Download Defective forms of cotton leaf curl virus DNA

Journal
of General Virology (1998), 79, 1501–1508. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Defective forms of cotton leaf curl virus DNA-A that have
different combinations of sequence deletion, duplication,
inversion and rearrangement
Yule Liu,1, 2 David J. Robinson1 and Bryan D. Harrison1
1
2
Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK
Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, China
Tobacco and tomato plants inoculated at least 9
months previously with a Pakistani isolate of cotton
leaf curl virus (CLCuV-PK), a whitefly-transmitted
geminivirus, contained substantial amounts of circular dsDNA molecules that were mostly about half
the size of CLCuV-PK dsDNA-A. They appeared to be
derived from CLCuV-PK DNA-A by various combinations of sequence deletion, duplication, inversion
and rearrangement and, in a few instances,
insertion of sequences of unknown origin. Each of
ten tobacco plants contained a different predominant form of such a defective molecule ; however, all
Introduction
Whitefly-transmitted geminiviruses in the genus Begomovirus have genomes consisting typically of two molecules of
circular single-stranded DNA (DNA-A and DNA-B), each of
about 2±8 kb (reviewed by Lazarowitz, 1992). However, the
genomes of a few begomoviruses, such as an Israeli isolate of
tomato yellow leaf curl virus (Navot et al., 1991), consist of
only one molecule, which is equivalent to DNA-A. Cotton leaf
curl virus (CLCuV-PK) is a begomovirus that has caused recent
severe disease epidemics in cotton crops in Pakistan (Mansoor
et al., 1993 ; Hameed et al., 1994). DNA-A-like molecules of this
virus have been sequenced (Nadeem, 1995 ; Zhou et al., 1998)
but no evidence for a DNA-B molecule has been reported. In
the first step of a procedure to test plant extracts for the
possible presence of a DNA-B, we conducted PCR with
primers based on sequences in the large intergenic region of
CLCuV-PK DNA-A (the region that in other begomoviruses is
Author for correspondence : Bryan D. Harrison.
Fax ­44 1382 562426. e-mail djrobi!scri.sari.ac.uk
The EMBL accession numbers of the sequences reported in this paper
are AJ222703 to AJ222707 inclusive.
the forms contained the intergenic region and part
of the AC1 (Rep) gene. Some of the forms contained
novel open reading frames and might have a role in
the evolution of variant geminiviruses. The defective
components were not detected at 3 months after
the original culture of CLCuV-PK was transmitted by
whiteflies (Bemisia tabaci) from cotton to tomato
but were present after a further 6 months. They
were transmitted, along with full-length DNA-A,
between tobacco and tomato plants by grafting and
by B. tabaci.
shared by DNA-A and DNA-B molecules) to amplify nearly
full-length DNA-A and, if present, DNA-B. However, in many
of the trials, the main product was about half the expected size.
The work described in this paper shows that the sequences
amplified are from a series of molecules apparently derived
from DNA-A of CLCuV-PK by deletion in combination with
various other changes.
Methods
+ Virus sources and propagation. Virus isolates were derived
from the CLCuV-PK stock culture (Harrison et al., 1997), which had been
transmitted by whiteflies (B. tabaci) from cotton to tobacco (Nicotiana
tabacum cv. Samsun NN) plants in late 1993. These tobacco plants were
retained for up to 3 years and were cut back at intervals to encourage the
growth of new shoots. In addition, isolates were subcultured in tobacco
and tomato (Lycopersicon esculentum) plants inoculated by grafting, or by
B. tabaci using the procedure of McGrath & Harrison (1995). Infected
plants were kept at 20–30 °C in a containment glasshouse at SCRI under
licence from the Scottish Office Agriculture, Environment and Fisheries
Department.
+ PCR. Nucleic acids were extracted from plant leaves and amplified by
PCR, as described by Harrison et al. (1997), with primers based on the
nucleotide sequence of DNA-A (2725 nt) of an isolate of CLCuV-PK
(Nadeem, 1995). Four of the primers were used by Harrison et al. (1997) :
0001-5405 # 1998 SGM
BFAB
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 02 Aug 2017 07:43:57
Y. Liu, D. J. Robinson and B. D. Harrison
CL1 (nt 208–226), CL3a (complementary to nt 998–980), CL4 (nt
1169–1190) and CL8 (complementary to nt 1963–1942). Nucleotides are
numbered from the origin of replication in the intergenic region. In
addition, two new primers were used :
CL104 : 5« AACGCTCCCGCACACTATAAGTAC 3« (24 nt) (nt
67–90)
CL105b : 5« TGGCCGCTTTTTGGAGCGT 3« (19 nt) (complementary to nt 2712–2694).
PCR products were analysed by electrophoresis in agarose gels or,
after digestion with restriction endonuclease, in polyacrylamide gels
(Deng et al., 1994).
+ Southern blot hybridization. Nucleic acids were extracted from
leaves by method B of Harrison et al. (1997), fractionated by
electrophoresis in 1 % agarose gels and transferred to nylon membranes
by the capillary method (Sambrook et al., 1989). The probe consisted of
cloned DNA representing the sequences between the EcoRV site at
residue 297 and the BglII site at residue 2449 of CLCuV-PK DNA-A
(Nadeem, 1995) and was labelled with $#P by random priming. Prehybridization and hybridization were done in a solution containing
0±9 M NaCl, 0±075 M trisodium citrate, 1 % blocking reagent (Boehringer
Mannheim), 0±1 M maleic acid, 0±1 % N-lauroylsarcosine and 0±02 % SDS,
pH 7±5, at 65 °C, and membranes were washed four times in 2¬
SSC­0±1 % SDS at 65 °C before autoradiography.
+ Sequence determination and analysis. PCR products were
either sequenced directly or cloned and sequenced as described by Zhou
et al. (1997). Sequence data were assembled and analysed with the aid of
the Wisconsin Package version 8.1 programs (Anon., 1994).
Results
Small DNA molecules in CLCuV-PK-infected tobacco
plants
Primers CL104 and CL105b were designed to amplify
almost the whole sequence of CLCuV-PK DNA-A, or DNA-B
if present, except for about 80 residues of the intergenic region,
to give a 2±6–2±7 kbp product. The first evidence for the
occurrence of unexpected DNA molecules in CLCuV-PKinfected plants was obtained when DNA from a tobacco plant
(plant 0) that had been inoculated with CLCuV-PK about 2
years earlier was amplified with these primers and a product of
only 1±4 kbp was consistently obtained. When similar tests
were done on ten other tobacco plants (plants 1 to 10) that had
been infected for comparable lengths of time, all yielded
unexpectedly short products of 1±4 kbp, although in some
instances (lanes 2 and 4 in Fig. 1 a) the bands were too weak to
reproduce photographically. Some plants also gave products
of 0±9 kbp (Fig. 1 a ; Table 1). No 2±6 kbp product was detected
from any of these plants, although all yielded the expected
0±8 kbp products (Harrison et al., 1997) with primer pairs CL1
and CL3a or CL4 and CL8 (Table 1). Moreover, a 2±6 kbp
product was obtained in PCR with primers CL104 and CL105b
from each of five tomato plants 3 months after inoculation with
CLCuV-PK by whiteflies (Table 1). Although all the 1±4 kbp
products were of similar size, those from each source plant
gave a different pattern of fragments when digested with
restriction endonucleases ; for example, Fig. 1 (b) shows the
fragments obtained by digestion with AluI. Notably, the sizes
BFAC
(a)
1
2
3
4
5 6
7 8
9 10 H
1·4 kbp
0·9 kbp
(b)
1 2
3 4
5 6
7 8
9 10
1·0 kbp
0·5 kbp
0·3 kbp
0·15 kbp
Fig. 1. (a) Agarose gel electrophoresis of PCR products amplified with
primers CL104 and CL105b from extracts of tobacco plants 1–10,
chronically infected with CLCuV-PK ; H, extract from virus-free tobacco.
(b) PAGE of fragments obtained by digestion with AluI of the 1±4 kbp PCR
products shown in (a). Approximate sizes of DNA (kbp) are indicated
beside each panel.
of the restriction fragments added up to no more than 1±4 kbp
in each instance, suggesting that each tobacco plant contained
a homogeneous population of molecules related to CLCuV-PK
DNA, similar in size but differing in sequence from plant to
plant. The products of replicate PCRs on extracts from the
same tobacco plant yielded the same pattern of restriction
fragments.
Southern blots of DNA extracted from chronically infected
tobacco and tomato plants exposed to a CLCuV-PK DNA-A
probe showed a complex pattern of bands, which was difficult
to interpret (Fig. 2 a). None of the major bands was eliminated
by treatment of the extracts with mung bean nuclease before
electrophoresis, suggesting that they all represented doublestranded DNA. However, when the extracts were treated with
ScaI, for which there is a single site in the intergenic region of
CLCuV-PK DNA-A and which was therefore expected to
linearize any circular forms of the DNA, much simpler band
patterns were obtained (Fig. 2 b). DNA from a plant recently
infected by viruliferous whiteflies yielded only a band of about
2±7 kbp, the expected size, whereas DNA from chronically
infected plants gave a band of this size together with one or
two smaller bands, often of about 1±5 kbp. None of the major
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 02 Aug 2017 07:43:57
Defective forms of CLCuV DNA-A
Table 1. DNA fragments amplified by PCR from extracts of CLCuV-infected tobacco and
tomato plants
DNA fragments obtained with indicated primers (kbp)*
Plant
CL1­CL3a
CL4­CL8
0±8
0±8
0±8
0±8
0±8
0±8
0±8
0±8
0±8
0±8
0
0±8
0±8
0±8
0
0±8
0±8
0±8
0±8
0±8
0±8
0±8
0±8
0±8
0±8
0
0±8
0±8
0±8
0
Tobacco 1
Tobacco 2
Tobacco 3
Tobacco 4
Tobacco 5
Tobacco 6
Tobacco 7
Tobacco 8
Tobacco 9
Tobacco 10
Virus-free tobacco
Tomato WFA†
Tomato WFB†
Tomato WFC†
Virus-free tomato
CL104­CL105b
1±4 (­0±9)
(1±4)
1±4­0±9
(1±4)­0±9
1±4
1±4
1±4 (­0±9)
1±4 (­0±9)
1±4
1±4
0
2±6
2±6
2±6
0
CL3a­CL8
0
0
0±9
0±9
0±25
0±9
0
0±45
0
0
0
0


0
* Figures in parentheses indicate fragments produced in only small amounts ; figures in bold type indicate
fragments sequenced.
† Tomato plants inoculated 3 months previously with CLCuV-PK by whiteflies.
, Not tested.
(a)
1 2 3 4 5 6
(b)
M H 1 2 3 4 5 6
1·6 kbp
0·5 kbp
PCR products from chronically infected tobacco plants are not
an artifact of the PCR but represent sequences amplified from
less than full-sized DNA-A-related circular molecules present
in the plants in substantial amounts. It is not clear why the PCR
failed to amplify, in addition to the 1±4 kbp products, the
expected 2±6 kbp product from the full-length DNA-A
molecules detected in Southern blots. Possibly, the efficiency
of amplification of the longer product from the same primer
sequences was substantially less.
Sequences of the small DNA molecules
Fig. 2. Southern blots of (a) untreated and (b) ScaI-treated DNA extracted
from : 1, tobacco plant 8 ; 2, tobacco plant 9 ; 3, tobacco plant 12 ; 4 and
5, tomato plants inoculated by grafting with scions from chronically
infected tobacco ; 6, tomato recently infected by whiteflies with a CLCuVPK culture lacking defective DNA ; H, virus-free tobacco. Blots were probed
with DNA representing residues 297–2449 of CLCuV-PK DNA-A.
M, Linear DNA markers, whose sizes (kbp) are indicated at the left.
bands in Fig. 2 (a) correspond in position to those in Fig. 2 (b),
and there are generally twice as many major bands in each
track of Fig. 2 (a) as in the corresponding track of Fig. 2 (b).
Thus, it seems likely that the major bands in Fig. 2 (a) represent,
in order of increasing mobility, open and supercoiled circular
forms of the 2±7 kbp DNA and open and supercoiled circular
forms of the smaller DNA(s). These results, together with the
reproducibility of the PCR results, suggest that the 1±4 kbp
The 1±4 kbp PCR products from four infected tobacco
plants, as well as the 0±9 kbp product from one of these plants,
were cloned and sequenced. In addition, the PCR products
from two plants were sequenced directly. The sequences
obtained for cloned or non-cloned products from the same
plant were identical. Inspection of the sequences showed that
the molecules from each plant contained sequences from
CLCuV-PK DNA-A, but that large parts had been deleted and
that the remaining sequences had been duplicated, inverted
and}or rearranged in various ways (Table 2). For example, the
1±4 kbp sequence from tobacco plant 0 has three deletions, an
inversion and a rearrangement when compared with CLCuVPK DNA-A. Most of the sequences from infected tobacco
differed at only a few positions from the corresponding
sequences in CLCuV-PK DNA-A but, in the sequences from
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 02 Aug 2017 07:43:57
BFAD
Y. Liu, D. J. Robinson and B. D. Harrison
Table 2. Affinities of nucleotide sequences in defective DNA molecules of CLCuV
Source plant
Primers
Product size Sequencing
(kbp)
procedure*
Tobacco 0
104­105b
1±4
C
Tobacco 1
104­105b
1±4
C(2)
Tobacco 4
104­105b
1±4
C, D
Tobacco 10
104­105b
1±4
C, D
Tobacco 4
104­105b
0±9
C, D
Tobacco 4
3a­8
0±9
D
Tobacco 8
3a­8
0±45
D
Tobacco 5
3a­8
0±25
D
Origin of sequence elements†
1–441
(67–507)
1–406
(66–471)
1–202
(80–281)
1–163
(66–228)
1–194
(88–281)
1–169
(894–735)
8–350
(983–641)
1–35
(983–949)
442–751
(1844–2153)
407–648
(416–657)
203–400
(1208–1011)
164–452
(1203–915)
195–350
(1033–1188)
170–196
?
351–464
(1839–1952)
36–180
?
752–1068
(1239–923)
649–892
?
401–1232
(1881–2712)
453–562
?
351–472
(1957–2078)
197–545
(2461–1–84)
1069–1324
(2457–2712)
893–1246
(2359–2712)
Calculated
size (nt)‡
1403
1324
1324
563–810
811–1233
(1937–2186) (2279–2701)
473–857
(2327–2711)
545–821
(1615–1892)
1322
958
181–239
(1897–1955)
* PCR product cloned and sequenced (C) or sequenced directly (D). Two separate clones of the 1±4 kbp product from tobacco 1 were sequenced.
† Figures are nucleotide positions in the sequence obtained ; figures in parentheses are the equivalent sequences in CLCuV DNA-A. ? indicates the
sequence was not recognized.
‡ Calculated assuming the sequence of the intergenic region was complete in the defective molecules.
Fig. 3. Nucleotide sequences around novel conjunctions of CLCuV-PK DNA-A sequences in defective DNA. Junction J1 is
between the first and second sequence elements listed in Table 2 for each PCR product, J2 between the second and third, etc.
For each junction, the middle line shows the sequence of the defective DNA and the upper and lower lines the sequences of
the regions of CLCuV-PK DNA-A that have apparently been joined, with residues they share with the defective DNA capitalized.
Residues shared by all three sequences at the junction point are underlined.
tobacco plants 1 and 10, segments of unrecognized sequence
not from CLCuV-PK DNA-A were present. All the sequences
began and ended in the intergenic region, close to the expected
priming sites, and all contained parts of the two adjacent genes,
BFAE
AV2 and AC1. Although the sequences that complete the circle
in the small DNA molecules by bridging between the 5« ends
of the primer sites were not determined, they were probably
the same as the equivalent sequences in DNA-A, i.e. residues
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 02 Aug 2017 07:43:57
Defective forms of CLCuV DNA-A
Table 3. ORFs in defective DNA molecules of CLCuV
ORFs in defective DNA extracted from :
Related
CLCuV ORF†
Reading
sense‡
Tobacco 0
1±4 kbp
Tobacco 1
1±4 kbp
Tobacco 10
1±4 kbp
Tobacco 4
1±4 kbp
Tobacco 4
0±9 kbp
AV2
(103)
V
121*
(101 from AV2)
188
(101 from AV2)
47
(39 from AV2)
39
(39 from AV2)
AV1 (CP)
(256)
AC1 (Rep)
(361)
V
92
(77 from AV1)
62
(42 from AC1)
67
(65 from AV1)
130
(74 from AC1)
–
107
(55 from AV2­
52 from AC3)
–
162
(146 from AC1)
245
(234 from AC1)
AC4
(100)
None
None
C
–
–
Complete
C
C
168
–
47
(23 from AC4)
126
61
92
–
–
–
171
(126 from AC1­
45 from AC3)
80
(35 from AC4)
–
–
C
–
* Figures are the number of amino acid residues in the predicted protein product of the ORF. The number of residues derived from the N terminus
of the related CLCuV-PK ORF product is given in parentheses together with, in the two instances where they occur, the number of residues
derived from the C terminus of the AC3 protein.
† The number of amino acid residues in the predicted product of the CLCuV-PK ORF is given in parentheses.
‡ V indicates that the ORF is read from viral sense DNA, C that it is read from the complementary sense.
2713–2725}1–66. This would provide each of the small
DNAs with a complete intergenic region, which contains all
the cis-acting sequences essential for replication of geminivirus
DNAs (Lazarowitz et al., 1992 ; Orozco et al., 1997). None of
the sequences contained nt 658–914 or 1240–1843 of DNAA, so all lacked part of the AV1, AC1, AC2 and AC3 genes.
Eleven sites in the five small DNA molecules sequenced
represent novel junctions of identifiable DNA-A sequences,
presumably produced by recombination. Fig. 3 shows the
nucleotide sequences around these junctions aligned with the
sequences in DNA-A from which they have apparently been
derived. Nine of the junctions correspond to points at which
the aligned progenitor sequences have from one to five
nucleotides in common, but at the remaining two sites there
are no such common residues. In most, but not all instances, the
aligned progenitor sequences also have residues in common in
the region flanking the recombination site. At one site, junction
3 in the 0±9 kbp product from tobacco plant 4, the sequence of
the small DNA contains a residue different from that expected
from the progenitor sequences. No obvious pattern or
characteristic feature emerges from this analysis of the
recombination junctions.
Analysis of the coding potential of the small DNA
molecules (Table 3) showed that one of them contains a
complete AC4 gene. Various other open reading frames (ORFs)
are also present, some of which are entirely novel and others
of which include portions of in-frame coding sequences of
CLCuV-PK genes, notably, in every case, the 5« part of the
AC1 coding sequence. Not all of these ORFs are associated
with plausible promoter and polyadenylation signals and it is
unclear which, if any, of them are expressed.
The presence in some of the small DNA molecules of
sequences that are inverted with respect to their orientation in
full-length DNA-A suggested that it should be possible to
amplify fragments from them by PCR with suitably chosen
pairs of primers that do not amplify any sequences from DNAA itself. Table 1 shows the results of an experiment with
primers CL3a and CL8, which are both complementary to
sequences in DNA-A (Harrison et al., 1997). Amplification
products were obtained from DNA extracted from five of the
ten chronically infected tobacco plants, with sizes ranging from
about 0±25 to 0±9 kbp. Thus these plants contain DNA
molecules in which the sequences corresponding to primers
CL3a and CL8 are in opposite orientation, whereas in DNA-A
they are in the same orientation. Products of 0±25, 0±45 and
0±9 kbp obtained with primers CL3a and CL8 were sequenced
directly ; each contained non-contiguous segments of DNA-A,
one of which was inverted, as well as, in some cases,
unrecognized sequences (Table 2). These molecules are further
examples of the variety of rearranged viral DNA molecules
that occurred in the chronically infected tobacco plants.
Occurrence of small DNA molecules in relation to time
after infection, and their transmission
The small DNA-A-related molecules were first detected
and analysed in extracts from tobacco plants that had been
inoculated with CLCuV-PK about 2 years previously. Grafting
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 02 Aug 2017 07:43:57
BFAF
Y. Liu, D. J. Robinson and B. D. Harrison
(a)
1
2
3
4
5
8 H
1·4 kbp
(b)
A B C
D E
F
H
2·6 kbp
1·4 kbp
Fig. 4. (a) Agarose gel electrophoresis of products amplified by PCR with
primers CL104 and CL105b from extracts of tomato plants, grafted with
scions from tobacco plants 1, 2, 3, 4, 5 or 8, or from uninfected tobacco
(H). (b) As (a), but extracts from tomato plants inoculated by whitefly
transmission from tobacco plant 5 (lanes A and C) or tobacco plant 8
(lanes B and D), or by grafting from tobacco plant 5 (lane E) or tobacco
plant 8 (lane F). Approximate sizes of DNA (kbp) are indicated beside
each panel.
of scions from these plants onto tomato plants resulted in
transmission of the small DNA molecules to the tomato plants
(Fig. 4 a). Similarly, the small molecules were transmitted by
grafting, together with CLCuV-PK, from tomato to tobacco.
When tomato seedlings were inoculated with the original
culture of CLCuV-PK using whiteflies, small DNA molecules
were not detected in extracts made 3 months after inoculation,
but by 9 months after inoculation they were detectable.
When tomato plants containing the small DNA molecules
were used as virus sources in whitefly transmission experiments, the virus isolate derived from tobacco plant 5 was
transmitted to 2 out of 11 tomato seedlings and the isolate
derived from tobacco plant 8 to 2 out of 7. Of the infected
seedlings, one with each isolate contained the 1±4 kbp
molecules (Fig. 4 b, lanes B and C). However, primers CL104
and CL105b detected only near full-length DNA in a third
seedling (Fig. 4 b, lane D) and two DNA species of about
1±5–1±6 kbp, which have not been studied further, in the fourth
(Fig. 4 b, lane A). Thus, generation of the small DNA molecules
seems to be a feature of long-term, chronic infection of tobacco
or tomato plants, but once formed they can be transmitted by
whiteflies.
Discussion
Our results show that tobacco and tomato plants,
chronically infected with CLCuV-PK, contain a range of small
circular DNA species derived predominantly from CLCuV-PK
DNA-A. The few sequence elements that were not identifiable
may have originated from CLCuV-PK DNA-B, if it exists, or
from the tobacco genome. However, in an initial attempt to
BFAG
detect it, no evidence for DNA-B was found ; when amplification of DNA extracts with primers CL104 and CL105b
gave a prominent 2±6 kbp product, digestion of that product
with several different restriction endonucleases gave fragments
that added up to no more than 2±6 kbp (data not shown). The
small DNA molecules, which appear in plants at relatively long
times after they are inoculated, seem to be generated by
illegitimate recombination, which results in deletions, duplications, inversions and rearrangements of the sequences. Each
chronically infected plant contains one predominant small
DNA species, but the predominant molecule in each plant is
different. Indeed, it is possible that different small DNA species
may predominate in the same plant at different times. All the
molecules seem to include the intergenic region, but recombinants that had lost this region would probably have lost the
ability to be replicated.
Including the bridging region between the 5« ends of the
PCR primers, the size of the small molecules is most commonly
about 1±4 kbp, although molecules of about 1±0 kbp also occur.
Circular single-stranded DNA molecules of about half the size
of the genomic DNA have also been detected in plants infected
with other begomoviruses, including tomato golden mosaic
virus (TGMV ; MacDowell et al., 1986), African cassava mosaic
virus (ACMV ; Stanley & Townsend, 1985), tomato yellow leaf
curl virus (TYLCV ; Czosnek et al., 1989) and ageratum yellow
vein virus (AYVV ; Stanley et al., 1997). Those in ACMVinfected and TGMV-infected plants were shown to be derived
exclusively from DNA-B. In contrast, the defective DNA
molecules of AYVV are derived from DNA-A (the only
genomic component detected), they are about the same size as
those of CLCuV-PK, and they too contain the intergenic
region and the 5« part of the Rep gene (Stanley et al., 1997). The
AYVV molecules differ somewhat from those of CLCuV-PK in
all containing large stretches of non-viral sequence, and only
one of the sequenced AYVV molecules contains part of a noncontiguous viral gene (the CP gene). TYLCV, like AYVV, has
only a single DNA component, equivalent to DNA-A, from
which its small DNA was presumably derived. Moreover, the
TYLCV small DNA was detected in extracts from purified
particle preparations, implying that it was encapsidated
(Czosnek et al., 1989). In addition to the characteristic geminate
particles, plants infected with geminiviruses frequently contain
a small proportion of isometric particles, and Sequeira (1982)
showed that fractions of purified ACMV preparations that
were enriched for the isometric particles were also enriched for
small circular ssDNA molecules. Taken together, these observations suggest that geminivirus coat protein can encapsidate
circular ssDNA molecules of 1±4–1±5 kb, about half the size of
genomic DNA, to form isometric particles. However, the
possibility that two small circular DNA molecules can be
packaged in one geminate particle is not excluded.
Encapsidation would be consistent with our observation (and
that of Stanley et al., 1997 for AYVV) that the small DNA
molecules can be transmitted by whiteflies, and the need for
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 02 Aug 2017 07:43:57
Defective forms of CLCuV DNA-A
encapsidation could explain why a particular size of small
DNA molecule seems to be favoured. Thus, we envisage the
occasional generation from DNA-A, by illegitimate recombination, of circular 1±4 kb molecules, which can be packaged in
viral coat protein and which retain the origin of replication as
well as sequences that interact with the viral Rep protein, and
perhaps with the N-terminal part of the Rep protein that the
recombinant molecules themselves encode. These molecules
would then be replicated in substantial amounts by the normal
mechanism for viral DNA-A.
Defective molecules are also described for the leafhoppertransmitted beet curly top virus (BCTV ; Frischmuth & Stanley,
1992 ; Stenger et al., 1992), the genome of which contains
elements similar to those in begomovirus DNA-A. Moreover,
the BCTV defective molecules resemble those of CLCuV-PK in
retaining the intergenic region and part of the Rep gene.
However, they differ in that the BCTV molecules contain only
a single deletion, and lack sequence inversions, rearrangements
and unidentified stretches. With both these viruses, and with
the defective molecules derived from DNA-B of ACMV and
TGMV (Stanley & Townsend, 1985 ; McDowell et al., 1986),
most of the recombination events needed to produce the
defective molecules have occurred between points where there
are a few (one to seven) shared nucleotides in the original
sequence.
What role the small DNA molecules might play in the
biology of CLCuV-PK in nature is unclear and we have not
ascertained whether or not they occur in naturally infected
plants. It seems unlikely that, in a short-lived annual crop plant
like cotton, they could have much effect on the development or
persistence of leaf curl symptoms, at least until a late stage of
infection. However, the means by which CLCuV-PK is
perpetuated between cotton seasons is uncertain and the small
DNA molecules might be involved in chronic infection of an
alternative host plant. Interestingly, some biological effects of
defective DNA molecules are reported for other begomoviruses. Defective forms of DNA-B of ACMV decrease
replication of viral genomic DNA and attenuate symptoms
(Stanley et al., 1990) as also do defective forms of DNA-A of
AYVV (Stanley et al., 1997).
Because they contain novel conjunctions of virus genetic
material, the small CLCuV-PK DNA molecules may serve as
raw material for evolution of new viruses or virus variants. It
is noteworthy that several variant forms of CLCuV-PK, which
have different combinations of nucleotide sequences, occur in
Pakistan (Zhou et al., 1998) and the small DNA molecules may
have had a role in the generation of these or other novel
geminivirus variants. Another intriguing possibility is that
small circular DNA molecules, similar to those described here,
might have been precursors of the geminivirus-related DNA
sequences found integrated into the genomes of some Nicotiana
species (Bejarano et al., 1996). Like the small circular DNAs, the
integrated sequences always include parts of the intergenic
region and of the AC1 gene.
Whatever their biological significance, the small circular
CLCuV-PK-related DNA molecules provide yet another
example of the facility with which illegitimate recombination
can occur in geminivirus DNA.
The work reported in this paper was supported financially by the
European Commission (contract CI1*-CT94-0052). Y. L. was a holder of
the Sino-Scottish Fellowship in Tropical Plant Virology. SCRI is grantaided by the Scottish Office Agriculture, Environment and Fisheries
Department.
References
Anon. (1994). Program Manual for the Wisconsin Package, Version 8.
Madison : Genetics Computer Group.
Bejarano, E. R., Khashoggi, A., Witty, M. & Lichtenstein, C. (1996).
Integration of multiple repeats of geminiviral DNA into the nuclear
genome of tobacco during evolution. Proceedings of the National Academy
of Sciences, USA 93, 759–764.
Czosnek, H., Ber, R., Navot, N., Antignus, Y., Cohen, S. & Zamir, D.
(1989). Tomato yellow leaf curl virus DNA forms in the viral capsid, in
infected plants and in the insect vector. Journal of Phytopathology 125,
47–54.
Deng, D., McGrath, P. F., Robinson, D. J. & Harrison, B. D. (1994).
Detection and differentiation of whitefly-transmitted geminiviruses in
plants and vector insects by the polymerase chain reaction with
degenerate primers. Annals of Applied Biology 125, 327–336.
Frischmuth, T. & Stanley, J. (1992). Characterization of beet curly top
virus subgenomic DNA localizes sequences required for replication.
Virology 189, 808–811.
Hameed, S., Khalid, S., Ehsan-ul-Haq & Hashmi, A. A. (1994). Cotton
leaf curl disease in Pakistan caused by a whitefly-transmitted geminivirus.
Plant Disease 78, 529.
Harrison, B. D., Liu, Y. L., Khalid, S., Hameed, S., Otim-Nape, G. W. &
Robinson, D. J. (1997). Detection and relationships of cotton leaf curl
virus and allied whitefly-transmitted geminiviruses occurring in Pakistan.
Annals of Applied Biology 130, 61–75.
Lazarowitz, S. G. (1992). Geminiviruses : genome structure and gene
function. Critical Reviews in Plant Sciences 11, 327–349.
MacDowell, S. W., Coutts, R. H. A. & Buck, K. W. (1986). Molecular
characterisation of subgenomic single-stranded and double-stranded
DNA forms isolated from plants infected with tomato golden mosaic
virus. Nucleic Acids Research 14, 7967–7984.
McGrath, P. F. & Harrison, B. D. (1995). Transmission of tomato leaf
curl geminiviruses by Bemisia tabaci : effects of virus isolate and vector
biotype. Annals of Applied Biology 126, 307–316.
Mansoor, S., Bedford, I., Pinner, M. S., Stanley, J. & Markham, P. G.
(1993). A whitefly-transmitted geminivirus associated with cotton leaf
curl disease in Pakistan. Pakistan Journal of Botany 25, 105–107.
Nadeem, A. (1995). Molecular characterization of two cotton geminiviruses.
PhD dissertation, University of Arizona, USA.
Navot, N., Pichersky, E., Zeidan, M., Zamir, D. & Czosnek, H. (1991).
Tomato yellow leaf curl virus : a whitefly-transmitted geminivirus with a
single genomic molecule. Virology 185, 151–161.
Orozco, B. M., Miller, A. B., Settlage, S. B. & Hanley-Bowdoin, L.
(1997). Functional domains of a geminivirus replication protein. Journal
of Biological Chemistry 272, 9840–9846.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning : A
Laboratory Manual, 2nd edn. Cold Spring Harbor, NY : Cold Spring
Harbor Laboratory.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 02 Aug 2017 07:43:57
BFAH
Y. Liu, D. J. Robinson and B. D. Harrison
Sequeira, J. C. (1982). Purification, properties and relationships of cassava
latent virus. PhD thesis, University of Dundee, UK.
Stanley, J. & Townsend, R. (1985). Characterisation of DNA forms
associated with cassava latent virus infection. Nucleic Acids Research 13,
2189–2206.
Stanley, J., Frischmuth, T. & Ellwood, S. (1990). Defective viral DNA
ameliorates symptoms of geminivirus infection in transgenic plants.
Proceedings of the National Academy of Sciences, USA 87, 6291–6295.
Stanley, J., Saunders, K., Pinner, M. S. & Wong, S. M. (1997). Novel
defective interfering DNAs associated with ageratum yellow vein
geminivirus infection of Ageratum conyzoides. Virology 239, 87–96.
Stenger, D. C., Stevenson, M. C., Hormuzdi, S. G. & Bisaro, D. M.
(1992). A number of subgenomic DNAs are produced following
BFAI
agroinoculation of plants with beet curly top virus. Journal of General
Virology 73, 237–242.
Zhou, X., Liu, Y., Calvert, L., Munoz, C., Otim-Nape, G. W., Robinson,
D. J. & Harrison, B. D. (1997). Evidence that DNA-A of a geminivirus
associated with severe cassava mosaic disease in Uganda has arisen by
interspecific recombination. Journal of General Virology 78, 2101–2111.
Zhou, X., Liu, Y., Robinson, D. J. & Harrison, B. D. (1998). Four DNAA variants among Pakistani isolates of cotton leaf curl virus and their
affinities to DNA-A of geminivirus isolates from okra. Journal of General
Virology 79, 915–923.
Received 22 December 1997 ; Accepted 11 February 1998
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 02 Aug 2017 07:43:57