.e. set of four reactions) in the cycle sequencing
protocol. The above is enough for about 20 samples.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 10
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Protocol 7: Cycle Sequencing using the Promega f-mol® Kit
1. a) Prepare one set of 4 tubes per isolate to be sequenced, label tubes T, C, G and A. A thin
walled 96 well plate may also be used.
b) Add 1 µl of the appropriate dd/dNTPs into each tube/well (in the order of T, C, G, A)
c) Spin briefly in microfuge.
d) Store at 4°C until needed (see part 4).
2. For each set of reactions add in a separate tube the following:Reagent
Amount (µl)
Template DNA (Wizard Prep™ purified)*
3
5
10
5x sequencing buffer
4
4
4
32
1.5
1.5
1.5
Sequencing grade Taq polymerase (5 U/µl)
1
1
1
P -ATP labelled primer
DEPC-H2O
10.5
8.5
3.5
Total
20
20
20
*
the amount of template used will depend on band intensity/conc, vary volume
of water accordingly.
3. Mix and spin
4. a) Add 4 µl of mixture to each dd/dNTP tube/well previously prepared.
b) Spin down (use a flat bed centrifuge if using a 96 well plate, 1000 rpm maximum)
5. Add a drop of mineral oil on top of reaction mixture.
6. Put onto pre-heated thermal cycler at 94°C.
Running conditions:
94°C
2 min
92°C
1 min
55°C
1 min
72°C
1 min 30 sec
20°C.
Hold
1 cycle
30 cycles
1 cycle
7. a) Add 4 µl of stop solution (see table below) to each tube/well.
b) Spin down.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 11
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
8. Heat at 80-90°C for 2-5 min before running on a gel.
9. Load 2.5-3.5 µl into each well.
Fmol® Sequencing Stop Solution
Reagent
Final conc.
Amount (µl)
Formamide
95%
950
2 M NaOH
10 mM
5
10% Bromophenol Blue
0.05%
5
10% Xylene Cyanol FF
0.05%
5
DEPC-H2O
Total
PROTOCOL.WPD
35
1000
WRL-FMD: Molecular Epidemiology Group
Page 12
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Protocol 8: Polyacrylamide Gel Electrophoresis of Cycle Sequencing Products
1.
a. Carefully clean a set of gel plates with a detergent that does not leave a residue.
b. Wash with distilled water and then wipe clean with ethanol.
2.
Coat one side of the SMALL plate with repelcote. If possible, mark the plate the first time
it is used with a diamond-tipped pen and always repelcote the same side.
3.
Put the plates together with the repelcoted side on the inside and the spacers at either side.
4.
Check that the sharkstooth combs fit tightly between the plates and then tape the plates on
either side and at the bottom.
5.
Mix gel solution: (note: wear gloves - acrylamide is dangerous)
- 125 ml 0.5x TBE gel mix
- 250 µl TEMED
- 250 µl 25% ammonium persulphate (AMPS)
Note: the gel will start setting within about 5 min of the addition of the AMPS.
If using Sequagel use 100 ml and 800 µl 10% AMPS.
6.
Pour the gel solution between the glass plates using a 50 ml syringe.
7.
Insert combs upside down (i.e. flat side next to gel and nearly as far in as the holes in the
comb).
8.
Clamp tightly using clips.
9.
Leave to set for at least 1 hour. The gel can be stored at 4°C overnight if the top is kept
moist with 1x TBE and covered with cling film.
10. Pre-running the gel:
- remove the combs carefully - the teeth break easily.
- remove the tape.
- rinse the top of the gel with distilled water or 1x TBE.
- Insert combs with sharks tooths forming wells (with points just touching top of gel).
- Put into gel tank and clamp tightly.
11. Prepare 1000 ml 1x TBE and pour into top and bottom tanks.
12. Wash urea out of wells with syringe and bent needle and pre-run the gel at a constant 70
watts for 1 hour. 2 µl of formamide dyes may be loaded in every other well prior to prerunning to see if any leakage from well-to-well is occurring.
13. Heat the samples at 95-100°C for 2 min before just before loading.
12. Wash urea out of wells with a 50 ml syringe and bent needle IMMEDIATELY prior to
loading samples.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 13
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
14. Add 3 µl of each sample into the wells formed by the combs following the order T, C, G, A.
15. Run at a constant 70 watts for 2 hours (the bromophenol blue marker should just run of the
end of the gel into the buffer). The samples can also be run of 4 hours.
16. Remove the plates from the gel tank, carefully remove the combs and split the glass plates
apart. The gel should remain attached to the larger glass plate!
17. Optionally fix in at tray of 10% acetic acid, 10% ethanol, 80% water for 20-30 min.
18. Remove from fixative and lay a piece of 3MM filter paper over the gel. Carefully peel off
with the gel sticking to the 3MM paper.
19. Dry down for 45 min to 1.5 hours on slab gel dryer set to heat at 80-85oC.
20. Mark one corner of the dried gel (e.g. by cutting off a corner). Expose gel to X-ray film in
a light tight cassette at room temperature (cut off the corresponding corner of the X-ray
film). If using an intensifying screen store at -70°C. Exposure times usually range from 18-48
h with an intensifying screen and 18-60 h without, depending on the activity of the
radioisotope.
21. Develop autoradiograph and immediately label with the date, order of loading (i.e. TCGA)
and the name of each sample.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 14
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Sequence Analysis
At the moment the chapter on sequence analysis only contains references to software which
is of use for this work; this subject will be expanded upon in a later edition of this manual.
Software packages for the PC which are useful for sequence analysis
EpiSeq for DOS
EpiSeq for Windows
PHYLIP
ClustalW
ClustalX
GeneDoc
TreeView
Neighbor-joining
algorithm
UPGMA
algorithm
Bootstrap
re-sampling
PROTOCOL.WPD
Knowles, N.J. (1991-98). EpiSeq for DOS: a suite of programs for
epidemiological sequencing. Unpublished. [Availability limited]
Knowles, N.J. (1994-98). EpiSeq for Windows: a suite of programs for
epidemiological sequencing. Unpublished. [Availability limited]
Felsenstein, J. (1993). PHYLIP (Phylogeny Inference Package) version 3.5c.
Distributed by the author. Department of Genetics, University of Washington,
Seattle, 1993.
http://evolution.genetics.washington.edu/phylip.html
Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994). CLUSTAL W:
improving the sensitivity of progressive multiple sequence alignment through
sequence weighting, positions-specific gap penalties and weight matrix choice.
Nucleic Acids Research 22: 4673-4680.
http://www-igbmc.u-strasbg.fr/BioInfo/ClustalW/clustalw.html
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G.
(1997). The CLUSTAL_X windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic Acids Research 25:
4876-4882.
http://www-igbmc.u-strasbg.fr/BioInfo/ClustalX/
Nicholas, K.B. and Nicholas, H.B. Jr. (1996). GeneDoc: a tool for editing and
annotating multiple sequence alignments. Distributed by the author.
http://www.cris.com/~ketchup/genedoc.shtml
Page, R.D.M. (1996). TREEVIEW: An application to display phylogenetic
trees on personal computers. Computer Applications in the Biosciences 12:
357-358.
http://taxonomy.zoology.gla.ac.uk/rod/treeview.html
Saitou, N. and Nei, M. (1987). The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406425.
Prager, E.M. and Wilson, A.C. (1978). Construction of phylogenetic trees for
proteins and nucleic acids: empirical evaluation of alternative matrix methods.
Journal of Molecular Evolution 11: 129-142.
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39: 783-791.
Efron, B., Halloran, E. and Holmes, S. (1996). Bootstrap confidence levels for
phylogenetic trees. Proceedings of the National Academy of Sciences USA 93:
13429-13434.
WRL-FMD: Molecular Epidemiology Group
Page 15
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
SPECIFIC APPLICATIONS 1: MOLECULAR EPIDEMIOLOGY OF FOOT-ANDMOUTH DISEASE TYPES O, A, C AND ASIA 1
Please refer to the following papers (and references therein) for examples of work on this
subject:
Beck, E. and Strohmaier, K. (1987). Subtyping of European foot-and-mouth disease virus strains
by nucleotide sequence determination. Journal of Virology 61: 1621-1629.
Abstract: The VP1-coding regions of foot-and-mouth disease virus strains from 18 recent European outbreaks
and of 9 strains isolated more than 20 years ago and used in part as vaccines were determined by direct cDNA
sequencing. Comparison of the sequences revealed that most of the isolated outbreak viruses are closely related
to the vaccine strains used. Isolates from the Italian epizootic of 1984 to 1985 correspond, for example, to the
vaccine strain A5 Parma 62; the outbreak in 1984 in Bernbeuren, Federal Republic of Germany, was induced by
A5 Allier 60; outbreaks in 1982 in Funen, Denmark, and in Murchin, German Democratic Republic, were caused
by O1 Lausanne 65. Viruses isolated during the 1983 Iberian epizootic show a close relationship to the vaccine
strain A5 Allier 60 but were probably derived from another not yet identified vaccine strain from Spain. Only two
minor outbreaks in the Federal Republic of Germany, A Aachen in 1976 and O Wuppertal in 1982, did not
correspond to the classical European strains but were obviously introduced from outside. We suggest that
nucleotide sequence analysis should be used as a standard method of diagnosis, because when compared with
other techniques it more clearly reveals the origin and course of epizootics and offers the possibility of preventing
further outbreaks.
Samuel, A.R., Knowles, N.J. and Kitching, R.P. (1988). Serological and biochemical analysis of
some recent type A foot-and-mouth disease virus isolates from the Middle East. Epidemiology
and Infection 101: 577-590.
Abstract: In 1986 and 1987 foot-and-mouth disease virus (FMDV) serotype A was isolated from outbreaks of
disease in Saudi Arabia and Iran. Selected virus isolates were antigenically distinct from the prototype A22 virus
strain (A22/Iraq/64), but were serologically related to each other. However, polyacrylamide gel electrophoresis
showed that whilst the respective Saudi Arabian structural polypeptides were homogeneous, those from an Iran
isolate were distinct. Direct sequencing of part of the P-1D (VP1) gene demonstrated considerable difference in
nucleotide homology between the two groups of viruses; the Saudi Arabian viruses were closely related to each
other but only distantly related to both the A22 prototype virus strain and the Iranian virus isolate. The latter
viruses were only slightly more closely related to each other. Thus there appeared to be at least two distinct
FMDV type A variants co-circulating in the Middle East, both of which differed considerably from the classical
A22 subtype.
Martínez, M.A., Dopazo, J., Hernández, J., Mateu, M.G., Sobrino, F., Domingo, E. and Knowles,
N.J. (1992). Evolution of the capsid protein genes of foot-and-mouth disease virus. Antigenic
variation without accumulation of amino acid substitutions over six decades. Journal of
Virology 66: 3557-3565.
Abstract: The genetic diversification of foot-and-mouth disease virus (FMDV) of serotype C over a 6-decade
period was studied by comparing nucleotide sequences of the capsid protein-coding regions of viruses isolated
in Europe, South America, and The Philippines. Phylogenetic trees were derived for VP1 and P1 (VP1, VP2,
VP3, and VP4) RNAs by using the least-squares method. Confidence intervals of the derived phylogeny
(significance levels of nodes and standard deviations of branch lengths) were placed by application of the
bootstrap resampling method. These procedures defined six highly significant major evolutionary lineages and
a complex network of sublines for the isolates from South America. In contrast, European isolates are
considerably more homogeneous, probably because of the vaccine origin of several of them. The phylogenetic
analysis suggests that FMDV CGC Ger/26 (one of the earliest FMDV isolates available) belonged to an
evolutionary line which is now apparently extinct. Attempts to date the origin (ancestor) of the FMDVs analyzed
met with considerable uncertainty, mainly owing to the stasis noted in European viruses. Remarkably, the
evolution of the capsid genes of FMDV was essentially associated with linear accumulation of silent mutations
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 16
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
but continuous accumulation of amino acid substitutions was not observed. Thus, the antigenic variation attained
by FMDV type C over 6 decades was due to fluctuations among limited combinations of amino acid residues
without net accumulation of amino acid replacements over time.
Samuel, A.R., Ansell, D.M., Rendle, R.T., Armstrong, R.M., Davidson, F.L., Knowles, N.J. and
Kitching, R.P. (1993). Field and laboratory analysis of an outbreak of foot-and-mouth disease
in Bulgaria in 1991. Revue scientifique et technique de l’Office International des Epizooties
12: 839-848.
Abstract: In July 1991, an outbreak of foot and mouth disease (FMD) occurred near Stefan Karadjovo village
in Boliarovo (south-east Bulgaria, close to the Turkish border). The virus isolated was identified in Bulgaria as
serotype O and this was subsequently confirmed by the World Reference Laboratory for Foot and Mouth Disease
in Pirbright (United Kingdom). Serological studies using bovine sera and monoclonal antibody analysis were
made. In addition, the sequence of approximately 170 nucleotides at the 3’ end of the 1D gene was determined
for the field isolate and for vaccine strains used in Bulgaria. These were compared with other sequences of type
O FMD viruses from outbreaks in the Middle East. Serum samples were taken from domestic animals in the
region close to the outbreak and examined for anti-FMD virus antibodies to assess the extent (if any) of spread
of the virus before or after the outbreak. No evidence of infection was found in these animals. The virus involved
in the Bulgarian outbreak was antigenically similar to the O1 vaccine strains but probably did not originate from
these strains. The virus was closely related genetically to a group of viruses isolated in the Middle East since
1987, suggesting that it may have been introduced into Bulgaria from an area in the Middle East by unidentified
means.
Ansell, D.M., Samuel, A.R., Carpenter, W.C. and Knowles, N.J. (1994). Genetic relationships
between foot-and-mouth disease type Asia 1 viruses. Epidemiology and Infection 112: 213224.
Abstract: The sequence of 165 nucleotides at the 3’ end of the 1D (VP1) gene of foot-and-mouth disease (FMD)
virus was determined for 44 type Asia 1 strains isolated from throughout Asia between 1954-92. Analysis of the
relationships between the virus genomes showed epidemiological links not previously evident. The possible
origin of the only outbreak of FMD Asia 1 to have occurred in Europe, in Greece in 1984, was identified because
the nucleotide sequence of this virus was closely-related to the sequences of those present in the Middle East
between 1983-5. Variation in the region sequenced was not as great as that seen in the other FMDV serotypes
and all viruses shared greater than 85% nucleotide identity. Thus all the virus isolates examined were considered
to belong to a single genotype. A database of Asia 1 virus sequences has been established which will facilitate
the rapid analysis of new outbreaks strains.
Armstrong, R.M., Samuel, A.R., Carpenter, W.C., Rama Kant and Knowles, N.J. (1994). A
comparative study of serological and biochemical methods for strain differentiation of
foot-and-mouth disease type A viruses. Veterinary Microbiology 39: 285-298.
Abstract: Three serological and three biochemical methods were used to compare five field isolates of
foot-and-mouth disease virus (FMDV) from Western India with nine reference vaccine strains and five field
isolates from other countries. The serological tests (liquid-phase ELISA and virus neutralization) were able to
distinguish between the three reference vaccine strains examined, but the five Indian field isolates reacted poorly
with antisera produced against these vaccine strains. Analysis of monoclonal antibody (mAb) data was difficult
to interpret although clearly the field isolate A/IND/5/87 reacted to a lesser extent with one of the mAb panels
(A 10/Holland/42) than the other four Indian isolates. The A22/Iraq/24/64 mAbs did not react with any of the
Indian field isolates and only significantly with one of the reference vaccine strains, A/IND/57/79.
Polyacrylamide gel electrophoresis distinguished the reference vaccine strains from each other and from the field
isolates. Additionally, one of the Indian isolates (A/IND/5/87) could be differentiated from the other four.
Electrofocusing showed similarities between the reference vaccine strain A22/Iraq/24/64 and three of the Indian
field isolates (A/IND/1/87, A/IND/2/87 and A/IND/3/87), however, A/IND/4/87 and A/IND/5/87 were distinct.
Nucleotide sequencing showed that the isolates A/IND/1/87, A/IND/2/87 and A/IND/3/87 were very closely
related to each other and related to A/IND/4/87, however, A/IND/5/87 was different.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 17
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Samuel, A.R., Knowles, N.J., Kitching, R.P. and Hafez, S.M. (1997). Molecular analysis of type
O foot-and-mouth disease viruses isolated in Saudi Arabia between 1983 and 1995.
Epidemiology and Infection 119: 381-389.
Abstract: Partial nucleotide sequence of the capsid polypeptide coding gene ID (VP1) was determined for 68
serotype O foot-and-mouth disease viruses isolated between 1983 and 1995 from outbreaks occurring in Saudi
Arabia. The sequences were compared with previously published sequences: 14 viruses of Middle Eastern origin
(isolated between 1987 and 1991); and with four vaccine virus strain sequences, three originating from the
Middle East (O1/Turkey/Manisa/69, O1/Sharquia/Egypt/72 and O1/Israel/2/85) and one from Europe (O1/BFS
1860/UK/67). The virus isolates from Saudi Arabia and the Middle East vaccine virus strains formed a related
genetic group distinct from the European O1 virus. Within this large group 12 distinct genetic sublineages were
observed.
Pattnaik, B., Venkataramanan, R., Tosh, C., Sanyal, A., Hemadri, D., Samuel, A.R., Knowles,
N.J. and Kitching, R.P. (1998). Genetic heterogeneity of Indian field isolates of foot-andmouth disease virus serotype O as revealed by partial sequencing of 1D gene. Virus Research
55: 115-127.
Abstract: The sequence of 165 nucleotides at the 3’ end of the ID gene, determined from RT-PCR amplified
cDNA fragments, of 25 type O strains isolated from different parts/regions of India during 1987-1995 and the
vaccine strain (R2/75) currently in use in India were subjected to phylogenetic analysis. One isolate from the
neighbouring country Nepal was also included in the study. The virus/field strains showed high degree of genetic
heterogeneity among themselves with % divergence in nucleotide sequence ranging from 1.2 to 19.4%. The
Indian strains were much away (13.3-20.6%) from the exotic type O strains of O1 BFS, O1 K, and O1 Campos.
The type O strains-analyzed were classified into three genotypes basing on level of divergence observed in
nucleotide sequence. The type O vaccine virus (R2/75) was > 7% divergent (7.3- 15.2%) from the field strains
which revealed significant (> 5%) genetic heterogeneity between the two. The phylogenetic analysis identified
three distinct lineages, viz., (i) lineage 1 represented by the exotic strains, (ii) lineage 2 represented by 25 of the
field strains which clustered into seven subgroups/sublines (2a-2g), and (iii) lineage 3 represented by a unique
field isolate which shared the branching/origin with the vaccine strain. The lineage 2 which comprised of 25 of
the 26 type O field strains analyzed, was placed almost at equidistance from the lineages 1 and 3 in the
phylogenetic tree. The vaccine strain was closer to the viruses in lineage 2. Though there was no specific
distribution pattern of sequences in different geographical regions of Indla, the viruses/sequences in subgroup
2f appeared to be restricted to the southern states. Comparison of deduced amino acid sequence in the
immunodominant regions 133-160 and 200-208 of the 1D gene product (VP1) showed that the two viruses in
lineage 3 had unique amino acid residues at the positions 138 (D), 139 (G), 144 (I), and 158 (A) compared to
rest of the strains including the exotic ones. Comparison of amino acid residues at critical positions 144, 148,
149, 151, 153, 154, and 208 revealed similarity between the type O strains analyzed. The virus strains showed
variation (V/L/I) at position 144. One field strain showed replacement from Q149 - E and another from P208
- L. Thus, the study revealed that the type O FMD virus populations circulating in India and causing disease
outbreaks are genetically much heterogenous but related at the immunodominant region of VP1 polypeptide, and
there are more than one genetically distinct virus populations in almost every region of the country which is
possible due to unrestricted animal movement in the country. The involvement of vaccine virus in disease
outbreaks was ruled out as the field strains (excluding the one in lineage 3) were phylogenetically distinct from
it.
Knowles, N.J. and Samuel, A.R. (1998). Molecular techniques in foot-and-mouth disease
epidemiology. Towards livestock disease diagnosis and control in the 21st century:
proceedings of an international symposium on diagnosis and control of livestock diseases
jointly organized by the International Atomic Energy Agency and the Food and Agriculture
Organization of the United Nations, held in Vienna, 7-11 April 1997. Vienna: International
Atomic Energy Agency, p. 185-201.
Abstract: The study of the epidemiology of FMD has been revolutionized by the introduction of molecular
biological techniques which can establish genetic relationships between the causative viruses. Early biochemical
techniques such as SDS-polyacylamide gel electrophoresis (PAGE), electrofocusing and ribonuclease T1
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 18
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
oligonucleotide mapping were used to augment traditional antigenic comparisons to relate different FMDV
isolates and strains. We have been studying FMD epidemiology using nucleotide sequencing since 1987 and
have accumulated a database of nearly 1500 partial VP1 sequences representing all seven serotypes of the virus.
This has put us in a unique position to study the global epidemiology of the disease. Our studies have shown that
FMD viruses may be grouped into genetic types which correlate with geographical location. We have proposed
that these geographically distinct genotypes be termed ‘topotypes’. For FMD type O at least six topotypes have
been defined, one of which is probably now extinct; for type A four topotypes have so far been identified; for type
C about six genotypes and for Asia 1 only one genotype. Studies on the SAT 1 and SAT 3 serotypes in southern
Africa have shown the presence of three distinct topotypes for each. These have probably arisen through the
geographic isolation of wild buffalo herds and multiple introductions into domesticated cattle. The situation with
the SAT 2 serotype was, however, different; only two genotypes were found, which did not correlate with
geographical origin.
Samuel, A.R., Knowles, N.J. and Mackay, D.K.J. (1998). Genetic analysis of type O viruses
responsible for epidemics of foot-and-mouth disease in North Africa. Epidemiology and
Infection, in press.
Abstract: The nucleotide sequences of the 3' end of the capsid-coding region were determined for 30 serotype
O foot-and-mouth disease (FMD) viruses isolated between 1987 and 1994 from outbreaks in North Africa and
the Middle East. These sequences were compared with the previously published sequences of nine field virus
isolates from the Middle East and five vaccine virus strains, three of which originated from the Middle East
(O 1/Turkey/Manisa/69, O1/Sharquia/Egypt/72 and O1/Israel/2/85) and two from Europe
(O1/Lausanne/Switzerland/65 and O2/Brescia/Italy/47). Cluster analysis of these sequences using the unweighted
pair group mean average (UPGMA) method showed i) that the FMD viruses isolated from North Africa and the
Middle East were very different from the classical European vaccine strains; ii) that all the viruses isolated during
the 1989-92 North African epidemic formed a cluster differing by no more than 6% from each other; iii) a virus
isolated in Libya in 1988 was unrelated to the aforementioned epidemic; and iv) viruses from a second, less
extensive epidemic, occurring in 1994, fell into yet another cluster.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 19
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
SPECIFIC APPLICATIONS 2: MOLECULAR EPIDEMIOLOGY OF FOOT-ANDMOUTH DISEASE TYPES SAT 1, SAT 2 AND SAT 3
Note: The primers set used for the RT-PCR amplification of the South African Territories
(SAT) serotypes of FMDV is as follows (N.J. Knowles, unpublished data):
Name
Primer sequence (5’ to 3’)
SAT-1D209F
CCACATACTACTTTTGTGACCTGGA
FMD-2B208R
ACAGCGGCCATGCACGACAG
NK72
GAAGGGCCCAGGGTTGGACTC
Location
Use
Gene
Nt.
VP1
209-234
Forward primer
2B
208-227
Reverse primer
2A/2B
34-48/1-6
Sequencing primer
This primer set works for all three SAT serotypes and results in a PCR products of
approximately 730 bp, 715 bp and 718 bp for SAT 1, SAT 2 and SAT 3, respectively.
Please refer to the following papers (and references therein) for examples of work on this
subject:
Vosloo, W., Knowles, N.J. and Thomson, G.R. (1992). Genetic relationships between southern
African SAT-2 isolates of foot-and-mouth disease virus. Epidemiology and Infection 109:
547-558.
Abstract: Sequencing of part of the 1D gene of foot-and-mouth disease virus was used to determine the
relationships between SAT-2 viruses isolated from outbreaks which occurred in cattle in Zimbabwe and Namibia
and in impala in South Africa between 1979 and 1989. The results demonstrated that the outbreaks in different
countries were unrelated. Surprisingly close relationships were shown between all SAT-2 viruses isolated from
cattle in Zimbabwe since 1983 but the two major epizootics which occurred in 1989 were caused by viruses
which were clearly different. Conversely, two apparently unrelated outbreaks in impala in South Africa were
caused by viruses which could not be distinguished.
Dawe, P.S., Flanagan, F.O, Madekurozwa, R.L., Sorensen, K.J., Anderson, E.C., Foggin, C.M.,
Ferris, N.P. and Knowles, N.J. (1994). Natural transmission of foot-and-mouth disease virus
from African buffalo (Syncerus caffer) to cattle in a wildlife area of Zimbabwe. Veterinary
Record 134: 230-232.
Abstract: An outbreak of foot-and-mouth disease (FMD) occurred during April 1991 in a trypanosomiasis
sentinel cattle herd by the Rifa River to the east of Lake Kariba, Zimbabwe. Despite the cattle having been
vaccinated biannually for the previous five years the disease was severe. The viruses isolated from the affected
animals were typed as FMD virus type SAT 1. Free-living African buffalo (Syncerus caffer) which had been
using the same watering place as the affected cattle were sampled and FMD type SAT 1 virus was isolated.
Partial nucleotide sequencing of the gene coding for the capsid protein 1D (VP1) of one of the viruses isolated
from cattle and two of the viruses isolated from buffalo demonstrated a close relationship between the three
viruses. Since no other cattle were present in the area and no outbreaks of SAT 1 had occurred in Zimbabwe
since 1989, it was concluded that the disease had been transmitted from buffalo to cattle.
Vosloo, W., Kirkbride, E., Bengis, R.G., Keet, D.F. and Thompson, G.R. (1995). Genome
variation in the SAT types of foot-and-mouth disease viruses prevalent in buffalo (Syncerus
caffer) in the Kruger National Park and other regions of southern Africa, 1986-93.
Epidemiology and Infection 114: 203-218.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 20
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Abstract: Dideoxy nucleotide sequencing of a portion of the 1D gene of SAT-type foot-and-mouth disease viruses
(FMDV) was used to derive phylogenetic relationships between viruses recovered from the
oesophageo-pharyngeal secretions of buffalo in the Kruger National Park as well as several other wildlife areas
in southern Africa. The three serotypes differed from one another by more than 40% while intratypic variation
did not exceed 29%. Within each type, isolates from particular countries were more closely related to one another
than to isolates from other countries lending credence to previous observations that FMDV evolve independently
in different regions of the subcontinent.
Vosloo, W., Bastos, A.D., Kirkbride, E., Esterhuysen, J.J., Rensburg, D.J. Van, Bengis, R.G.,
Keet, D.W and Thomson, G.R. (1996). Persistent infection of African buffalo (Syncerus
caffer) with SAT-type foot-and-mouth disease viruses: rate of fixation of mutations, antigenic
change and interspecies transmission. Journal of General Virology 77: 1457-1467.
Abstract: Transmission of a plaque-purified SAT-2 foot-and-mouth disease virus (FMDV) occurred erratically
from artificially infected African buffaloes in captivity to susceptible buffaloes and cattle in the same enclosure;
in some instances transmission occurred only after contact between persistently infected carriers and susceptible
animals lasting a number of months. Because the rate at which FMDV mutations accumulated in persistently
infected buffaloes was approximately linear (1.64% nucleotide substitutions per year over the region of the 1D
gene sequenced), both buffaloes and cattle that became infected some months after the start of the experiment
were infected with viruses that differed from the original clone. The nucleotide differences were reflected in
significant antigenic change. A SAT-1 FMDV from a separate experiment inadvertently infected some of the
buffalo in the SAT-2 experiment. The SAT-1 FMDV also accumulated mutations at a constant rate in individual
buffaloes (1.54% nucleotide changes per year) but the resultant antigenic variation was less than for SAT-2. It
is concluded that persistently infected buffaloes in the wild constantly generate variants of SAT-1 and SAT-2
which explains the wide range of genomic and antigenic variants which occur in SAT-1 and SAT-2 viruses in
southern Africa.
Keet, D.F., Hunter, P., Bengis, R.G., Bastos, A. and Thomson, G.R. (1996). The 1992
foot-and-mouth disease epizootic in the Kruger National Park. Journal of the South African
Veterinary Association 67: 83-87.
Abstract: The monitoring of a foot-and-mouth disease epizootic amongst impala (Aepyceros melampus) in the
Kruger National Park is described. Infection rates of different sex and age classes of impala within the outbreak
focus were determined. Seroprevalence rates in other cloven-hoofed species were also determined. RNA
sequencing of a portion of the 1D gene of viruses isolated from SAT-2 viruses obtained from diseased impala
showed that they were unrelated to previous SAT-2 isolates made from animals in the Kruger National Park.
Bastos, A.D.S. (1998). Detection and characterization of foot-and-mouth disease virus in
sub-Saharan Africa. Onderstepoort Journal of Veterinary Research 65: 37-47.
Abstract: Genomic amplification of the VP1 gene of SAT-type foot-and-mouth disease virus (FMDV) was
performed with published and novel oligonucleotide primers. The primer pair with the highest SAT-type
recognition (67%) was identified and selected for optimization. Modifications to primers significantly improved
SAT-type detection (100%), broadened the recognition range to European (A, O and C) and Asian (Asia-1)
serotypes and improved test sensitivity. In addition to being able to confirm the presence of FMDV in a clinical
specimen within 6 h of receipt, the PCR product, which is amenable to nucleotide sequencing, enables genetic
characterization of viruses into serotype and topotype within 48 h. VP1 gene sequence analysis of isolates from
seven African countries and representative of five of the six serotypes occurring on the continent, revealed that
SAT-types have the highest levels of intratypic variation. Intratypic variation for the SAT-types ranged from
34-40,4% on nucleotide level, and from 24,1-27,5% on amino acid level. In addition, the methodology presented
here was shown to be useful for determining the origin and tracing the course of epizootics in both wild and
domestic cloven-hoofed animals.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 21
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
SPECIFIC APPLICATIONS 3: MOLECULAR EPIDEMIOLOGY OF SWINE
VESICULAR DISEASE
Please refer to the following papers (and references therein) for examples of work on this
subject:
Brocchi, E., Zhang, G., Knowles, N.J., Wilsden, G., McCauley, J.W., Marquardt, O., Ohlinger,
V.F. and De Simone, F. (1997). Molecular epidemiology of recent outbreaks of swine
vesicular disease: two genetically and antigenically distinct variants in Europe, 1987-1994.
Epidemiology and Infection 118: 51-61.
Abstract: Viruses from the recent epidemic of swine vesicular disease (SVD) in Europe have been isolated and
characterized by antigenic and genetic methods to examine the likely epidemiological origins of the disease.
Antigenic analysis was performed on 77 SVD viruses (SVDV) isolated in Europe between 1966 and 1994 using
two panels of monoclonal antibodies (MAb) in a trapping ELISA. Genetic analysis of 33 of the SVD viruses by
reverse transcription-polymerase chain-reaction (RT-PCR) amplification and nucleotide sequencing of the ID
(VP1) coding region was also performed. Comparison of the nucleotide sequences with each other and with three
other previously published SVDV sequences revealed four distinct groups which correlated exactly with the
results of the pattern of reactivity with MAbs. The first group consisted solely of the earliest SVD virus isolated
(ITL/1/66) while the second group comprised viruses present in Europe and Japan between 1972 and 1981. The
third group consisted of viruses isolated from outbreaks of SVD in Italy between December 1988 and June 1992.
Viruses isolated between 1987 and 1994 from Romania, the Netherlands, Italy and Spain formed a fourth group.
The genetic and antigenic similarity of the most recent virus isolates from Western Europe to a virus isolated in
Romania 5 years previously suggests that the possible origin of the recent epidemic of swine vesicular disease
in Western Europe was in Eastern Europe.
Zhang, G., Haydon, D.T., Knowles, N.J., McCauley, J.W. (1999). Molecular evolution of swine
vesicular disease virus. Journal of General Virology, in press.
Abstract: Phylogenetic analysis was used to examine the evolutionary relationships within a group of coxsackie
B viruses that contained representatives of the major serotypes of this group and 45 isolates of swine vesicular
disease virus (SVDV) from Asia and Europe. Separate analyses of sequence data from two regions of the viral
genomes encoding the VP1 and 3BC genes both revealed the SVDVs to belong to a single monophyletic group,
clearly distinguished from all other sampled coxsackie viruses. Regression analysis revealed that within the
SVDV clade at least 80% of synonymous variation in evolutionary divergence between isolates was explained
by time, indicating the existence of an approximate molecular clock. Calibration of this clock according to
synonymous substitutions per year indicated the date of occurrence of a common ancestor for the SVDV clade
to be between 1945 and 1965.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 22
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
SPECIFIC APPLICATIONS 4: MOLECULAR EPIDEMIOLOGY OF
ENCEPHALOMYOCARDITIS VIRUS INFECTIONS
Please refer to the following papers (and references therein) for examples of work on this
subject:
Koenen, F., Vanderhallen, H., Papadopoulos, O., Billinis, C., Paschaleri-Papadopoulou, E.,
Brocchi, E., De Simone, F., Carra, E. and Knowles, N.J. (1997). Comparison of the
pathogenic, antigenic and molecular characteristics of two encephalomyocarditis virus
(EMCV) isolates from Belgium and Greece. Research in Veterinary Science 62: 239-244.
Abstract: The pathogenicity of two porcine encephalomyocarditis virus (EMCV) isolates for sows in gestation
and young piglets was studied. One virus originated from a case of reproductive failure in pigs in Belgium and
the other from a case of acute myocarditis in pigs in Greece. Sows in the mid-gestation period and one- to
two-month old piglets were inoculated with each isolate. The molecular relationship between both isolates was
studied by determining the nucleotide sequence located across the junction of the 1C and 1D capsid-coding
genes. Antigenic analysis was performed using a panel of 35 monoclonal antibodies raised against an Italian
field isolate of EMCV. All three approaches revealed differences between both isolates and also confirmed that
there was no link between the two outbreaks of disease.
Knowles, N.J., Dickinson, N.D., Wilsden, G., Carra, E., Brocchi, E. and De Simone, F. (1998).
Molecular analysis of encephalomyocarditis viruses isolated from pigs and rodents in Italy.
Virus Research 57: 53-62.
Abstract: Partial nucleotide sequences of encephalomyocarditis (EMC) viruses isolated from five, apparently
independent, outbreaks of fatal myocarditis in pigs in Italy were compared with three EMC viruses isolated from
wild rodents from a different geographic region in the same country. These viruses were also compared with
EMC viruses isolated from pigs in other European countries and three historical strains. All the Italian EMC
viruses were closely related (> 94.6% nucleotide identity), but were distinct from viruses occurring in Belgium
in 1991 (< 80.5% nucleotide identity), Greece in 1990 (< 83.3% nucleotide identity) and the three older viruses
(<82.9% nucleotide identity). An EMC virus isolated from pigs in the Netherlands in 1988, was closely related
to the Italian viruses (95.3-99.3% nucleotide identity). It is suggested that pigs may play a role in the movement
of EMC viruses between different geographic regions.
Koenen, F., Vanderhallen, H., Dickinson, N.D. and Knowles, N.J. (1999). Phylogenetic analysis
of European encephalomyocarditis viruses: comparison of two genomic regions. Archives of
Virology, in press.
Abstract: The phylogenetic relationships of encephalomyocarditis (EMC) viruses isolated from pigs and rodents
in Europe were determined by comparison of nucleotide sequences from two different regions of the virus
genome, the VP3/VP1 gene junction (part of the capsid-coding region) and part of the 3D polymerase-coding
region. Thirty-five European EMC viruses could be divided into two genetic groups, one which contained viruses
from Greece isolated between 1986 and 1997 and from Belgium in 1991 and the other which contained viruses
from Italy (1986-1996), Cyprus (1994-1995), France (1995) and Belgium (1995-1996).
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 23
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Appendix I: Reagents for Acrylamide Gel Fractionation
10x TBE (Tris-borate-EDTA) buffer
432 g Tris base
220 g Boric acid
37.2 g EDTA
make up to 4 litres with water
titrate to pH 8.3 with conc. HCl
Store at room temperature.
40% stock acrylamide solution
380 g Acrylamide
20 g Bis-acrylamide
make up to 1 litre with water.
Stir with 20 g Amberlite MB-1, filter off, store at 4°C.
0.5x TBE gel mix
150 ml 40% stock acrylamide solution
50 ml 10x TBE
460 g urea
make up to 1 litre with water, store at 4°C.
Final preparation of acrylamide gel solution
For a 0.4 mm gel prepare:
50 ml 0.5x TBE gel solution
100 µl TEMED
100 µl 25% ammonium persulphate (AMPS; after adding AMPS gel sets in ~5-10 min).
Mix well.
For a 0.4-1.2mm wedge gel prepare:
125 ml 0.5x TBE gel solution
250 µl TEMED
250 µl 25% AMPS (after adding AMPS gel sets in ~5-10 min).
Mix well.
Commercially available Sequagel
80 ml gel solution
20 ml buffer solution
800 µl 10% AMPS (after adding AMPS gel sets in ~5-10 min).
Mix well.
Important note: the ambient temperature of the laboratory and the temperature used to store
reagents will affect the rapidity of gel polymerisation, i.e. it will proceed more rapidly at higher
temperatures. The amounts of gelling reagents (TEMED and AMPS) given above are for ambient
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 24
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
temperatures of approx. 20-22°C. For lower or higher temperature the amounts of AMPS and/or
TEMED may be lowered or raised, respectively. Any reagents which are stored at 4°C should be
allowed to equilibrate to ambient temperature before use. If you are unsure make up small
volumes of gel solution and add varying amounts of gelling reagents. The gel should not set in less
than 5 min and not take longer than 15 min.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 25
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Appendix II: Polymerase Chain Reaction Amplification and Cycle Sequencing of the 1D (VP1) Gene of Foot-and-Mouth
Disease Viruses. Paper presented at the Session of the Research Group of the Standing Technical Committee of the
European Commission for the Control of Foot-and-Mouth Disease, Vienna, Austria, 19-22 September, 1994.
POLYMERASE CHAIN REACTION AMPLIFICATION AND CYCLE SEQUENCING OF THE 1D
(VP1) GENE OF FOOT-AND-MOUTH DISEASE VIRUSES
N.J. Knowles and A.R. Samuel
World and Community Reference Laboratory for Foot-and-Mouth Disease, Institute for Animal Health, Pirbright
Laboratory, Ash Road, Pirbright, Woking, Surrey, GU24 0NF, United Kingdom.
Since 1987 the molecular epizootiology of foot-and-mouth disease (FMD) has largely been
based on the comparison of genetic distances between virus isolates. Many molecular
epizootiological studies have been published, or are awaiting publication, and include examples
of all seven FMDV serotypes, viz. type O (Beck and Strohmaier, 1987; Knowles et al., 1988;
Marquardt and Adam, 1989; Samuel et al., 1990a, b; Krebs et al., 1991; Armstrong et al., 1992;
Marquardt and Krebs, 1992; Samuel et al., 1993; Lin et al., unpublished data), type A (Weddell
et al., 1985; Beck and Strohmaier, 1987; Marquardt and Adam, 1988; Samuel et al., 1988;
Carrillo et al., 1990; Armstrong et al., 1992; Armstrong et al., 1994), type C (Martínez et al.,
1988; Piccone et al., 1988; Sobrino et al., 1989; Knowles and Samuel, 1990; Martínez et al.,
1992), type SAT 1 (Dawe et al., 1994; Knowles et al., unpublished data), type SAT 2 (Vosloo
et al., 1992; Knowles et al., unpublished data), type SAT 3 (Knowles et al., unpublished data)
and type Asia 1 (Ansell et al., 1994a, b). Most of the data used for molecular epizootiological
studies of FMD has been obtained by direct RNA sequencing (Knowles, 1990). This technique
has a number of drawbacks including the need to obtain a relatively large quality of good quality
viral RNA. The advent of polymerase chain reaction (PCR) amplification of reverse transcribed
virus RNA promised the possibility of obtaining sequence data from relatively small amounts of
RNA and without having to 'adapt' viruses to cell cultures. Determination of the nucleotide
sequences of cDNA PCR products has not been straight forward owing to their double-stranded
nature. However, recently a new sequencing technique has been developed - cycle sequencing.
This is based on the amplification of dideoxy-sequencing products using a thermostable
polymerase. This has two advantages, i) product extension takes place at a high temperature
(72°C), meaning the double-stranded nature of the cDNA is no longer a problem and ii) the
sequencing products themselves are amplified, meaning much less template cDNA is needed.
Oligonucleotide primers
We have developed four sets of oligonucleotide primers capable of amplifying the 1D (VP1)
coding region of most FMD virus isolates belonging to serotypes O, A, C and Asia 1. The viruses
sense (+) primers were designed using aligned 1C (VP3) sequences of the viruses shown in
Table 1. The design of antisense (-) primer NK61 was based on aligned sequences of the 2B gene
of types O, A, C and SAT 2 (data not shown). The internal sequencing primer, NK72, is identical
to the FMDV universal primer described by Beck and Strohmaier (1987) and is also the primer
used for most of the direct RNA sequencing studies in the laboratory. The locations of these
primers on the FMDV genome are shown in Fig. 1.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 26
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Table 1. Foot-and-mouth disease virus sequences used for primer design.
Virus
Accession no.*
Reference
O1/Campos/Brazil/58
M95781
Jensen and Moore, unpub.
O1/Kaufbeuren/FRG/66
X00871
Forss et al., 1984
O2/Brescia/Italy/47
M55287
Krebs et al., 1991
O/Syria/1/87
N/A†
Samuel et al., unpub.
A5/Spain/86
M72587
Saiz et al., 1991
A10/Holland/42
M20715-7
Thomas et al., 1988
A10/Argentina/61
X00429
Carroll et al., 1984
A12/119/UK/32
M10975
Robertson et al., 1985
A22/Iraq/24/64
N/A
Bolwell et al., 1989
A24/Cruzeiro/Brazil/55
N/A
Abrams, 1992
A32/Venezuela/70
N/A
Knowles et al., unpub.
C1/Germany/c.26
M90368
Martínez et al., 1992
C1/Oberbayern/FRG/60
X00130
Beck et al., 1983
C1/Santa Pau/Spain/70 (C-S8)
N/A
Sobrino et al., 1989
C1/Serra de Daró/Spain/81 (C-S15)
N/A
Sobrino et al., 1989
C2/Pando/Uruguay/44
M90367
Martínez et al., 1992
C3/Resende/Brazil/55
M90381
Martínez et al., 1992
C3/Indaial/Brazil/71
M90376
Martínez et al., 1992
C4/TDF/Argentina/66
M90372
Martínez et al., 1992
Asia 1/Pakistan/1/54
N/A
Ansell et al., unpub.
Asia 1/Tadzhikistan/USSR/64
N/A
Sosnovtsev et al., 1989
Asia 1/L83 (Lebanon)
U01207
Stram et al., 1994
Asia 1/Saudi Arabia/8/88
N/A
Woodbury et al., 1994
* EMBL/GenBank accession number
† not available
RNA preparation
Two methods were used i) phenol/chloroform extraction followed by cold ethanol precipitation
(Knowles, 1990) and ii) QIAamp spin columns (Qiagen). Viral RNA was extracted from either
i) 10% epithelium suspensions; ii) first passage in primary bovine thyroid cells; or iii) IB-RS-2 cell
culture adapted virus.
Reverse transcription
Primer NK61 was used with either AMV or MMLV RTase (Boehringer Mannheim) in a
standard RT reaction and extended for 30-60 min. at 42°C.
Polymerase chain-reaction amplification
The amplification cycles were preceded by heating the mix tube for 2 min. at 94°C and followed
by heating for 5 min. at 72°C. Optimal PCR conditions for each primer pair are shown in Table 2.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 27
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Table 2. Optimum PCR conditions for each primer set
Serotype
Primer pair
No. of
cycles
Denaturation
(94°C)
Annealing
Extension (72°C)
O
ARS4/NK61
30
1 min
45 sec at 60°C
2 min
A
A-1C562/NK61
30
1 min
1 min at 55°C
1.5 min
C
C-1C536/NK61
25
1 min
30 sec at 60°C
2 min
Asia 1
As1-1C505/NK61
30
1 min
1 min at 55°C
1.5 min
The sequences of the primers and product lengths, when used with NK61, are shown in
Table 3. A second primer located internally at the 1C (VP3) end of the product was sometimes
used for sequencing. Alternatively these primers could be used with NK61 if the first PCR
amplification was unsuccessful.
Table 3. Oligonucleotide primers used for RT-PCR and cycle sequencing of foot-and-mouth disease viruses
Primer designation*
Primer sequence (5' 6 3')
Product length (bp)†
Positive sense primers
O-1C124 (ARS4)
ACCAACCTCCTTGATGTGGCT
1301
O-1C564
AATTACACATGGCAAGGCCGACGG
861
O-1C609 (Ovp3)
TAGTGCTGGTAAAGACTTTGAGCT
816
A-1C562
TACCAAATTACACACGGGAA
863-866
A-1C612
TAGCGCCGGCAAAGACTTTGA
813-816
C-1C536
TACAGGGATGGGTCTGTGTGTACC
877-883
C-1C616
AAAGACTTTGAGCTCCGGCTACC
797-803
As1-1C505
TACACTGCTTCTGACGTGGC
908-914
As1-1C616
GGCAAGGACTTTGAGTTTCGC
797-803
Negative sense primers
FMD-2B58 (NK61)
GACATGTCCTCCTGCATCTG
FMD-2A34 (NK72)
GAAGGGCCCAGGGTTGGACTC
* the primer name is constructed from the FMDV serotype followed by the gene and in subscript the location within the gene
(alternative lab. name in parentheses). Universal FMD primers are designated FMD.
† when used in PCR with FMD-2B58 (NK61).
Post-PCR clean-up
Residual oligonucleotide primers, dNTPs and enzyme were removed using Wizard™ PCR Preps
(Promega) as per the manufacturer's protocol.
Cycle sequencing
Sequencing of part of the PCR fragments was performed using the fmol™ cycle sequencing kit
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 28
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
(Promega) employing 32P-end-labelled primers as per the manufacturers protocol. Primer NK72
was used for most of the sequencing although internal primers at the 1C (VP3) end of the product
were sometimes also used (Table 3).
Date analysis
The computer software previously described by Knowles (1990) has been rewritten to run on
IBM PC compatible microcomputers (the original programs ran on the Acorn Archimedes range).
Each function within the package (called SeqProgs) was written as a separate program using
either Power BASIC v.2.0a (Spectra Publishing) or Microsoft Professional BASIC v.7.01
(Microsoft). SeqProgs also interacts with various programs from the PHYLIP Phylogeny Package
v.3.5c (Felsenstein, 1993). Essentially, the nucleotide sequences are stored in a number of ASCII
(text) files (usually up to about 25 different sequences per file including a reference sequence);
these files have the suffix name ALN. Each sequence may have multiple gel readings listed
beneath a consensus sequence. The data input and deduction of consensus sequences is performed
’by hand’ using the MS-DOS editor. The program SPLIT can then be used to process the align
files resulting in the extraction of the individual sequences into ASCII files (filename suffix: SEQ)
and at the same time translate their amino acid sequences (filename suffix: PEP). Comparisons
between any sequences in the database are performed in two basic ways; i) the program
COMPARE processes a file containing a list of filenames (suffix: LST) and then compares each
sequence on the list to a single sequence chosen from the database (’query’ sequence) and
produces a sorted list, with those most closely related to the ’query’ sequence being at the top
(filename suffix: CMP); ii) the program LINEUP also takes a list of filenames but then compares
each sequence with every other sequence on the list producing a matrix file which can be used as
the input file for programs within the PHYLIP package. Presently the programs KITSCH, FITCH
and NEIGHBOR are used to calculate the phylogenetic trees; the latter program also includes the
UPGMA method as an option.
In the future it is planned to introduce new programs into the package to interact with other
PHYLIP programs (e.g. DNADIST which produces distance matrices based on a number of
different weighting methods) and with CLUSTAL V (Higgins et al., 1991) which can perform
single and multiple sequence alignments.
Results
Examples of PCR amplification products from FMDV types O, A, C and Asia 1 are shown in
Fig. 2. The PCR amplification was not always successful, although those proving negative could
usually be amplified by using more RNA, more first strand cDNA or using a different RNA
preparation. The sensitivity of the PCR has not been explored, however, it is not designed as a
diagnostic PCR and it must be capable of amplifying as many different virus isolates as possible.
For similar reason the PCR is also not type specific and, for example, some type O’s may be
amplified by the type A primer set.
This assay was successfully employed in the epidemiological investigations of the recent
outbreaks of FMD type O in Greece. The PCR was carried out on seven samples (six 10%
epithelium suspensions and one blood sample) received by the WRL in July 1994. These all
proved negative (they were also negative in the typing ELISA). However, following isolation of
virus on BTy cells from five of the samples, the PCR was carried out again and products were
obtained. These were sequenced as described above and the results were obtained within 48
hours. The comparison of the Greek virus isolates and some other type O virus is shown in Fig. 3.
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 29
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Acknowledgements
We would like to thank J.S. Thevasagayam and Lin Fengsheng who participated in this work
while visiting this laboratory and D.M. Ansell and K.V. Marchant for valuable technical
assistance.
References
Abrams, C. (1992). The biosynthesis of foot-andmouth disease virus empty capsids. Ph. D. Thesis,
University of Reading.
Ansell, D.M., Samuel, A.R., Carpenter, W.C. and
Knowles, N.J. (1994a). Genetic relationships
between foot-and-mouth disease type Asia 1
viruses. Epidemiology and Infection 112: 213-224.
Ansell, D.M., Samuel, A.R. and Knowles, N.J.
(1994b). Molecular epizootiology of foot-andmouth disease type Asia 1. Report of the Session of
the Research Group of the Standing Technical
Committee of the European Commission for the
Control of Foot-and-Mouth Disease, Vienna,
Austria, 19-22 September, 1994.
Ansell, D.M., Clarke, B.E., Samuel, A.R. and
Knowles, N.J. The capsid-coding sequence of footand-mouth disease virus type Asia 1. Unpublished.
Armstrong, R.M., Samuel, A.R., Knowles, N.J. and
Uluturk, S. (1992). Genetic studies on foot-andmouth disease viruses isolated from samples
collected in Turkey. Report of the Session of the
Research Group of the Standing Technical
Committee of the European Commission for the
Control of Foot-and-Mouth Disease, Berne,
Switzerland. Rome: FAO, 1992.
Armstrong, R.M., Samuel, A.R., Carpenter, W.C.,
Rama Kant and Knowles, N.J. (1994). A
comparative study of serological and biochemical
methods
for
strain
differentiation
of
foot-and-mouth disease type A viruses. Veterinary
Microbiology 39: 285-298.
Beck, E. and Strohmaier, K. (1987). Subtyping of
European foot-and-mouth disease virus strains by
nucleotide sequence determination. Journal of
Virology 61: 1621-9.
Beck, E., Forss, S., Strebel, K., Cattaneo, R. and Feil,
G. (1983). Structure of the FMDV translation
initiation site and of the structural proteins.
Nucleic Acids Research 11: 7873-7885.
PROTOCOL.WPD
Bolwell, C., Brown, A.L., Barnett, P.V., Campbell,
R.O., Clarke, B.E., Parry, N.R., Ouldridge, E.J.,
Brown, F. and Rowlands, D.J. (1989). Host cell
selection of antigenic variants of foot-and-mouth
disease virus. Journal of General Virology 70: 4557.
Carrillo, C., Dopazo, J., Moya, A., Gonzalez, M.,
Martínez, M.A., Saiz, J.C. and Sobrino, F. (1990).
Comparison of vaccine strains and the virus
causing the 1986 foot-and-mouth disease outbreak
in Spain: epizootiological analysis. Virus Research
15: 45-56.
Carroll, A.R., Rowlands, D.J. and Clarke, B.E. (1984).
The complete nucleotide sequence of the RNA
coding for the primary translation product of foot
and mouth disease virus. Nucleic Acids Research
12: 2461-2472.
Dawe, P.S., Flanagan, F.O, Madekurozwa, R.L.,
Sorensen, K.J., Anderson, E.C., Foggin, C.M.,
Ferris, N.P. and Knowles, N.J. (1994). Natural
transmission of foot-and-mouth disease virus from
African buffalo (Syncerus caffer) to cattle in a
wildlife area of Zimbabwe. Veterinary Record 134:
230-232.
Felsenstein, J. (1993). PHYLIP (Phylogeny Inference
Package) version 3.5c. Distributed by the author.
Department of Genetics, University of Washington,
Seattle.
Forss, S., Strebel, K., Beck, E. and Schaller, H.
(1984). Nucleotide sequence and genome
organization of foot-and-mouth disease virus.
Nucleic Acids Research 12: 6587-6601.
Higgins, D.G. Bleasby, A.J. and Fuchs, R. (1992).
CLUSTAL V: improved software for multiple
sequence alignment. Computer Applications in the
Biosciences 8: 189-191.
Jensen, M.J. and Moore, D.M. The nucleotide
sequence of the untranslated region, L and P1
regions of the foot-and-mouth disease virus
WRL-FMD: Molecular Epidemiology Group
Page 30
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
serotype O1 Campos. Unpublished.
Knowles, N.J. (1990). A method for direct nucleotide
sequencing of foot-and-mouth disease virus RNA
for epidemiological studies. Report of the Session
of the Research Group of the Standing Technical
Committee of the European Commission for the
Control of Foot-and-Mouth Disease, Lindholm,
Denmark, 25-29 June, 1990, Appendix 06-112.
Rome: FAO.
Knowles, N.J. and Samuel, A.R. (1990). Molecular
and antigenic analysis of foot-and-mouth disease
type C viruses isolated from outbreaks in Italy
during 1988 and 1989. Report of the Session of the
Research Group of the Standing Technical
Committee of the European Commission for the
Control of Foot-and-Mouth Disease, Lindholm,
Denmark. Rome: FAO, 1990 : pp.122-8.
Knowles, N.J., Marquardt, O. and Samuel, A.R.
(1988). Antigenic and molecular characterization
of isolates from recent outbreaks of foot-and-mouth
disease virus in the Federal Republic of Germany.
Report of the Session of the Research Group of the
Standing Technical Committee of the European
Commission for the Control of Foot-and-Mouth
Disease, Prague, Czechoslovakia. Rome: FAO,
1988: pp.149-55.
Krebs, O., Berger, H.-G. and Marquardt, O. (1991).
The capsid protein-coding sequence of foot-andmouth disease virus O2 Brescia. Archives of
Virology 120: 135-143.
Krebs, O., Berger. H,-G., Niedbalski, W. and
Marquardt, O. (1991). Foot-and-mouth disease
virus O1 Lombardy is biochemically related to O2
isolates. Virus Genes 5: 255-66.
Marquardt, O. and Adam, K.-H. (1988). Sequences of
capsid protein VP1 of two type A foot-and-mouth
disease viruses. Virus Genes 2: 283-91.
N.J. Knowles & A.R. Samuel
Tierarztliche Umschau 47: 137-40.
Martínez, M.A., Carrillo, C., Plana, J., Mascarella, R.,
Bergada, J., Palma, E.L., Domingo, E. and
Sobrino, F. (1988). Genetic and immunogenic
variations among closely related isolates of
foot-and-mouth disease virus. Gene 62: 75-84.
Martínez, M.A., Dopazo, J., Hernández, J., Mateu,
M.G., Sobrino, F., Domingo, E. and Knowles, N.J.
(1992). Evolution of the capsid protein genes of
foot-and-mouth disease virus. Antigenic variation
without accumulation of amino acid substitutions
over six decades. Journal of Virology 66: 35573565.
Piccone, M.E., Kaplan, G., Giavedoni, L., Domingo,
E. and Palma, E.L. (1988). VP1 of serotype C
foot-and-mouth disease viruses: long-term
conservation of sequences. Journal of Virology 62:
1469-73.
Robertson, B.H., Grubman, M.J., Weddell, G.N.,
Moore, D.M., Welsh, J.D., Fischer, T., Dowbenko,
D.J., Yansura, D.G., Small, B. and Kleid, D.G.
(1985). Nucleotide and amino acid sequence
coding for polypeptides of foot-and-mouth disease
virus type A12. Journal of Virology 54: 651-660.
Saiz, J.C., Gonzalez, M.J., Borca, M.V., Sobrino, F.
and Moore, D.M. (1991). Identification of
neutralizing antigenic sites on VP1 and VP2 of
type A5 foot-and-mouth disease virus, defined by
neutralization resistant variants. Journal of
Virology 65: 2518-2524.
Samuel, A.R., Knowles, N.J. and Kitching, R.P.
(1988). Serological and biochemical analysis of
some recent type A foot-and-mouth disease virus
isolates from the Middle East. Epidemiology and
Infection 101: 577-90.
Marquardt, O. and Adam, K.-H. (1990). FMDV
subtyping by sequencing VP1 genes. Advances in
Veterinary Virology: Proceedings of the 1st
Congress of the European Society for Veterinary
Virology, Liege, 1989. Veterinary Microbiology
23: 175-83.
Samuel, A.R., Knowles, N.J. and Kitching, R.P.
(1990a). Preliminary molecular analysis of footand-mouth disease virus type O in the Middle East.
Report of the Session of the Research Group of the
Standing Technical Committee of the European
Commission for the Control of Foot-and-Mouth
Disease, Lindholm, Denmark. Rome: FAO, 1990
: pp.133-8.
Marquardt, O. and Krebs, O. (1992). Outbreaks of
foot-and-mouth disease near Hannover in 1987 and
1989: evidence for two strains of virus.
Samuel, A.R., Knowles, N.J. and Kitching, R.P.
(1990b). Preliminary antigenic and molecular
analysis of strains of foot-and-mouth disease virus
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 31
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
serotype O isolated from Saudi Arabia in 1988 and
1989. Report of the Session of the Research Group
of the Standing Technical Committee of the
European Commission for the Control of Foot-andMouth Disease, Lindholm, Denmark. Rome: FAO,
1990 : pp.139-45.
N.J. Knowles & A.R. Samuel
S.M. and Kitching, R.P. (1994). Analysis of mixed
foot-and-mouth disease virus infections in Saudi
Arabia: prolonged circulation of an exotic serotype.
Epidemiology and Infection 112: 201-211.
Samuel, A.R., Ansell, D.M., Rendle, R.T., Armstrong,
R.M., Davidson, F.L., Knowles, N.J. and Kitching,
R.P. (1993). Field and laboratory analysis of an
outbreak of foot-and-mouth disease in Bulgaria in
1991. Revue scientifique et technique de l’Office
International des Epizooties 12: 839-848.
Sobrino, F., Martínez, M.A., Carrillo, C. and Beck, E.
(1989). Antigenic variation of foot-and-mouth
disease virus of serotype C during propagation in
the field is mainly restricted to only one structural
protein (VP1). Virus Research 14: 273-280.
Sosnovtsev, S.V., Onishchenko, A.M., Petrov, N.A.,
Mamaeva,
N.V.,
Kalashnikova,
T.I.,
Perevozchikova, N.A., Ivanyushchenkov, V.N.,
Burdov, A.N. and Vasilenko, S.K. (1989). Primary
structure of the gene of the VP1 protein of
epidemic stomatitis virus of Asia 1 serotype.
Molekulyarnaya Genetika, Mikrobiologiya i
Virusologiya 12: 44-46.
Stram, Y., Laor, O., Molad, T., Chai, D., Moore, D.,
Yadin, H. and Becker, Y. (1994). Nucleotide
sequence of the P1 region of serotype Asia 1
foot-and-mouth disease virus. Virus Genes 8: 275278.
Thomas, A.A.M., Woortmeijer, R.J., Puijk, W. and
Barteling, S.J. (1988). Antigenic sites on
foot-and-mouth disease virus type A10. Journal of
Virology 62: 2782-2789.
Vosloo, W., Knowles, N.J. and Thomson, G.R. (1992).
Genetic relationships between southern African
SAT-2 isolates of foot-and-mouth disease virus.
Epidemiology and Infection 109: 547-58.
Weddell, G.N., Yansura, D.G., Dowbenko, D.J.,
Hoatlin, M.E., Grubman, M.J., Moore, D.M. and
Kleid, D.G. (1985). Sequence variation in the gene
for the immunogenic capsid protein VP1 of
foot-and-mouth disease virus type A. Proceedings
of the National Academy of Sciences USA 82:
2618-22.
Woodbury, E.L., Samuel, A.R., Knowles, N.J., Hafez,
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 32
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
pO-1C609
pO-1C564
pNK72 pNK61
pARS4
Type O
pA-1C616
pNK72 pNK61
pA-1C562
Type A
pC-1C616
pC-1C536
Type C
pNK72 pNK61
pAs1-1C616
pNK72 pNK61
pAs1-1C505
Type Asia 1
Poly(C)
VPg
L
0
1A
1
1B
1C
2
1D
2
A
3
2B
3A
2C
4
3B
5
3C
AAAAAAAAAn
3D
6
7
8
Kilobases
Fig. 1. Foot-and-mouth disease virus genome map and PCR/sequencing primer locations
Markers
A/SAU/2/94
A/SAU/8/94
A/SAU/14/94
A/SAU/16/94
A/SAU/18/94
A/SAU/21/94
A/SAU/24/94
A10/Arg/61
A12/119/UK/32
Markers
A/BRA/3/93
A/BRA/5/93
A24/Cruzeiro/BRA/55
Markers
Markers
O/EGY/2/93
O/EGY/3/93
FMDV type A
O/EGY/1/93
O/EGY/2/89
O/JOR/6/93
O/JOR/5/93
O/JOR/3/93
O/SAU/31/92
O/SAU/1/92
Markers
FMDV type O
A-1C562/NK61
product (~866 bp)
ARS4/NK61
product (1301 bp)
C-1C536/NK61
product (~911 bp)
Markers
Asia1/NEP/19/86
Asia1/AFG/5/72
Asia1/WBN/117/85
Asia1/CAM/1/90
Asia1/WBN/117/85
Asia1/NEP/1/85
Asia1/CAM/1/90
Asia1/MAY/13/92
Asia1/ISR/1/84
Asia1/TUR/15/73
Asia1/MAY/2/90
Asia1/KUW/2/79
Asia1/IND/12/76
Markers
C/PHI/10/89
C/BAN/1/92
C/IND/12/82
C/IND/7/76
Markers
C/PHI/3/90
C/IND/4/71
C/PHI/9/76
C/IND/3/83
Asia1/YEM/15/79
FMDV Asia 1
FMDV type C
AS1-1C505/NK61
product (~911 bp)
Fig. 2. Examples of PCR products of FMD viruses using conserved primer sets
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 33
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
O1/Kaufbeuren/FRG/66
O/Greece/1/94
O/Bulgaria/1/93
Bulgaria 1991 & 1993
O/Turkey/20/91
O/Saudi Arabia/35/90
O/Saudi Arabia/29/93
O/Egypt/1/93
OA/Saudi Arabia/34/92
O/Bulgaria/1/91
O/Egypt/4/93
O/Turkey/6/93
O/Bahrain/4/93
O/Israel/1/91
O/Jordan/6/93
O/Jordan/1/94
Greece 1994
O/Jordan/2/94
O/Iran/10/93
O/Saudi Arabia/45/94
O/Saudi Arabia/17/94
O/Israel/6/89
O/Jordan/1/89
O/Syria/1/89
O/Bahrain/9/88
O/Kuwait/3/88
O/Jordan/1/88
O/Turkey/5/90
O/Turkey/21/90
O/Syria/1/91
O/Saudi Arabia/3/91
O/Saudi Arabia/8/88
O/Saudi Arabia/3/89
O/Saudi Arabia/33/88
O/Israel/1/88
O/Saudi Arabia/7/91
O/Saudi Arabia/26/90
O/Italy/1/93
O/Italy/2/93
O/Italy/5/93
O/Italy/6/93
O/Israel/1/92
Italy 1993
O/Israel/3/92
O/Oman/3/91
O/Oman/54/91
O/Oman/58/91
O/Bahrain/2/91
18
16
14
12
10
8
6
4
2
0
Percentage nucleotide difference (positions 475-639 of VP1)
Fig. 3. Nucleotide sequence relationships between FMD type O viruses which caused recent outbreaks in Europe and the Middle East
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 34
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
Appendix III: Recent Developments in the Epidemiology of Foot-and-Mouth Disease: Genetic Relationships Determined by Nucleotide
Sequence Analysis. Paper published in: Foot-and-Mouth Disease Newsletter 1 (2): 13-19 (1994).
Recent Developments in the Epidemiology of Foot-and-Mouth Disease:
Genetic Relationships Determined by Nucleotide Sequence Analysis
N.J. Knowles and A.R. Samuel
World and Community Reference Laboratory for Foot-and-Mouth Disease,
AFRC Institute for Animal Health, Pirbright Laboratory, Ash Road,
Pirbright, Woking, Surrey, GU24 0NF, United Kingdom.
The advent of nucleotide sequence analysis has revolutionized the study of the epidemiology of virus
infections. This technique has been used at the World Reference Laboratory (WRL) for Foot-and-Mouth
Disease (FMD) since the end of 1987. The sequence database which has been generated has also been of
great value to the Community Reference Laboratory (CRL) for FMD enabling the rapid identification of
the likely origins of the last three FMD outbreaks in Europe.
In July 1991, FMD type O appeared in Bulgaria and sequence comparisons eliminated the possibilities
of either a laboratory escape of the virus or improperly inactivated vaccine. Furthermore genetically related
type O viruses were found in the Middle East suggesting that locality as a probable origin (Samuel et al.,
1993).
In February 1993, FMD type O appeared in Southern Italy where it spread rapidly (Kitching, 1993). In
the following month the disease appeared in Northern Italy, but was limited to two premises. Nucleotide
sequence analysis again suggested the Middle East as an origin and additionally showed the virus responsible to be different from the earlier outbreak in Bulgaria. This analysis also confirmed that the outbreaks
in Southern and Northern Italy were caused by the same virus (N.J. Knowles and A.R. Samuel,
unpublished data; Kitching, 1993).
Subsequently, in 1993, FMD type O again appeared in Bulgaria. Comparison with the earlier nucleotide
sequences showed that the virus was identical to that causing the 1991 outbreak in Bulgaria (A.R. Samuel
and N.J. Knowles, unpublished data; see front cover).
In the WRL and CRL there are currently many different sequencing studies in progress aimed at
elucidating the epidemiology of all seven serotypes of FMD. Some of these studies have been, or are about
to be, published; we present here a resume of that work.
FMD virus type O
Further isolates of FMD virus type O have been examined from countries in the Middle East and North
Africa. Virus isolates from Egypt and Jordan in 1993 are genetically related to a group of viruses that
include isolates from Turkey in 1987, 1988 and 1991, Syria in 1987, Saudi Arabia in 1990, Bahrain in
1992, Iran in 1993 and Bulgaria in 1991 and 1993 (Fig. 1). The Egyptian isolates from 1993 are not
closely related to the virus which caused epizootics in North Africa between 1989 and 1991 (Fig. 1).
FMD virus type A
Three serological and three biochemical methods have used to compare five field isolates of FMD virus
from Western India with nine reference vaccine strains and five field isolates from other countries
(Armstrong et al., 1994).
The serological tests (liquid-phase ELISA and virus neutralization) were able to distinguish between the
three reference vaccine strains examined, however, generally the five recent Indian field isolates reacted
poorly with these vaccine strains. Analysis of monoclonal antibody (MAb) data was difficult to interpret
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 35
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
although generally the field isolate A/IND/5/87 reacted to a lesser extent with one of the MAb panels
(A10/Holland/42) than the other four recent Indian isolates. The A22/Iraq/24/64 MAbs were generally less
reactive, only reacting significantly with one of the reference vaccine strains.
Polyacrylamide gel electrophoresis distinguished the reference vaccine strains from each other and from
the field isolates. Additionally, one of the Indian isolates (A/IND/5/87) could be differentiated from the
other four. Electrofocusing showed similarities between the reference vaccine strain A22/Iraq/24/64 and
three of the Indian field isolates (A/IND/1/87, A/IND/2/87 and A/IND/3/87), however, A/IND/4/87 and
A/IND/5/87 were distinct. Nucleotide sequencing showed that the isolates A/IND/1/87, A/IND/2/87 and
A/IND/3/87 were very closely related to each other and related to A/IND/4/87, however, A/IND/5/87 was
different.
Foot-and-mouth disease type O is enzootic in Saudi Arabia, but type A only occurs occasionally. In
1986-87 type A appeared after an absence of 10 years (a single isolation of type A was made in imported
stock for slaughter at an abattoir in 1984). Sequence analysis showed the virus responsible to be related,
although not closely, to type A viruses from North-western India (Samuel et al., 1988; Fig. 2). The virus
was eradicated following vaccination using one of the outbreak viruses (A/SAU/23/86). Type A viruses
next appeared in Saudi Arabia in 1991 and, despite vaccination, continues to cause outbreaks. Sequence
analysis has shown that the 1991-93 Saudi Arabian type A viruses are very different to those causing the
1986-87 outbreaks but are closely related to viruses circulating in Turkey between 1991-92 (Fig. 2).
FMD virus type Asia 1
Ansell et al. (1994) determined the sequence of 165 nucleotides at the 3N end of the 1D (VP1) gene of
44 type Asia 1 FMD viruses. These strains had been isolated from throughout Asia between 1954-92.
Analysis of the relationships between the virus genomes showed epidemiological links not previously
evident, for example, between Bangladesh and Kuwait (Fig. 3).
The origin of the only outbreak of FMD Asia 1 to have occurred in Europe, in Greece in 1984, was
clarified; the nucleotide sequence of this virus was closely related to the sequences of viruses present in
Israel, Lebanon and Bahrain between 1983-85.
Variation in the region sequenced was not as great as that seen in the other FMD virus serotypes and all
viruses shared greater than 85% nucleotide identity. Thus they considered all the virus isolates examined
to belong to a single genotype.
The above study was performed by directly sequencing FMD virus RNA (Knowles, 1990) and further
studies are in progress using reverse transcription-polymerase chain reaction (RT-PCR) and cycle
sequencing to examine a wider range of Asia 1 isolates.
In another study (Woodbury et al., 1994) plaque purification of FMD type O viruses isolated from cattle
in Saudi Arabia showed the presence of mixed serotype infections. Sixteen out of 31 samples collected
between 1985 and 1991 also contained Asia 1 virus, a serotype which had previously only been isolated
from a single outbreak in that country in 1980. Nucleotide sequences of the Asia 1 component of all these
samples revealed little variation and showed that they were closely related to both a Russian lapinized
vaccine virus strain (Asia 1/Tadzhikistan/64), and to a field isolate from Turkey (Asia 1/TUR/15/73).
Although mixed FMD infections have been observed previously this is the first report of a serotype, considered to be exotic to a country, co-existing undetected for an extended period of time.
Buffalo to cattle transmission of FMD virus
Two recent studies (Dawe et al., 1994a,b) have demonstrated, in one case, the experimental transmission
of FMD virus type SAT 2 from African buffalo (Syncerus caffer) to cattle and in the other a case of
PROTOCOL.WPD
WRL-FMD: Molecular Epidemiology Group
Page 36
RT-PCR and Sequencing Protocols for the Molecular Epidemiology of Exotic Virus Diseases of Animals
N.J. Knowles & A.R. Samuel
natural transmission of type SAT 1 from African buffalo to cattle. Nucleotide sequencing played a key role
in determining the origin of the viruses in both cases.
Four female cattle and three male African buffalo which were free of FMD virus were held together on
an island in Lake Kariba, Zimbabwe. The buffalo were experimentally infected with FMD virus type
SAT 2, showed generalised disease and became virus carriers. While the buffalo were in the acute phase
of disease the susceptible contact cattle did not show lesions, no virus was recovered from them nor did
they develop serum antibodies. However, five months later the cattle showed severe FMD. Direct nucleotide
sequencing of the virus used to infect the buffalo and of the virus from the in-contact cattle showed that
the two isolates were almost identical. The results suggest that in nature it is possible for transmission from
buffalo to cattle to occur under the influence of factors not yet defined and that there was very little change
in the nucleotide sequence of the virus during the carrier period of five months.
An outbreak of FMD occurred during April, 1991 in a trypanosomiasis sentinel cattle herd in the Rifa
River area of the Hurungwe hunting blocks, to the east of Lake Kariba in Zimbabwe (Dawe et al., 1994a).
Despite having been vaccinated bi-annually for the previous five years the disease was severe. Viruses
isolated from the affected animals were typed as FMD virus type SAT 1. Free-living African buffalo which
had been using the same watering place as the affected cattle were sampled and FMD type SAT 1 virus
was isolated. Partial nucleotide sequencing of the gene coding for the capsid protein 1D was performed for
one of the viruses isolated from cattle and for two of the viruses isolated from buffalo. Comparison of these
sequences demonstrated a close relationship between all three virus isolates. Since no other cattle were
present in this area and no SAT 1 outbreaks had occurred in Zimbabwe since 1989, it was concluded that
transmission from buffalo to cattle had taken place.
References
Ansell, D.M., Samuel, A.R., Carpenter, W.C. and
Knowles, N.J. (1994). Genetic relationships between
foot-and-mouth disease type Asia 1 viruses. Epidemiology and Infection 112: 213-224.
Armstrong, R.M., Samuel, A.R., Carpenter, W.C.,
Rama Kant and Knowles, N.J. (1994). A comparative study of serological and biochemical methods
for strain differentiation of foot-and-mouth disease
type A viruses. Veterinary Microbiology 39: 285298.
Dawe, P.S., Flanagan, F.O, Madekurozwa, R.L.,
Sorensen, K.J., Anderson, E.C., Foggin, C.M.,
Ferris, N.P. and Knowles, N.J. (1994). Natural
transmission of foot-and-mouth disease virus from
African buffalo (Syncerus caffer) to cattle in a
wildlife area of Zimbabwe. Veterinary Record 134:
230-232.
Dawe, P.S., Sorensen, K.J., Ferris, N.P., Barnett,
I.T.R., Armstrong, R.M. and Knowles, N.J. (1994).
Experimental transmission of foot-and-mouth
disease virus from carrier African buffalo (Syncerus
caffer) to cattle in Zimbabwe. Veterinary Record
134: 211-215.
Kitching, R.P. (1993). Foot and mouth disease in
Italy. Community Reference Laboratory Newsletter
PROTOCOL.WPD
1 (1): 3-5.
Knowles, N.J. (1990). A method for direct nucleotide
sequencing of foot-and-mouth disease virus RNA for
epidemiological studies. Report of the Session of the
Research Group of the Standing Technical Committee of the European Commission for the Control of
Foot-and-Mouth Disease, Lindholm, Denmark, 2529 June, 1990, Appendix 06-112. Rome: FAO.
Samuel, A.R., Knowles, N.J. and Kitching, R.P.
(1988). Serological and biochemical analysis of
some recent type A foot-and-mouth disease virus
isolates from the Middle East. Epidemiology and
Infection 101: 577-590.
Samuel, A.R., Ansell, D.M., Rendle, R.T., Armstrong,
R.M., Davidson, F.L., Knowles, N.J. and Kitching,
R.P. (1993). Field and laboratory analysis of an
outbreak of foot-and-mouth disease in Bulgaria in
1991. Revue scientifique et technique de l’Office
International des Epizooties 12: 839-848.
Woodbury, E.L., Samuel, A.R., Knowles, N.J., Hafez,
S.M. and Kitching, R.P. (1994). Analysis of mixed
foot-and-mouth disease virus infections in Saudi
Arabia: prolonged circulation of an exotic serotype.
Epidemiology and Infection 112: 201-211.
WRL-FMD: Molecular Epidemiology Group
Page 37