Download PDF

RESEARCH ARTICLE 1123
Development 134, 1123-1132 (2007) doi:10.1242/dev.02802
Mbd3, a component of the NuRD co-repressor complex, is
required for development of pluripotent cells
Keisuke Kaji, Jennifer Nichols* and Brian Hendrich†
Mbd3 is a core component of the NuRD (Nucleosome Remodeling and Histone Deacetylation) co-repressor complex, and NuRDmediated silencing has been implicated in cell fate decisions in a number of contexts. Mbd3-deficient embryonic stem (ES) cells
made by gene targeting are viable but fail to form a stable NuRD complex, are severely compromised in the ability to differentiate,
and show LIF-independent self-renewal. Mbd3 is known to be essential for postimplantation embryogenesis in mice, but the
function of Mbd3 in vivo has not previously been addressed. Here we show that the inner cell mass (ICM) of Mbd3-deficient
blastocysts fails to develop into mature epiblast after implantation. Unlike Mbd3-null ES cells, Mbd3-deficient ICMs grown ex vivo
fail to expand their Oct4-positive, pluripotent cell population despite producing robust endoderm outgrowths. Additionally, we
identify a set of genes showing stage-specific expression in ICM cells during preimplantation development, and show that Mbd3 is
required for proper gene expression patterns in pre- and peri-implantation embryos and in ES cells. These results demonstrate the
importance of Mbd3/NuRD for the development of pluripotent cells in vivo and for their ex vivo progression into embryonic stem
cells, and highlight the differences between ES cells and the ICM cells from which they are derived.
INTRODUCTION
Mammalian embryogenesis begins with a single cell, the zygote,
which in the context of the proper maternal environment can give
rise to all tissues of the embryo and the placenta. The zygote and
cells of early cleavage stage embryos are said to be totipotent, that
is, they are capable of giving rise to all embryonic and extraembryonic tissues (Rossant, 1976). At the morula stage, the embryo
begins to compact and by the blastocyst stage the outer cells form an
extra-embryonic cell layer called the trophectoderm, while the inside
cells form the inner cell mass (ICM) that will eventually give rise to
all cells of the foetus and some further extra-embryonic structures.
Proper segregation of the ICM and trophectoderm lineages at this
stage requires the activity of the transcription factors Cdx2 and Oct4
(Pou5f1) (Nichols et al., 1998; Niwa et al., 2005; Strumpf et al.,
2005). At 3.5 days post-coitus (dpc), the ICM contains two cell
populations, one expressing Pou5f1 and Nanog that is apparently
fated to become epiblast, the other expressing Pou5f1 and Gata6 and
is likely to become primitive endoderm (Chazaud et al., 2006). At
late blastocyst stages (around 4.5 dpc) and immediately prior to
implantation, the two cell populations become spatially resolved
with the primitive endoderm forming a layer of cells facing the
blastocyst cavity, while the early epiblast retains the potential to
derive all embryonic cell types, a property known as pluripotency.
Immediately after implantation, the early epiblast begins to expand
and form a columnar epithelium with a proamniotic cavity, a
structure that we define here as ‘late epiblast’. This transition is
accompanied by a dramatic increase in cell proliferation, resulting
Institute for Stem Cell Research, Centre Development in Stem Cell Biology, School of
Biological Sciences, University of Edinburgh, Edinburgh EH9 3JQ, UK.
*Present address: Wellcome Trust Centre for Stem Cell Research, Institute for Stem
Cell Biology, University of Cambridge, Tennis Court Road, Cambridge CB2 1QT, UK
†
Author for correspondence (e-mail: [email protected])
Accepted 9 January 2007
in expansion of the pluripotent cell population from ~25 cells at 4.5
dpc to ~660 cells by 6.5 dpc (Snow and Bennett, 1978). In addition
to having a shorter cell cycle, the late epiblast also differs from early
epiblast in terms of gene expression (Pelton et al., 2002). However,
little is known of the differentiation events from 3.5 dpc ICM to early
epiblast and late epiblast, owing to the small size and inaccessibility
of relevant tissues.
One of the striking differences between the pluripotent cell
populations in 3.5 dpc ICMs, early epiblast and late epiblast, is the
ability to produce embryonic stem (ES) cells (Evans and Kaufman,
1981; Martin, 1981; Smith, 2001). ES cells, which can be
maintained indefinitely in culture while maintaining pluripotency,
can be derived from cells of the ICM and early epiblast, but not from
late epiblast (Brook and Gardner, 1997). ES cells share many
properties with ICM/early epiblast cells, and are able to differentiate
into all embryonic cell types including the germ line (Bradley et al.,
1984). However, ES cells can be derived from only 30% of ICMs at
best with conventional methods (Brook and Gardner, 1997), and the
molecular mechanisms underlying the derivation of ES cells, and the
molecular differences between ES cells and ICM/early epiblast cells,
are largely unknown (Zwaka and Thomson, 2005).
The difference between early embryonic pluripotent cells and the
lineage-committed cells derived from them, or their transformed
derivatives in vitro (i.e. ES cells), is, by definition, epigenetic.
Therefore, it stands to reason that epigenetic silencing factors will play
important roles in this process. Several proteins involved in epigenetic
silencing have been shown to be important for early embryonic
viability (Bernstein et al., 2003; Cowley et al., 2005; Dannenberg et
al., 2005; David et al., 2003; Dodge et al., 2004; Hendrich et al., 2001;
O’Carroll et al., 2001; Rayasam et al., 2003), although it is not always
clear why the mutant embryos do not survive. ES cells appear to
contain an unusual epigenetic profile consisting of both active and
silencing histone methylation marks, which tend to resolve into one
or the other upon differentiation (Azuara et al., 2006; Bernstein et al.,
2006). Many genes which encode developmentally important
DEVELOPMENT
KEY WORDS: Pluripotency, ES cells, Epiblast, Epigenetics, Mbd3, NuRD
1124 RESEARCH ARTICLE
MATERIALS AND METHODS
Mice
Mbd3+/– mice (Hendrich et al., 2001) were backcrossed to C57Bl/6 mice for
more than 10 generations. Hex-GFP mice (Rodriguez et al., 2001) were
kindly provided by Joshua Brickman and used to generate Mbd3–/– Hex-GFP
embryos. Embryonic diapause was induced as described (Buehr and Smith,
2003). To generate GFP-ES cell/Mbd3 mutant embryo chimeras, Tau-GFP
ES cells (Pratt et al., 2000) were aggregated with morulae obtained from
Mbd3 heterozygote intercrosses. After overnight culture, embryos were
transferred to the uteri of embryonic day (E) 2.5 pseudopregnant females
and collected after 3 days.
Immunofluorescence and RNA in situ hybridisation
Embryos were fixed with 4% paraformaldehyde and permeabilised with
0.25% Triton X-100. After blocking with 1% skimmed milk and 0.05%
Tween 20 in PBS, embryos were stained with primary antibodies: anti-Mbd3
(sc-9402, Santa Cruz), anti-Oct4 (sc-8628, sc-5279, Santa Cruz and Becton
Dickinson), anti-Nanog (provided by Ian Chambers, Institute for Stem Cell
Research, Edinburgh, UK), anti-Gata4 (sc-1237, Santa Cruz), anti-␣7
integrin (provided by Ann Sutherland, University of Virginia,
Charlottesville, VA) (Klaffky et al., 2001), anti-activated caspase-3 (AF-835,
R&D Systems), anti-Ki67 (MAB4062, Chemicon), followed by the
appropriate secondary antibodies. Nuclei were stained with DAPI
(Molecular Probes). Images were captured with a confocal microscope
(Leica TSC SP2) and Leica confocal software. Whole-mount RNA in situ
hybridisation was performed as described (Rosen and Beddington, 1993).
Staining reactions were carried out for 2 days. The in situ probes for Cdx2
and Mash2 have been described previously (Buehr et al., 2003; Nichols et
al., 1998). Embryos were genotyped by PCR.
Immunosurgery and ICM culture
Immunosurgery was carried out as described (Solter and Knowles, 1975),
with collection of trophectoderm lysates for genotype determination by
PCR. ICMs were cultured in the presence of 2000 U/ml of LIF and 20% FCS
in GMEM on gelatin-coated dishes.
Single-ICM and single-cell PCR
cDNA from single ICMs (30-40 cells) or single cells was amplified as
described (Iscove et al., 2002), except for the following modifications. The
sequence of the primer used for cDNA amplification is 5⬘AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGTACT30-3⬘.
SuperRNaseIn (Ambion) and SuperScript III (Invitrogen) were used as
RNase inhibitor and reverse transcriptase, respectively. PCR was carried out
with ExTaq (Takara). The genotype of individual ICMs was confirmed by
PCR with trophectoderm lysates. cDNAs from seven 3.5-dpc ICMs, six 4.5dpc ICMs, or five single ES cells, respectively, were combined and the
amount of cDNA was normalised for Gapdh expression by PCR. See Table
1 for information on gene-specific primers. All PCRs for specific genes were
performed with an annealing temperature of 60°C.
RESULTS
Mbd3 is required for proper organisation of ICMderived tissues upon implantation
We have previously shown that Mbd3-deficient ES cells made by
gene targeting contained little or no NuRD complex, were
severely compromised in their ability to differentiate, and
persistently expressed Oct4 in a variety of differentiation
conditions including in chimeric embryos (Kaji et al., 2006). To
investigate the role played by Mbd3/NuRD in pluripotent cells in
vivo, we sought to determine the function of Mbd3 in pre- and
peri-implantation embryos. In wild-type embryos, Mbd3
expression was observed in all cells from morulae to the egg
cylinder stage at 6.5 dpc, and appeared exclusively nuclear (Fig.
1A). Maternal Mbd3 protein was detected in morulae but not in
blastocysts, as judged by immunofluorescence of Mbd3–/–
embryos produced by intercrossing Mbd3 heterozygote parents
(Fig. 1B). At both 3.5 dpc and 4.5 dpc, Mbd3–/– embryos were
morphologically indistinguishable from wild-type littermates,
showed normal expression of Oct4 at 3.5 dpc and 4.5 dpc (Fig.
2A), and normal segregation of early epiblast (Oct4-Nanog
double-positive cells; Fig. 2B) and hypoblast or primitive
endoderm (Gata4-expressing cells, some of which also express
Oct4; Fig. 2B) at 4.5 dpc. Null embryos were recovered at
mendelian frequencies at both 3.5 dpc and 4.5 dpc (Table 2).
By 5.5 dpc, null embryos were no longer identified in the
expected ratio and failed to form a cavitated structure, with the
Oct4-expressing, presumptive epiblast cells remaining proximally
located as in 3.5 and 4.5 dpc embryos (Fig. 2C). Mbd3–/– ESderived cells in chimeric embryos were capable of forming an
epiblast-like structure, but failed to extinguish Oct4 expression
(Kaji et al., 2006). By contrast, Oct4-expressing cells in Mbd3–/–
embryos were gradually lost without ever forming a proamniotic
cavity (Fig. 2C) while the ectoplacental cone continued to grow
during early postimplantation stages, demonstrating that Mbd3 is
not required for growth of all cell types. Whereas null embryos
DEVELOPMENT
transcription factors are occupied by the Polycomb repressive
complexes PRC1 and PRC2 in ES cells, and mouse ES cells deficient
for PRC components fail to maintain silencing at several of these loci
(Azuara et al., 2006; Boyer et al., 2006; Lee et al., 2006). Although the
details of epigenetic modifications in pluripotent cells in vivo have
been lacking owing to the scarcity of relevant tissue, a recent study has
revealed that ICMs have more intense silencing marks than do ES
cells, at in least some genes (O’Neill et al., 2006).
The NuRD (Nucleosome Remodeling and Histone Deacetylation)
co-repressor complex is an abundant and biochemically wellcharacterised co-repressor which is implicated in silencing in a
number of contexts and in a variety of organisms, including mammals,
flies, nematodes and plants (Ahringer, 2000; Bowen et al., 2004). In
mammals, NuRD-mediated silencing has been implicated in cell fate
decisions during ES cell differentiation (Kaji et al., 2006) and
haematopoietic development (Fujita et al., 2004; Hong et al., 2005;
Hutchins et al., 2002; Rodriguez et al., 2005; Williams et al., 2004).
One of the core components of NuRD is the Mbd3 protein (Wade et
al., 1999; Zhang et al., 1999). Mbd3 was originally identified in mice
and humans as a protein containing a region with high homology to
the methyl-CpG-binding domain (MBD) of MeCP2, but which did
not bind methylated DNA (Hendrich and Bird, 1998). Recently, we
generated Mbd3–/– ES cells by gene targeting and showed that Mbd3
is required for stable formation of the NuRD complex in ES cells (Kaji
et al., 2006). Mbd3–/– ES cells are viable and maintain expression of
genes associated with pluripotent cells such as Oct4 and Nanog, but
fail to differentiate or silence expression of Oct4 upon withdrawal of
LIF in vitro or in chimeric embryos.
Mice lacking a functional Mbd3 gene die prior to midgestation
(Hendrich et al., 2001), but why these embryos fail to develop, and
what role is played by Mbd3/NuRD in early embryos has not been
described. In this study, we have characterised the function of Mbd3
in peri-implantation development. We find that Mbd3 is required for
ICM cells to develop into late epiblast after implantation, for
proliferation of epiblast cells in culture, and for the proper function
of extra-embryonic tissues immediately after implantation. We
further identify a number of gene expression differences between
ICMs from 3.5 dpc embryos, 4.5 dpc embryos and ES cells, many
of which show misregulation in mutant embryos prior to the onset
of morphological abnormalities. Together, these data demonstrate
that Mbd3/NuRD plays a key role in the transition of pluripotent
ICM cells towards an epiblast fate during peri-implantation
development, and for the acquisition of an ES cell fate.
Development 134 (6)
Mbd3 and ICM potential
RESEARCH ARTICLE 1125
Table 1. PCR primers
Gene name
Mbd3 + allele
Mbd3 – allele
Mbd3 expression
Gapdh*
Pou5f1
Nanog
Pramel4*
Pramel5*
Pramel6*
Pramel7*
Ppp2r2c
2410076I21Rik
Sohlh2
Sfrp1
Aes
Yaf2
Dazl
Peg3
Htra1
Pak1
Dppa3*
Primer sequences (5⬘-3⬘)
TGTAGCCACCTAGCTCAAGG
TGTAGCCACCTAGCTCAAGG
TCCAGGTCTCAGTGCAGGGA
GTGTTCCTACCCCCAATGTG
CCAACGAGAAGAGTATGAGGC
GTGCATATACTCTCTCCTTCCC
GAAAACGCTGCTGCAACATA
GCATTCCAGCACTGTCTGAG
AGATTCCAGGGCTCATCCTT
AGAGAACCCACATGGCTTTG
TGATCGAGGAAAAAGTGCGG
TGAAAGCCAAGGGAAGGACC
CCCCCTTCTTCCATCATCATC
CATGTTGGCTGCTCTGACCT
CACCTTCAACATTTCCCTGG
CACTGGTATTTCCTGCATCCTC
GTCCTTACATGTACCATTCTGTGAC
CCTGAGGAGGAAGAGAGCAAC
TTTGTCCCTTCCCTTAGCCT
TGACCAAGCTCTCTGCAAGTG
CTTTCCCAAGAGAAGGGTCC
CACGCTGGCGACTCTTATTC
TCCGCAAACTCCTATTTCTG
TGACTTCCTGGTGGGCTGCT
GTCATTGAGAGCAATGCCAG
AGAGCAGTGACGGGAACAGAG
AGCTACCCTCAAACTCCTGGT
GAGCAGTCGGGTGTTCCTAC
TACTGGACCTCCCCAAGAAA
ACTTTCTTGGGCTGCCTTTT
GGATTTGGCTTGGCATACAT
GATACCCAACACCCTCCAAG
CCACCTCTTCCACAAATGCTG
GCCATCCTTTCTCCCCTTGTT
CAAAACACACCTGGGAATCACT
GAAGAGGGGAGGGAAGTTTG
GGAGTGACACCTCAGTTCTGTG
GACTCCAACAAAACAGCAGACAA
TCAGTCTCAAGGGGTCTGGG
GTCACTGTACTCCGGGTTCC
AGAAACTTGTGCTGCTGAGGC
TGCAGAGACATCTGAATGGC
*Bortvin et al. (Bortvin et al., 2003)
The failure of Mbd3–/– embryos to expand their pluripotent cell
population after 4.5 dpc could be due to apoptosis and/or quiescence
of these cells. In order to address the possibility of increased cell
death in Mbd3–/– ICM-derived cells, 5.5 dpc embryos were stained
for activated caspase-3, a marker of apoptosis (Krajewska et al.,
1997). No Oct4-caspase-3 double-positive cells were found in any
Mbd3–/– embryos (n=3), and were found only rarely in wild-type
Fig. 1. Mbd3 expression in pre- and periimplantation development. (A) Phase contrast
microscopy (top panels) and anti-Mbd3 staining
(bottom panels) of wild-type embryos at indicated
stages. (B) Staining of morulae (top panels) and
blastocysts (bottom panels) with anti-Mbd3 antibodies
(green; middle panels) produces a strong, nuclear
signal in all cells of wild-type and Mbd3+/– embryos,
but only a faint nuclear signal in the Mbd3–/– morulae
and no staining in Mbd3–/– blastocysts. The genotypes
of embryos are indicated in the middle panel.
DEVELOPMENT
were recovered at sub-mendelian frequencies at 5.5 dpc and 6.5
dpc, by 8.5 dpc the number of null embryos recovered reverted to
the expected 25%. This indicates that our failure to isolate some
Mbd3–/– embryos immediately after implantation is due to their
very small size, whereas by 8.5 dpc, null conceptuses have grown
a large ectoplacental cone and are easily identified (Table 2 and
Fig. 2C).
Development 134 (6)
Table 2. Number and genotype of embryos produced by Mbd3
heterozygote intercrosses
Age (dpc)
3.5
4.5
5.5
6.5
8.5
+/+
+/–
–/–
n
40 (24.0%)
12 (29.3%)
21 (25.9%)
6 (31.6%)
9 (20.5%)
83 (49.7%)
18 (43.9%)
50 (61.7%)
10 (52.6%)
23 (52.3%)
44 (26.3%)
11 (26.8%)
10 (12.3%)
3 (15.8%)
12 (27.3%)
167
41
81
19
44
embryos (8 of 16 embryos) (see Fig. S1A in the supplementary
material). To determine whether loss of Mbd3 results in quiescence
of late epiblast cells, embryos were stained for Ki67 (Mki67), a
marker of proliferating cells (Gerdes, 1990). Ki67-expressing cells
are detectable in both the extra-embryonic tissues and in the Oct4expressing cells of both wild-type and Mbd3–/– embryos at 5.5 dpc
(see Fig. S1B in the supplementary material). Thus, we find no
evidence for death or quiescence of ICM descendents in the absence
of Mbd3 at 5.5 dpc.
The finding that Mbd3-null ICMs fail to expand their pluripotent
cell population was surprising given that Mbd3-null ES cells are
viable and maintain Oct4 expression even when induced to
differentiate in chimeric embryos (Kaji et al., 2006). The epiblast,
extra-embryonic ectoderm, and primitive endoderm show a complex
interdependence during normal development, such that a defect in
one tissue can result in developmental abnormalities in an adjacent
tissue (Guzman-Ayala et al., 2004; Murray and Edgar, 2000).
Therefore, we next assessed whether other cell types were formed
properly in mutant peri-implantation embryos. Double-staining of
Mbd3–/– 5.5 dpc embryos for Oct4 and ␣7 integrin, a marker of
extra-embryonic ectoderm and trophectoderm (Klaffky et al., 2001),
showed that although the ␣7 integrin-expressing cells are distinct
from and surround the Oct4-expressing cells, mutant embryos do not
form an organised extra-embryonic ectoderm structure (Fig. 3A,
bottom panels). Similarly, Mash2 (Ascl2 – Mouse Genome
Informatics) expression, which normally marks the developing
ectoplacental cone, was detectable over the entire mutant embryo
(Fig. 3B). Cdx2, which is normally expressed in trophoblast stem
cells and in extra-embryonic ectoderm (Strumpf et al., 2005), was
detectable in only a few cells by whole-mount in situ hybridisation
in 5.5 dpc Mbd3–/– embryos, again consistent with a lack of extraembryonic ectoderm organisation (Fig. 3B). The fact that Mbd3-null
embryos could form an ectoplacental cone (Fig. 2C) and were able
to implant, indicates that some trophectoderm lineage cells could
proliferate and function in the absence of Mbd3. Nevertheless, we
saw no evidence for expansion of the Cdx2-expressing cell
population or formation of extra-embryonic ectoderm in mutant
embryos after implantation.
Staining embryos for Oct4 and Gata4, an endoderm marker,
revealed that although Mbd3–/– embryos show normal endoderm
specification at 4.5 dpc (Fig. 2B), by 5.5 dpc mutant embryos have
failed to form the organised visceral endoderm epithelium seen in
wild-type embryos at this stage (Fig. 3C). In addition to the
Gata4-positive cells and the Oct4-positive cells, presumably
indicating primitive endoderm and primitive ectoderm,
respectively, mutant embryos also contained Gata4-Oct4 doublepositive cells (n=3) (Fig. 3C). Oct4-Gata4 double-positive cells
were never observed in wild-type embryos at this stage (n=12),
but were characteristic of early primitive endoderm cells in the
ICMs of 4.5 dpc embryos (e.g. Fig. 2B). This persistence of Oct4-
Fig. 2. Abnormal morphology and loss of epiblast after implantation. (A) One litter of embryos at 3.5 dpc was stained for Oct4 expression
(green). Genotypes for each embryo are indicated in the middle panel. (B) Embryos at 4.5 dpc were stained with anti-Oct4, anti-Nanog and antiGata4 antibodies. Images taken with independent wavelength were coloured in green for Oct4 and Nanog, red for Gata4. Note Gata4-positive
primitive endoderm cells maintain Oct4 protein (yellow cells, middle panels) at this stage in both heterozygous and homozygous null embryos.
(C) Mbd3+/– and Mbd3–/– embryos at indicated stages shown in phase contrast (top panels of each set) or stained for Oct4 (green; bottom panels of
each set). Asterisks indicate non-specific staining at ectoplacental cone.
DEVELOPMENT
1126 RESEARCH ARTICLE
Mbd3 and ICM potential
RESEARCH ARTICLE 1127
Gata4 double-positive cells in 5.5 dpc Mbd3–/– embryos, as well
as the lack of robust expression of Hex (Hhex – Mouse Genome
Informatics), a marker of distal visceral endoderm in 5.5 dpc
embryos (Rodriguez et al., 2001) (see Fig. S2 in the
supplementary material), indicates that primitive endoderm
formation is also abnormal in these embryos.
To discern whether Mbd3 is indeed required for normal function
of extra-embryonic tissues, wild-type, GFP-expressing ES cells
were aggregated with Mbd3–/– morulae and allowed to develop for
several days in utero. In morula aggregation experiments with ES
cells, the extra-embryonic tissues are formed by the host embryo,
whereas the ES cells contribute primarily to the epiblast (Tam and
Rossant, 2003). Mbd3–/– embryo/ES cell chimeras contained a
significant number of GFP-expressing, ES-derived cells at 5.5 dpc;
however, they formed neither a cavitated epiblast nor an organised
extra-embryonic ectoderm (Fig. 3D; n=3). Thus, a wild-type, ES
cell-derived epiblast was not able to rescue the Mbd3–/– embryonic
phenotype at 5.5 dpc (Fig. 3D) or 6.5 dpc (data not shown). We
therefore conclude that Mbd3 is necessary for normal development
of both the embryonic and extra-embryonic tissues in periimplantation embryos.
Mbd3 is required for epiblast expansion in vivo
and ex vivo
Given the different developmental capacity of Mbd3–/– ES cells and
ICM cells in embryos, we sought to characterise more fully the ICM
phenotype of Mbd3–/– embryos independently of the extraembryonic phenotype. In order to determine whether the loss of
Oct4-expressing cells seen in postimplantation Mbd3–/– embryos is
due to an autonomous defect, or to some developmental or
environmental cue, the preimplantation period was extended by
subjecting blastocysts to diapause (Buehr and Smith, 2003). In this
context, epiblast cells and primitive endoderm cells are spatially
distinct, with the former expressing both Oct4 and Nanog while the
latter express Oct4 and Gata4 (Fig. 4A). As in non-delayed 5.5 dpc
embryos, Mbd3–/– blastocysts subjected to diapause for 2 days (i.e.
at 5 days after fertilisation) generally contained few, if any,
Oct4/Nanog-expressing epiblast cells, whereas all embryos
contained a Gata4-expressing primitive endoderm layer that was
comparable in size to that see in wild-type or heterozygous
littermates (Fig. 4A). Thus, we conclude that the loss of epiblast
cells in Mbd3-null embryos occurs independently of the process of
implantation.
DEVELOPMENT
Fig. 3. Mbd3 is required for epiblast maturation and extra-embryonic development. (A) Wild-type (top panels) and homozygous null
(bottom panels) embryos at 5.5 dpc were stained for Oct4 (green) and ␣7 integrin (red). (B) Whole-mount in situ hybridisation of heterozygous
(top) and homozygous null (bottom) embryos at 5.5 dpc for Cdx2 (left-hand panels), and Mash2 (right-hand panels). (C) Heterozygous (top panels)
and homozygous null (bottom panels) embryos at 5.5 dpc were stained for Gata4 (red) and Oct4 (green). A close-up of the homozygous null
embryo is shown in the inset at the bottom of each panel to illustrate co-expression of Oct4 and Gata4 in a subset of cells (arrow), in addition to
Oct4 or Gata4 single-positive cells (asterisk and arrowhead, respectively). (D) Chimeric embryos made with wild-type ES cells expressing GFP (green)
and embryos obtained from Mbd3 heterozygote intercrosses. The genotype of the embryo used for each chimera was determined by Mbd3
staining (red) in GFP-negative (i.e. host-derived) cells.
1128 RESEARCH ARTICLE
Development 134 (6)
To exclude any possible influence of the trophectoderm on the
growth of mutant epiblasts, we next investigated the growth
potential of isolated Mbd3–/– ICMs ex vivo. ICMs from 3.5 dpc
blastocysts were isolated away from the surrounding
trophectoderm by immunosurgery and cultured in the presence of
LIF. In most cases, the outgrowths from Mbd3–/– ICMs were
distinguishable from those of wild-type or Mbd3+/– ICMs from
the first or second day of culture, producing a smaller cell mass
and tighter cell junctions between outgrowing endoderm cells
(Fig. 4B). After 3 days in culture, only 32% of Mbd3–/–
outgrowths contained a recognisable cell mass as compared with
79% or 86% of wild-type or heterozygous outgrowths,
respectively (Fig. 4C). Mbd3–/– cell mass outgrowths were
invariably smaller than those produced by wild-type or
heterozygous ICMs, and contained few if any Oct4-positive cells
(Fig. 4B,D). By contrast, the endoderm produced by Mbd3–/–
outgrowths expressed Gata4 and Sparc, a marker of differentiated
parietal endoderm (Holland et al., 1987) (data not shown). Thus,
we conclude that although dispensable for primitive endoderm
growth, Mbd3 is required for the expansion of Oct4-expressing
cells during ICM culture that is essential for ES cell derivation
(Buehr and Smith, 2003).
Misregulation of gene expression in Mbd3–/– ICMs
Mbd3 is a crucial component of the NuRD co-repressor complex
(Kaji et al., 2006). Therefore, the failure of Mbd3–/– ICMs to expand
their pluripotent cell population is likely to be due to aberrant gene
expression patterns in the ICMs of Mbd3-null preimplantation
embryos. We reasoned that gene expression changes resulting in the
observed embryonic phenotypes, rather than occurring as a
secondary consequence of them, should be present in Mbd3-null
ICMs after the loss of maternally-derived Mbd3 protein, but prior to
the onset of morphological abnormalities, i.e. in 3.5 dpc and 4.5 dpc
ICMs. To identify such genes, we monitored gene expression in
wild-type and Mbd3–/– 3.5 dpc and 4.5 dpc ICMs by RT-PCR (Fig.
5). To make cDNA from individual ICMs, we used a single-cell
cDNA amplification method that includes multiple amplification
steps (see Materials and methods for details). In order to control for
possible threshold effects and/or amplification bias, cDNA was also
made from single ES cells and compared with ES cell cDNA
prepared using a conventional method. As shown in Fig. 5, the
amplified cDNA produced identical results to those obtained using
conventional cDNA for a number of control genes (Mbd3, Gapdh,
Oct4, Nanog, Pramel4, Pramel5). It is noteworthy that the reported
decrease in Nanog expression in 4.5 dpc ICMs (Chambers et al.,
DEVELOPMENT
Fig. 4. ICMs lacking Mbd3 fail to expand pluripotent cells in vivo and in vitro. (A) Embryos in which implantation was delayed by diapause
were collected after 3 days of diapause (See Materials and methods) and stained for Oct4 (white), Nanog (green) and Gata4 (red). Nuclei were
stained with DAPI (blue). Genotype of embryos is indicated in the phase contrast images. (B) ICMs from Mbd3+/– (top panels) or Mbd3–/– (middle
and bottom panels) 3.5 dpc embryos were isolated using immunosurgery and allowed to attach and outgrow in the presence of LIF for 3 days.
Pictures were taken every 24 hours. (C) Number and morphology of ICM outgrowths after 3 days in culture. Any outgrowths with a cell mass in
addition to monolayer endoderm were scored as having ‘cell mass+endoderm’ irrespective of the size of the cell mass. Outgrowths with adherent
cells only were classed as ‘endoderm only’. Outgrowths containing fewer than 10 cells after 3 days were classed as ‘<10 cells’. The number of
outgrowths of each genotype is indicated (N). (D) Cell masses isolated from ICM outgrowths cultured for 5 days were stained for Oct4 (green).
Genotyopes are indicated in each panel.
Mbd3 and ICM potential
RESEARCH ARTICLE 1129
genes either showed no expression changes over this period (Sfrp1,
Aes, Yaf2), or showed an increase in expression between 3.5 and 4.5
dpc (Dazl, Peg3, Htra1) in wild-type ICMs (Fig. 5). Each of these
genes showed increased expression in Mbd3–/– ICMs and ES cells,
except Peg3, which showed decreased expression. It is notable that
misexpression of Sohlh2, Sfrp1, Aes, Yaf2, Dazl and Htra1 could
already be detected by 3.5 dpc in mutant ICMs. It is not clear which
of these genes, if any, are direct targets of NuRD-mediated silencing
in ICMs; however, this failure of efficient silencing might indicate that
the observed developmental failure of pluripotent cells in Mbd3-null
ICMs derives from inappropriate gene expression initiating at or
before 3.5 dpc (Fig. 6).
2003; Saba-El-Leil et al., 2003) is detectable in our ICM cDNAs,
and indicates some degree of normal ICM development between 3.5
and 4.5 dpc in the absence of Mbd3 (Fig. 5).
By monitoring expression of genes found to be misexpressed in
Mbd3–/– ES cells (K.K. and B.H., unpublished), we identified 11 genes
showing altered expression patterns in Mbd3–/– ICMs at 3.5 and/or 4.5
dpc (Fig. 5). Expression of three of these genes (Pramel6, Pramel7,
Peg3) could not be detected in amplified ES cell cDNA, probably
owing to low expression levels, although expression was detected in
ICM samples and in conventionally prepared ES cell cDNA. The
expression patterns of genes found to be misexpressed in Mbd3–/–
ICMs fall broadly into two categories. Pramel6, Pramel7, Ppp2r2c,
2410076I21Rik and Sohlh2 were all expressed in wild-type 3.5 dpc
ICMs, but expression was either decreasing or extinguished in 4.5 dpc
ICMs (Fig. 5). Mbd3–/– ICMs failed to silence appropriately any of
these genes at 4.5 dpc, as did Mbd3–/– ES cells. The remaining six
Mbd3/NuRD is required for programmed
maturation of pluripotent ICM cells and
development of extra-embryonic tissues
Maternal Mbd3 protein is lost in embryos by 3.5 dpc, at which point
altered gene expression patterns are detectable in ICM cells, followed
by the appearance of morphological abnormalities within 48 hours.
Mbd3–/– embryos at 5.5 dpc lack a mature late epiblast, proper spatial
organisation and distinct extra-embryonic ectoderm and visceral
DEVELOPMENT
Fig. 5. Gene expression in 3.5 dpc ICMs, 4.5 dpc ICMs and ES cells.
Amplified cDNA from individual ICMs and single ES cells were mixed
according to the genotype and gene expression was assayed by semiquantitative PCR. cDNA made with a conventional method from 1 ␮g
total RNA of ES cells was used to assess the quality of amplified cDNA.
The number of PCR cycles for each gene is shown alongside (left for
amplified cDNA, right for conventional ES cell cDNA). ‘(+/?)’ indicates
embryos of either (+/+) or (+/–) genotype.
DISCUSSION
Epigenetic silencing is important for early
development and ES cell derivation
ES cells can be efficiently derived from the ICMs of 3.5 dpc embryos,
4.5 dpc ICMs and from delayed blastocysts (Brook and Gardner,
1997). Mbd3–/– embryos can be recovered at each of these stages that
contain Oct4-Nanog double-positive cells; however, this presumptive
epiblast precursor population fails to expand in vivo or to outgrow in
culture. This finding is surprising given the fact that Mbd3 is not
required for viability or self-renewal of ES cells (Kaji et al., 2006).
These data, along with our identification of differential gene
expression between 3.5 dpc ICMs, 4.5 dpc ICMs and ES cells,
demonstrate that although each of these cell types are pluripotent, they
differ from each other in terms of gene expression and requirements
for expansion; ES cells, which in practice are most often derived from
3.5 dpc ICMs, are most similar to 4.5 dpc ICMs. In addition, we show
that Mbd3/NuRD is necessary for proper gene expression in 3.5 dpc
and 4.5 dpc ICMs, and is important for development of the ICMderived cell population in peri-implantation embryos.
Several epigenetic silencing proteins have been reported to be
important for early murine development (Bernstein et al., 2003;
Cowley et al., 2005; Dannenberg et al., 2005; David et al., 2003;
Dodge et al., 2004; Hendrich et al., 2001; O’Carroll et al., 2001;
Rayasam et al., 2003), and often a requirement in ES cells is inferred
from the failure of blastocysts to outgrow in culture. Here, we show
that Mbd3, a component of the NuRD co-repressor complex, is
required for the initial step of ES cell derivation, namely expansion
of the early epiblast cell population, despite being dispensable for
ES cell self-renewal. This requirement in early embryonic
development and for the growth of ICM cells in vitro, but not for ES
cell maintenance, has been reported for only one other epigenetic
silencing protein, namely Dicer, a protein important in RNAimediated gene silencing (Bernstein et al., 2003; Kanellopoulou et
al., 2005; Murchison et al., 2005). Recently, O’Neill et al. identified
differences in histone acetylation patterns between ICMs and ES
cells, possibly indicating epigenetic changes important for ES cell
derivation from ICMs (O’Neill et al., 2006). Together, these data
indicate that epigenetic silencing plays an important role in the
developmental and gene expression changes that occur during the
development of pluripotent cells in vivo and for ES cell derivation.
1130 RESEARCH ARTICLE
Development 134 (6)
Fig. 6. Transition of pluripotent cells and function of Mbd3. Pluripotency (indicated as black shading in cells and embryos) is passed on from
the 3.5 dpc ICM to the early epiblast of 4.5 dpc embryos, and then to the late epiblast of 5.5 dpc embryos. During this transition, the expression
levels of the listed genes change as shown. Loss of Mbd3 results in misregulation of genes with asterisks at 3.5 dpc and/or 4.5 dpc, followed by
failure of epiblast proliferation and proaminiotic cavity formation at 5.5 dpc. Whereas Nanog downregulation occurs between 3.5 and 4.5 dpc, it is
not clear whether expression levels increase during ES cell derivation, or whether ES cells are derived from rare Nanog high-expressing cells at 4.5
dpc. Mbd3/NuRD is required for proliferation of ICM cells in vivo and for isolated ICMs to give rise to a proliferating epiblast in the presence of LIF in
culture. Mbd3 is also required for lineage commitment in ES cells (Kaji et al., 2006).
extra-embryonic ectoderm (Hanna et al., 2002). In addition, whereas
most Mbd3–/– ICMs were able to give rise to adherent primitive
endoderm cells expressing Gata4, even these cells showed a more
compact growth morphology than did wild-type primitive endoderm
outgrowths, indicating some defect in proliferation and/or adhesion
consistent with the disorganised visceral endoderm seen in mutant
embryos at 5.5 dpc. Further analysis of Mbd3-deficient extraembryonic tissues and of Mbd3-null trophectoderm stem cells and
endoderm stem cells (Kunath et al., 2005; Tanaka et al., 1998) will be
important for defining the tissue-specific and general requirements for
Mbd3/NuRD during early postimplantation development.
Transcriptional misregulation in Mbd3–/– ICMs
Although it is becoming clear that in 3.5 dpc ICMs there may be
distinct cell populations fated to be either epiblast or primitive endoderm
with distinct gene expression patterns (Chazaud et al., 2006; Kurimoto
et al., 2006), gene expression changes that accompany the maturation
of epiblast cells upon implantation remain largely uncharacterised. We
identified 11 genes that show altered expression patterns in 3.5 and/or
4.5 dpc ICMs in the absence of Mbd3/NuRD. Sohlh2, Sfrp1, Aes and
Dazl show increased expression immediately after loss of maternallyderived Mbd3 protein at 3.5 dpc, and misregulation persists in 4.5 dpc
ICMs and in ES cells, making these genes good candidates to be
predominantly and directly regulated by Mbd3/NuRD. Sfrp1 is a
secreted antagonist of the Wnt signaling pathway (Kawano and Kypta,
2003); Aes is a naturally occurring dominant-negative molecule
alleviating transcriptional repression by TLE/GRG proteins, which bind
and repress various transcription factors including Tcf proteins, the
nuclear mediators of canonical Wnt signaling (Brantjes et al., 2001).
There are several Wnt pathway molecules expressed in preimplantation
embryos that can function in both canonical and non-canonical Wnt
pathways (Kemp et al., 2005). Therefore, it will be interesting to
determine whether misregulation of Sfrp1 and Aes, alone or in
combination, can affect the normal development of pluripotent cells.
The two other genes showing early misexpression, Dazl, an RNAbinding translational regulator, and Sohlh2, a basic helix-loop-helix
(bHLH) protein, are both exclusively expressed in germ cells
DEVELOPMENT
endoderm structures, although they do contain cells expressing
markers for each of these lineages. Epiblast cells in 5.5 dpc Mbd3–/–
embryos display characteristics of 3.5 dpc ICM cells, such as a lack
of expansive growth or cavitation, proximal localisation and the
presence of Oct4-Gata4 double-positive cells. Mbd3-null embryos
lose Oct4-expressing cells by 7.5 dpc, while the ectoplacental cone
continues to grow. Given that we could find no evidence that the Oct4expressing cells either die by apoptosis or undergo cell cycle arrest, it
may be that they fail to make the transition from ICM cells to become
late epiblast, and instead all gradually lose Oct4 expression while
activating Gata4 expression and become primitive endoderm.
Although the epiblast, extra-embryonic ectoderm and primitive
endoderm interact with each other during normal development at
implantation, we feel it is unlikely that the failure of epiblast
development seen in Mbd3–/– embryos in vivo can be explained solely
by failure of one of the extra-embryonic tissues. Erk2 (Mapk1 –
Mouse Genome Informatics) mutant embryos can form a cavitated
epiblast without forming either an ectoplacental cone or extraembryonic ectoderm (Saba-El-Leil et al., 2003), whereas embryos
lacking Elf5, a transcription factor belong to the Ets superfamily, can
develop a cavitated epiblast while lacking an extra-embryonic
ectoderm (Donnison et al., 2005), indicating that extra-embryonic
ectoderm is not strictly required for epiblast growth in vivo. We cannot
rule out the possibility that the defect we see in Mbd3–/– ICM cells is
actually caused by some defect in very early trophectoderm cells.
However, we feel this is very unlikely given the fact that ES cell
derivation is possible from Cdx2-null embryos, which lack any
detectable trophectoderm functions (Meissner and Jaenisch, 2006),
demonstrating that early failure of trophectoderm lineages does not
preclude ICM outgrowth in vitro. Although Cdx2-null blastocysts
appear to have trophectoderm-like cells, these cells express Nanog and
thus may not actually be trophectoderm (Strumpf et al., 2005).
It is also unlikely that the Mbd3-null embryonic phenotype is
exclusively due to an epiblast defect, as wild-type ES cells were
unable to rescue the mutant phenotype in chimeric embryos, and
embryos lacking an epiblast due to mutation in Foxd3, a member of
the forkhead family of transcriptional regulators, are able to form
(Ballow et al., 2006; Ruggiu et al., 1997). By contrast, expression of
another germ cell-specific gene, Dppa3 (also called Stella or Pgc7),
is not disturbed in Mbd3–/– ICMs despite the fact that it is strongly
downregulated in Mbd3–/– ES cells (Fig. 5) (Kaji et al., 2006). Thus,
it is unlikely that misregulation of Dazl and Sohlh2 in Mbd3–/– ICMs
reflects some commitment towards the germ cell lineage; however,
it remains possible that their overexpression in Mbd3–/– ICMs and
ES cells interferes with normal development and/or lineage
commitment of pluripotent cells.
The Pramel (PRAME-like) genes encode proteins similar to the
human preferentially expressed antigen in melanoma, or PRAME,
protein (Bortvin et al., 2003). PRAME is an antigen expressed in a
wide variety of human tumours (van Baren et al., 1998) and was
recently shown to act as a dominant repressor of retinoic acid
receptor signalling and to inhibit retinoic acid-induced
differentiation of mouse embryonal carcinoma cells (Epping et al.,
2005). Although the function of the Pramel proteins is not known,
their preimplantation-specific expression pattern in mouse (Fig. 5),
and the existence of families of Pramel genes in the genomes of
other mammals, Xenopus tropicalis and Gallus gallus, might
indicate that they play some conserved role in early vertebrate
development (Birtle et al., 2005) (B.H., unpublished observations).
Molecular and transcriptional differences
between ICM cells and ES cells
ES cells are derived from ICMs, inheriting their pluripotency and
acquiring the ability for indefinite self-renewal (Brook and Gardner,
1997). ES cell derivation remains an inefficient process, the efficiency
of which varies between different inbred mouse strains and is currently
not possible in other rodent species (Buehr and Smith, 2003;
Robertson, 1987). Despite the growing popularity of ES cell research,
surprisingly little is known about the molecular differences between
ICM/epiblast cells and ES cells. In addition to identifying Mbd3dependent gene expression patterns in the ICMs of preimplantation
stage embryos and ES cells, we also found seven genes (Pramel4,
Pramel5, Pramel6, Pramel7, Ppp2c2r, 2410076I21Rik and Sohlh2)
downregulated and 2 genes (Htra1 and Pak1) upregulated between 3.5
dpc and 4.5 dpc in wild-type ICMs (Fig. 5). The expression of most
of these genes in wild-type ES cells is more similar to that in 4.5 dpc
ICMs than in 3.5 dpc ICMs. These molecular data support the
assertion that the origin of ES cells is early epiblast rather than 3.5 dpc
ICM (Brook and Gardner, 1997). This indicates that during ES cell
derivation, pluripotent cells in 3.5 dpc ICMs must first mature in
culture to a 4.5 dpc-like state before undergoing the necessary
epigenetic changes that enable them to become ES cells (Fig. 6). ICMs
at 4.5 dpc, which include the early epiblast, also show some gene
expression differences when compared with ES cells. Nanog is
robustly expressed in ES cells, but its mRNA levels are decreasing in
4.5 dpc ICMs (Chambers et al., 2003), and Pak1 expression is also
lower than in ES cells (Fig. 5). By contrast, expression of Pramel7,
2410076I21Rik and Htra1 is higher in 4.5 dpc ICMs than in ES cells.
Two genes (Pak1 and Dppa3) showed no significant misregulation in
Mbd3–/– ICMs, although these genes are misregulated in Mbd3–/– ES
cells (Fig. 5) (Kaji et al., 2006), indicating a difference in control of
epigenetic silencing between ICM cells and ES cells.
The effect of loss of Mbd3 is different in 4.5 dpc ICMs than in ES
cells. Pak1 and Dppa3 expression is misregulated in Mbd3–/– ES
cells, but not in Mbd3–/– 4.5 dpc ICMs. Furthermore, whereas
Mbd3–/– ICM cells fail to initiate the rapid proliferation characteristic
of late epiblast and do not maintain expression of Oct4, Mbd3–/– ES
cells show only a modest growth defect and robustly express Oct4
even when induced to differentiate (Kaji et al., 2006). While we
RESEARCH ARTICLE 1131
cannot exclude the possibility that some of the differences observed
here come from the presence of primitive endoderm cells in 4.5 dpc
ICMs, these data further illuminate the differences between ICM
cells and ES cells. Although the molecular events that occur during
ES cell derivation are largely unknown, here we show that Mbd3 is
necessary for ICM cells to gain ES cell-like properties of increased
proliferation and an appropriate gene expression profile necessary
for both in vivo development and ES cell derivation.
We thank Renee McLay for aggregation chimaeras, Alan McClure, Carol
Manson and John Agnew for animal husbandry, Ann Sutherland for the ␣7
integrin antibody, Ian Chambers for the anti-Nanog antibody, Josh Brickman
and Korinna Henseleit for Hex-GFP mice, and Austin Smith, Val Wilson, Tilo
Kunath, Laura Batlle-Morera and Nicola Reynolds for advice, discussions and
comments on the manuscript. K.K. was the recipient of a postdoctoral
fellowship from the Japanese Society for the Promotion of Science. This work
was funded by the Wellcome Trust, the UK Medical Research Council and by a
BBSRC UK-Japan Partnering Award.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/6/1123/DC1
References
Ahringer, J. (2000). NuRD and SIN3 histone deacetylase complexes in development.
Trends Genet. 16, 351-356.
Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H. F., John, R. M.,
Gouti, M., Casanova, M., Warnes, G., Merkenschlager, M. et al. (2006).
Chromatin signatures of pluripotent cell lines. Nat. Cell Biol. 8, 532-538.
Ballow, D. J., Xin, Y., Choi, Y., Pangas, S. A. and Rajkovic, A. (2006). Sohlh2 is a
germ cell-specific bHLH transcription factor. Gene Expr. Patterns 6, 1014-1018.
Bernstein, B. E., Mikkelsen, T. S., Xie, X., Kamal, M., Huebert, D. J., Cuff, J., Fry,
B., Meissner, A., Wernig, M., Plath, K. et al. (2006). A bivalent chromatin
structure marks key developmental genes in embryonic stem cells. Cell 125, 315326.
Bernstein, E., Kim, S. Y., Carmell, M. A., Murchison, E. P., Alcorn, H., Li, M. Z.,
Mills, A. A., Elledge, S. J., Anderson, K. V. and Hannon, G. J. (2003). Dicer is
essential for mouse development. Nat. Genet. 35, 215-217.
Birtle, Z., Goodstadt, L. and Ponting, C. (2005). Duplication and positive selection
among hominin-specific PRAME genes. BMC Genomics 6, 120.
Bortvin, A., Eggan, K., Skaletsky, H., Akutsu, H., Berry, D. L., Yanagimachi, R.,
Page, D. C. and Jaenisch, R. (2003). Incomplete reactivation of Oct4-related
genes in mouse embryos cloned from somatic nuclei. Development 130, 16731680.
Bowen, N. J., Fujita, N., Kajita, M. and Wade, P. A. (2004). Mi-2/NuRD: multiple
complexes for many purposes. Biochim. Biophys. Acta 1677, 52-57.
Boyer, L. A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L. A., Lee, T. I.,
Levine, S. S., Wernig, M., Tajonar, A., Ray, M. K. et al. (2006). Polycomb
complexes repress developmental regulators in murine embryonic stem cells.
Nature 441, 349-353.
Bradley, A., Evans, M., Kaufman, M. H. and Robertson, E. (1984). Formation of
germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature 309,
255-256.
Brantjes, H., Roose, J., van De Wetering, M. and Clevers, H. (2001). All Tcf HMG
box transcription factors interact with Groucho-related co-repressors. Nucleic Acids
Res. 29, 1410-1419.
Brook, F. A. and Gardner, R. L. (1997). The origin and efficient derivation of
embryonic stem cells in the mouse. Proc. Natl. Acad. Sci. USA 94, 5709-5712.
Buehr, M. and Smith, A. (2003). Genesis of embryonic stem cells. Philos. Trans. R.
Soc. Lond. B Biol. Sci. 358, 1397-1402.
Buehr, M., Nichols, J., Stenhouse, F., Mountford, P., Greenhalgh, C. J.,
Kantachuvesiri, S., Brooker, G., Mullins, J. and Smith, A. G. (2003). Rapid loss
of Oct-4 and pluripotency in cultured rodent blastocysts and derivative cell lines.
Biol. Reprod. 68, 222-229.
Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. and
Smith, A. (2003). Functional expression cloning of nanog, a pluripotency
sustaining factor in embryonic stem cells. Cell 113, 643-655.
Chazaud, C., Yamanaka, Y., Pawson, T. and Rossant, J. (2006). Early lineage
segregation between epiblast and primitive endoderm in mouse blastocysts
through the Grb2-MAPK pathway. Dev. Cell 10, 615-624.
Cowley, S. M., Iritani, B. M., Mendrysa, S. M., Xu, T., Cheng, P. F., Yada, J.,
Liggitt, H. D. and Eisenman, R. N. (2005). The mSin3A chromatin-modifying
complex is essential for embryogenesis and T-cell development. Mol. Cell. Biol. 25,
6990-7004.
Dannenberg, J. H., David, G., Zhong, S., van der Torre, J., Wong, W. H. and
Depinho, R. A. (2005). mSin3A corepressor regulates diverse transcriptional
networks governing normal and neoplastic growth and survival. Genes Dev. 19,
1581-1595.
DEVELOPMENT
Mbd3 and ICM potential
David, G., Turner, G. M., Yao, Y., Protopopov, A. and DePinho, R. A. (2003).
mSin3-associated protein, mSds3, is essential for pericentric heterochromatin
formation and chromosome segregation in mammalian cells. Genes Dev. 17,
2396-2405.
Dodge, J. E., Kang, Y. K., Beppu, H., Lei, H. and Li, E. (2004). Histone H3-K9
methyltransferase ESET is essential for early development. Mol. Cell. Biol. 24,
2478-2486.
Donnison, M., Beaton, A., Davey, H. W., Broadhurst, R., L’Huillier, P. and
Pfeffer, P. L. (2005). Loss of the extraembryonic ectoderm in Elf5 mutants leads to
defects in embryonic patterning. Development 132, 2299-2308.
Epping, M. T., Wang, L., Edel, M. J., Carlee, L., Hernandez, M. and Bernards, R.
(2005). The human tumor antigen PRAME is a dominant repressor of retinoic acid
receptor signaling. Cell 122, 835-847.
Evans, M. J. and Kaufman, M. H. (1981). Establishment in culture of pluripotential
cells from mouse embryos. Nature 292, 154-156.
Fujita, N., Jaye, D. L., Geigerman, C., Akyildiz, A., Mooney, M. R., Boss, J. M.
and Wade, P. A. (2004). MTA3 and the Mi-2/NuRD complex regulate cell fate
during B lymphocyte differentiation. Cell 119, 75-86.
Gerdes, J. (1990). Ki-67 and other proliferation markers useful for
immunohistological diagnostic and prognostic evaluations in human malignancies.
Semin. Cancer Biol. 1, 199-206.
Guzman-Ayala, M., Ben-Haim, N., Beck, S. and Constam, D. B. (2004). Nodal
protein processing and fibroblast growth factor 4 synergize to maintain a
trophoblast stem cell microenvironment. Proc. Natl. Acad. Sci. USA 101, 1565615660.
Hanna, L. A., Foreman, R. K., Tarasenko, I. A., Kessler, D. S. and Labosky, P. A.
(2002). Requirement for Foxd3 in maintaining pluripotent cells of the early mouse
embryo. Genes Dev. 16, 2650-2661.
Hendrich, B. and Bird, A. (1998). Identification and characterization of a family of
mammalian methyl-CpG binding proteins. Mol. Cell. Biol. 18, 6538-6547.
Hendrich, B., Guy, J., Ramsahoye, B., Wilson, V. A. and Bird, A. (2001). Closely
related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse
development. Genes Dev. 15, 710-723.
Holland, P., Harper, S., McVey, J. and Hogan, B. (1987). In vivo expression of
mRNA for the Ca2+-binding protein SPARC (osteonectin) revealed by in situ
hybridization. J. Cell Biol. 105, 473-482.
Hong, W., Nakazawa, M., Chen, Y. Y., Kori, R., Vakoc, C. R., Rakowski, C. and
Blobel, G. A. (2005). FOG-1 recruits the NuRD repressor complex to mediate
transcriptional repression by GATA-1. EMBO J. 24, 2367-2378.
Hutchins, A. S., Mullen, A. C., Lee, H. W., Sykes, K. J., High, F. A., Hendrich, B.
D., Bird, A. P. and Reiner, S. L. (2002). Gene silencing quantitatively controls the
function of a developmental trans-activator. Mol. Cell 10, 81-91.
Iscove, N. N., Barbara, M., Gu, M., Gibson, M., Modi, C. and Winegarden, N.
(2002). Representation is faithfully preserved in global cDNA amplified
exponentially from sub-picogram quantities of mRNA. Nat. Biotechnol. 20, 940943.
Kaji, K., Caballero, I. M., MacLeod, R., Nichols, J., Wilson, V. A. and Hendrich,
B. (2006). The NuRD component Mbd3 is required for pluripotency of embryonic
stem cells. Nat. Cell Biol. 8, 285-292.
Kanellopoulou, C., Muljo, S. A., Kung, A. L., Ganesan, S., Drapkin, R.,
Jenuwein, T., Livingston, D. M. and Rajewsky, K. (2005). Dicer-deficient
mouse embryonic stem cells are defective in differentiation and centromeric
silencing. Genes Dev. 19, 489-501.
Kawano, Y. and Kypta, R. (2003). Secreted antagonists of the Wnt signalling
pathway. J. Cell Sci. 116, 2627-2634.
Kemp, C., Willems, E., Abdo, S., Lambiv, L. and Leyns, L. (2005). Expression of all
Wnt genes and their secreted antagonists during mouse blastocyst and
postimplantation development. Dev. Dyn. 233, 1064-1075.
Klaffky, E., Williams, R., Yao, C. C., Ziober, B., Kramer, R. and Sutherland, A.
(2001). Trophoblast-specific expression and function of the integrin alpha 7
subunit in the peri-implantation mouse embryo. Dev. Biol. 239, 161-175.
Krajewska, M., Wang, H. G., Krajewski, S., Zapata, J. M., Shabaik, A.,
Gascoyne, R. and Reed, J. C. (1997). Immunohistochemical analysis of in vivo
patterns of expression of CPP32 (Caspase-3), a cell death protease. Cancer Res.
57, 1605-1613.
Kunath, T., Arnaud, D., Uy, G. D., Okamoto, I., Chureau, C., Yamanaka, Y.,
Heard, E., Gardner, R. L., Avner, P. and Rossant, J. (2005). Imprinted Xinactivation in extra-embryonic endoderm cell lines from mouse blastocysts.
Development 132, 1649-1661.
Kurimoto, K., Yabuta, Y., Ohinata, Y., Ono, Y., Uno, K. D., Yamada, R. G.,
Ueda, H. R. and Saitou, M. (2006). An improved single-cell cDNA amplification
method for efficient high-density oligonucleotide microarray analysis. Nucleic Acids
Res. 34, e42.
Lee, T. I., Jenner, R. G., Boyer, L. A., Guenther, M. G., Levine, S. S., Kumar, R.
M., Chevalier, B., Johnstone, S. E., Cole, M. F., Isono, K. et al. (2006). Control
of developmental regulators by Polycomb in human embryonic stem cells. Cell
125, 301-313.
Martin, G. R. (1981). Isolation of a pluripotent cell line from early mouse embryos
cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad.
Sci. USA 78, 7634-7638.
Meissner, A. and Jaenisch, R. (2006). Generation of nuclear transfer-derived
pluripotent ES cells from cloned Cdx2-deficient blastocysts. Nature 439, 212-215.
Development 134 (6)
Murchison, E. P., Partridge, J. F., Tam, O. H., Cheloufi, S. and Hannon, G. J.
(2005). Characterization of Dicer-deficient murine embryonic stem cells. Proc. Natl.
Acad. Sci. USA 102, 12135-12140.
Murray, P. and Edgar, D. (2000). Regulation of programmed cell death by basement
membranes in embryonic development. J. Cell Biol. 150, 1215-1221.
Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D.,
Chambers, I., Scholer, H. and Smith, A. (1998). Formation of pluripotent stem
cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell
95, 379-391.
Niwa, H., Toyooka, Y., Shimosato, D., Strumpf, D., Takahashi, K., Yagi, R. and
Rossant, J. (2005). Interaction between Oct3/4 and Cdx2 determines
trophectoderm differentiation. Cell 123, 917-929.
O’Carroll, D., Erhardt, S., Pagani, M., Barton, S. C., Surani, M. A. and
Jenuwein, T. (2001). The polycomb-group gene Ezh2 is required for early mouse
development. Mol. Cell. Biol. 21, 4330-4336.
O’Neill, L. P., Vermilyea, M. D. and Turner, B. M. (2006). Epigenetic
characterization of the early embryo with a chromatin immunoprecipitation
protocol applicable to small cell populations. Nat. Genet. 38, 835-841.
Pelton, T. A., Sharma, S., Schulz, T. C., Rathjen, J. and Rathjen, P. D. (2002).
Transient pluripotent cell populations during primitive ectoderm formation:
correlation of in vivo and in vitro pluripotent cell development. J. Cell Sci. 115,
329-339.
Pratt, T., Sharp, L., Nichols, J., Price, D. J. and Mason, J. O. (2000). Embryonic
stem cells and transgenic mice ubiquitously expressing a tau-tagged green
fluorescent protein. Dev. Biol. 228, 19-28.
Rayasam, G. V., Wendling, O., Angrand, P. O., Mark, M., Niederreither, K.,
Song, L., Lerouge, T., Hager, G. L., Chambon, P. and Losson, R. (2003). NSD1
is essential for early post-implantation development and has a catalytically active
SET domain. EMBO J. 22, 3153-3163.
Robertson, E. J. (1987). Teratocarcinoma and Embryo-derived Stem Cells: A Practical
Approach. Oxford: IRL Press.
Rodriguez, P., Bonte, E., Krijgsveld, J., Kolodziej, K. E., Guyot, B., Heck, A. J.,
Vyas, P., de Boer, E., Grosveld, F. and Strouboulis, J. (2005). GATA-1 forms
distinct activating and repressive complexes in erythroid cells. EMBO J. 24, 23542366.
Rodriguez, T. A., Casey, E. S., Harland, R. M., Smith, J. C. and Beddington, R. S.
(2001). Distinct enhancer elements control Hex expression during gastrulation and
early organogenesis. Dev. Biol. 234, 304-316.
Rosen, B. and Beddington, R. S. (1993). Whole-mount in situ hybridization in the
mouse embryo: gene expression in three dimensions. Trends Genet. 9, 162-167.
Rossant, J. (1976). Postimplantation development of blastomeres isolated from 4and 8-cell mouse eggs. J. Embryol. Exp. Morphol. 36, 283-290.
Ruggiu, M., Speed, R., Taggart, M., McKay, S. J., Kilanowski, F., Saunders, P.,
Dorin, J. and Cooke, H. J. (1997). The mouse Dazla gene encodes a cytoplasmic
protein essential for gametogenesis. Nature 389, 73-77.
Saba-El-Leil, M. K., Vella, F. D., Vernay, B., Voisin, L., Chen, L., Labrecque, N.,
Ang, S. L. and Meloche, S. (2003). An essential function of the mitogenactivated protein kinase Erk2 in mouse trophoblast development. EMBO Rep. 4,
964-968.
Smith, A. G. (2001). Embryo-derived stem cells: of mice and men. Annu. Rev. Cell
Dev. Biol. 17, 435-462.
Snow, M. H. and Bennett, D. (1978). Gastrulation in the mouse: assessment of cell
populations in the epiblast of tw18/tw18 embryos. J. Embryol. Exp. Morphol. 47,
39-52.
Solter, D. and Knowles, B. B. (1975). Immunosurgery of mouse blastocyst. Proc.
Natl. Acad. Sci. USA 72, 5099-5102.
Strumpf, D., Mao, C. A., Yamanaka, Y., Ralston, A., Chawengsaksophak, K.,
Beck, F. and Rossant, J. (2005). Cdx2 is required for correct cell fate specification
and differentiation of trophectoderm in the mouse blastocyst. Development 132,
2093-2102.
Tam, P. P. and Rossant, J. (2003). Mouse embryonic chimeras: tools for studying
mammalian development. Development 130, 6155-6163.
Tanaka, S., Kunath, T., Hadjantonakis, A. K., Nagy, A. and Rossant, J. (1998).
Promotion of trophoblast stem cell proliferation by FGF4. Science 282, 2072-2075.
van Baren, N., Chambost, H., Ferrant, A., Michaux, L., Ikeda, H., Millard, I.,
Olive, D., Boon, T. and Coulie, P. G. (1998). PRAME, a gene encoding an antigen
recognized on a human melanoma by cytolytic T cells, is expressed in acute
leukaemia cells. Br. J. Haematol. 102, 1376-1379.
Wade, P. A., Gegonne, A., Jones, P. L., Ballestar, E., Aubry, F. and Wolffe, A. P.
(1999). Mi-2 complex couples DNA methylation to chromatin remodelling and
histone deacetylation. Nat. Genet. 23, 62-66.
Williams, C. J., Naito, T., Arco, P. G., Seavitt, J. R., Cashman, S. M., De Souza,
B., Qi, X., Keables, P., Von Andrian, U. H. and Georgopoulos, K. (2004). The
chromatin remodeler Mi-2beta is required for CD4 expression and T cell
development. Immunity 20, 719-733.
Zhang, Y., Ng, H. H., Erdjument-Bromage, H., Tempst, P., Bird, A. and
Reinberg, D. (1999). Analysis of the NuRD subunits reveals a histone deacetylase
core complex and a connection with DNA methylation. Genes Dev. 13, 19241935.
Zwaka, T. P. and Thomson, J. A. (2005). A germ cell origin of embryonic stem
cells? Development 132, 227-233.
DEVELOPMENT
1132 RESEARCH ARTICLE