Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
DNA to Protein 5 2 DNA, RNA, and the Flow of Information DNA is the genetic material but proteins are the executors. How is the genetic information translated into function? • 1958 -Francis Crick’s central dogma stated that DNA codes for RNA, and RNA codes for protein. 5 3 DNA to Protein Flow of Information • DNA is an information molecule. The information is stored in the order of the four different bases. • DNA sequence codes for amino-acid sequence in proteins • A genetic code relates genes (DNA) to the amino acids of proteins. 5 4 Genes, the units of heredity • Genes are the units of heredity • A gene caries the information for a full polypeptide (Typically, one gene=one polypeptide). • Genes are segments of DNA 5 5 DNA, RNA, and the Flow of Information • The expression of a genetic information takes place in two steps: Transcription makes a singlestranded RNA copy of a segment of the DNA. Translation uses information encoded in the RNA to make a polypeptide. 5 6 DNA, RNA, and the Flow of Information RNA can base-pair with single-stranded DNA (adenine pairs with uracil instead of thymine) and also can fold over and base-pair with itself. DNA RNA Deoxyribose Ribose Thymine Uracil Double strand Single strand 5 7 Transcription: DNA-Directed RNA Synthesis Transcription DNA DNA RNA DNA 5 8 RNA Polymerase • Transcription requires: A DNA template for complementary base pairing The appropriate ribonucleoside triphosphates (ATP, GTP, CTP, and UTP) The enzyme RNA polymerase 5 9 Transcription: DNA-Directed RNA Synthesis • Just one DNA strand (the template strand) is used to make the RNA. • The DNA double helix partly unwinds to serve as template. 5 10 Transcription Initiation • Three stages of transcription: Initiation, elongation, termination. • The first step of transcription, initiation, begins at a promoter, a special sequence of DNA. • There is at least one promoter for each gene to be transcribed. • The RNA polymerase binds to the promoter region when conditions allow. 5 11 Transcription: Elongation • After binding, RNA polymerase unwinds the DNA about 20 base pairs at a time and reads the template in the 3′-to-5′ direction (elongation). • The new RNA elongates from its 5′ end to its 3′ end; thus the RNA transcript is antiparallel to the DNA template strand. • As the RNA transcript forms, it peels away, allowing the already transcribed DNA to be rewound into the double helix. 5 12 Transcription: Termination • Particular base sequences in the DNA specify termination. • Gene mechanisms for termination vary: For some, the newly formed transcript simply falls away from the DNA template. For other genes, a helper protein pulls the transcript away. In prokaryotes, translation of the mRNA often begins before transcription is complete. 5 13 Promoter sequence and transcription initiation • The first step of transcription, initiation, begins at a promoter, a special sequence of DNA. • The promoter sequence directs the RNA polymerase as to which of the double strands is the template and in what direction the RNA polymerase should move. Start signal 5’GCACTCTACTATATTCTCAATAGGTCCACG3’ 3’CGTGAGATGATATAAGAGTTATCCAGGTGC5’ Template DNA Start site 5’ 3’ Transcription 5 14 Promoter sequence and transcription initiation • Pre-initiation complex 5 15 TATA Binding protein • DNA binding factors are proteins that bind DNA through non-covalent interactions 5 16 Transcription termination • Particular base sequences in the DNA specify termination. (Hairpin structure) CCCACAGCCGCCAGTTCCGCTGGCGGCATTTTAA GGGTGTCGGCGGTCAAGGCGACCGCCGTAAAATT Stop signal (dsDNA) Transcription CGGCGGUC CCCACA GCCGCCAG CCCACAGCCGCCAGUUCCGCUGGCGGCAUUUUU (RNAss) (Hairpin RNA structure) AUUUU 5 17 Transcription results in amplification • Many RNA molecules are produced in parallel from a single DNA template 5 18 Genome organization • A gene should carry all the information for a full polypeptide including information for defining initiation and termination • Just one DNA strand (the template strand) is used to make the RNA. • For different genes in the same DNA molecule, the roles of these strands may be reversed. 5 19 Messenger RNA • Gene transcription generates messenger RNA (mRNA) which will be translated into protein • mRNA ends are chemically modified One RNA = one proteins One RNA = several proteins 5 20 Translation 5 21 The Genetic Code • A genetic code relates genes (DNA) to mRNA and mRNA to the amino acids of proteins. • mRNA is read in three-base segments called codons. AUGGGCAUGCCU RNA Translation Met-Gly-Met-Pro Protein 5 22 The Genetic Code • mRNA is read in three-base segments called codons. • The number of different codons possible is 64 (43), because each position in the codon can be occupied by one of four different bases. 5 23 DNA, RNA, and the Flow of Information • The 64 possible codons code for only 20 amino acids and the start and stop signals. 5 24 The Genetic Code • This means that many amino acids have more than one codon. Thus the code is redundant. • However, the code is not ambiguous. Each codon is assigned only one amino acid. 5 25 The Genetic Code • Three reading frames for genetic information 5 26 mRNA structure • AUG, which codes for methionine, is called the start codon, the initiation signal for translation. • Three codons (UAA, UAG, and UGA) are stop codons, which direct the ribosomes to end translation. • mRNA contains a coding sequence as well as UnTranslated Regions (UTRs) Start (AUG) UTR Stop UTR 5 27 Breaking the Genetic Code • In the early 1960s, molecular biologists used Invitro translation to brake the genetic code. • Nirenberg prepared an artificial mRNA in which all bases were uracil (poly U). • When incubated with additional components, the poly U mRNA led to synthesis of a polypeptide chain consisting only of phenylalanine amino acids. • UUU appeared to be the codon for phenylalanine. • Other codons were deciphered from this starting point. Figure 12.6 Deciphering the Genetic Code 5 29 Translation machinery: Ribosomes • Ribosomes are protein-RNA complexes that translate RNA to protein. Ribosome 5 30 tRNA adaptor molecule • At the 3′ end of every tRNA molecule is a site to which its specific amino acid binds covalently. • Midpoint in the sequence are three bases called the anticodon. • The anticodon is the contact point between the tRNA and the mRNA. • The anticodon is complementary (and antiparallel) to the mRNA codon. • The codon and anticodon unite by complementary base pairing. 5 31 tRNA: adaptor molecules • The codon in mRNA and the amino acid in a protein are related by way of an adapter—a specific tRNA molecule. • tRNA has three functions: It carries an amino acid. It associates with mRNA molecules. It interacts with ribosomes. tRNA mRNA Ribosome Amino Acid 5 32 tRNA: adaptor molecules • A tRNA molecule has 75 to 80 nucleotides and a threedimensional shape (conformation). • The shape is maintained by complementary base pairing and hydrogen bonding. • The three-dimensional shape of the tRNAs allows them to combine with the binding sites of the ribosome. 5 33 Linking RNAs, Amino Acids, and Ribosomes • The molecule tRNA is required to assure specificity in the translation of mRNA into proteins. • The tRNAs must read mRNA correctly. • The tRNAs must carry the correct amino acids. mRNA Ribosome tRNA Amino Acid Protein 5 34 Ribosome structure • Each ribosome has two subunits: a large one and a small one. • In eukaryotes the ribosome has four different associated rRNA molecules and 45 different proteins. 5 Preparation for Translation: 35 Linking RNAs, Amino Acids, and Ribosomes • The large subunit has four binding sites: The T site where the tRNA first lands The A site where the tRNA anticodon binds to the mRNA codon The P site where the tRNA adds its amino acid to the polypeptide chain The E site where the tRNA goes before leaving the ribosome 5 Preparation for Translation: 36 Linking RNAs, Amino Acids, and Ribosomes • The small ribosomal subunit plays a role in validating the three-base-pair match between the mRNA and the tRNA. • If hydrogen bonds have not formed between all three base pairs, the tRNA is ejected from the ribosome. 5 37 Translation: RNA-Directed Polypeptide Synthesis • Translation begins with an initiation complex: a charged tRNA with its amino acid and a small subunit, both bound to the mRNA. • This complex is bound to a region upstream of where the actual reading of the mRNA begins. • The start codon (AUG) designates the first amino acid in all proteins. • The large subunit then joins the complex. • The process is directed by proteins called initiation factors. Figure 12.10 The Initiation of Translation 5 39 Translation: RNA-Directed Polypeptide Synthesis • Ribosomes move in the 5′-to-3′ direction on the mRNA. • The peptide forms in the N–to–C direction. • The large subunit catalyzes two reactions: Breaking the bond between the tRNA in the P site and its amino acid Peptide bond formation between this amino acid and the one attached to the tRNA in the A site • This is called peptidyl transferase activity. Figure 12.11 Translation: The Elongation Stage (Directions) Figure 12.11 Translation: The Elongation Stage 5 42 Translation: RNA-Directed Polypeptide Synthesis • After the first tRNA releases methionine, it dissociates from the ribosome and returns to the cytosol. • The second tRNA, now bearing a dipeptide, moves to the P site. • The next charged tRNA enters the open A site. • The peptide chain is then transferred to the P site. • These steps are assisted by proteins called elongation factors. 5 43 Translation: RNA-Directed Polypeptide Synthesis • When a stop codon—UAA, UAG, or UGA— enters the A site, a release factor and a water molecule enter the A site, instead of an amino acid. • The newly completed protein then separates from the ribosome. Figure 12.12 The Termination of Translation 5 45 Polysomes • Polysomes are mRNA molecules with more than one ribosome attached. 5 46 Polysomes • Polysomes make protein more rapidly, producing multiple copies of protein simultaneously. 5 47 Classes of RNA • Messenger RNA, or mRNA moves from the nucleus of eukaryotic cells into the cytoplasm, where it serves as a template for protein synthesis. • Transfer RNA, or tRNA, is the link between the code of the mRNA and the amino acids of the polypeptide, specifying the correct amino acid sequence in a protein. • Ribosomal RNA, or rRNA, Functional component of Ribosomes rRNA mRNA 5 48 Inhibition of translation • Some antibiotics work by inhibiting protein synthesis at various points. • Because of differences between prokaryotic and eukaryotic ribosomes, the human ribosomes are unaffected. 5 49 DNA and the Flow of Information • DNA stores information and is used to transmit heritable information 5 50 DNA, RNA, and the Flow of Information • The expression of a genetic information takes place in two steps: • Transcription makes a singlestranded RNA copy of a segment of the DNA. • Translation uses information encoded in the RNA to make a polypeptide. 5 51 DNA, RNA, and the Flow of Information 5 52 One Gene, One Polypeptide • A gene is defined as a DNA sequence. • A one-gene, one-polypeptide relationship. Figure 12.5 The Universal Genetic Code 5 54 Mutations: Heritable Changes in Genes • Mutations are heritable changes in DNA— changes that are passed on to daughter cells. • Multicellular organisms have two types of mutations: Somatic mutations are passed on during mitosis, but not to subsequent generations. Germ-line mutations are mutations that occur in cells that give rise to gametes. 5 55 Mutations: Heritable Changes in Genes • Changes in DNA sequence can lead to changes in Protein level or function and lead to change in cell function. • Mutations are alterations of the DNA nucleotide sequence and are of two types: Point mutations are mutations of single sites. Chromosomal mutations are changes in the arrangements of chromosomal DNA segments. 5 56 Point Mutations • Point mutations result from the addition or subtraction of a base or the substitution of one base for another. • Point mutations can occur as a result of mistakes during DNA replication or can be caused by environmental mutagens. • Because of redundancy in the genetic code, some point mutations, called silent mutations, result in no change in the amino acids in the protein. Figure 12.5 The Universal Genetic Code Silent Mutation • Because of redundancy in the genetic code, some point mutations, called silent mutations, result in no change in the amino acids in the protein. Wild type DNA template 3′ strand 5′ 5′ 3′ mRNA 5′ 3′ Protein Stop Amino end Carboxyl end A instead of G 5′ 3′ 3′ 5′ U instead of C 5′ 3′ Stop Silent (no effect on amino acid sequence) 5 59 Mutations: Heritable Changes in Genes • Some mutations, called missense mutations, cause an amino acid substitution. • An example in humans is sickle-cell anemia, a defect in the β-globin subunits of hemoglobin. • The β-globin in sickle-cell differs from the normal by only one amino acid. • Missense mutations may reduce the functioning of a protein or disable it completely. Missense mutation Wild type DNA template 3′ strand 5′ 5′ 3′ mRNA 5′ 3′ Protein Stop Amino end Carboxyl end T instead of C 5′ 3′ 3′ 5′ A instead of G 3′ 5′ Stop Missense 5 61 Mutations: Heritable Changes in Genes • Nonsense mutations are base substitutions that substitute a stop codon. • The shortened proteins are usually not functional. Wild type DNA template 3′ strand 5′ 5′ 3′ mRNA 5′ 3′ Protein Stop Amino end Carboxyl end A instead of T 3′ 5′ 5′ 3′ U instead of A 5′ 3′ Stop Nonsense 5 62 Mutations: Heritable Changes in Genes • A frame-shift mutation consists of the insertion or deletion of a single base in a gene. • This type of mutation shifts the code, changing many of the codons to different codons. • These shifts almost always lead to the production of nonfunctional proteins. Frame-shift mutation Wild type DNA template 3′ strand 5′ 5′ 3′ mRNA 5′ 3′ Protein Stop Amino end Carboxyl end Extra A 5′ 3′ 3′ 5′ Extra U 5′ 3′ Stop Frameshift causing immediate nonsense (1 base-pair insertion) 5 64 Chromosomal mutations • DNA molecules can break and re-form, causing four different types of mutations: Deletions are a loss of a chromosomal segment. Duplications are a repeat of a segment. Inversions result from breaking and rejoining when segments get reattached in the opposite orientation. Translocations result when a portion of one chromosome attaches to another. Figure 12.18 Chromosomal Mutations (Part 1) DNA molecules can break and re-form, causing four different types of mutations: Deletions are a loss of a chromosomal segment. Duplications are a repeat of a segment. Figure 12.18 Chromosomal Mutations (Part 2) Inversions result from breaking and rejoining when segments get reattached in the opposite orientation. Translocations result when a portion of one chromosome attaches to another. 5 67 Mutations: Heritable Changes in Genes • Induced mutations are permanent changes caused by some outside agent (mutagen). • Mutagens can alter DNA in several ways: Altering covalent bonds in nucleotides Adding groups to the bases Radiation damages DNA: Ionizing radiation (X rays) produces free radicals. Ultraviolet radiation is absorbed by thymine and causes interbase covalent bonds to form. Figure 12.19 Spontaneous and Induced Mutations (Part 1) Guanine Benzo(a)pyrene 5 69 T T U.V 5’--C C G A ATTC tt A G--3’ 3’--G G CTTA A GT C --5’ Frame Shift Thymine Dimer 5 70 Mutations: Heritable Changes in Genes • Most mutations are repaired by cellular mechanisms. 1012Events/min 5 71 Mutations: Heritable Changes in Genes • DNA replication is a mechanism for introducing spontaneous mutations and for fixing mutations. Figure 12.19 Spontaneous and Induced Mutations (Part 2) 5 Nucleic Acids: Informational Macromolecules 73 That Can Be Catalytic • Closely related living species have DNA base sequences that are more similar than distantly related species. • The comparative study of base sequences has confirmed many of the traditional classifications of organisms. • DNA comparisons confirm that our closest living relatives are chimpanzees: We share more than 98 percent of our DNA base sequences. 5 74 06_27_humans_whales.jpg 5 75 Mutations: Heritable Changes in Genes • Mutations have both benefits and costs. • Germ line mutations provide genetic diversity for evolution, but usually produce an organism that does poorly in its environment. • Somatic mutations do not affect offspring, but can cause cancer. • Mutations can be detrimental, neutral, or occasionally beneficial. • Random accumulation of mutations in the extra copies of genes can lead to the production of new useful proteins.