Download The transcription factor AtDOF4.2 regulates shoot branching and

Biochem. J. (2013) 449, 373–388 (Printed in Great Britain)
373
doi:10.1042/BJ20110060
The transcription factor AtDOF4.2 regulates shoot branching and seed coat
formation in Arabidopsis
Hong-Feng ZOU1 , Yu-Qin ZHANG1 , Wei WEI, Hao-Wei CHEN, Qing-Xin SONG, Yun-Feng LIU, Ming-Yu ZHAO, Fang WANG,
Bao-Cai ZHANG, Qing LIN, Wan-Ke ZHANG, Biao MA, Yi-Hua ZHOU, Jin-Song ZHANG2 and Shou-Yi CHEN2
State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China
Plant-specific DOF (DNA-binding with one finger)-type
transcription factors regulate various biological processes. In
the present study we characterized a silique-abundant gene
AtDOF (Arabidopsis thaliana DOF) 4.2 for its functions in
Arabidopsis. AtDOF4.2 is localized in the nuclear region and
has transcriptional activation activity in both yeast and plant
protoplast assays. The T-M-D motif in AtDOF4.2 is essential
for its activation. AtDOF4.2-overexpressing plants exhibit an
increased branching phenotype and mutation of the T-M-D motif
in AtDOF4.2 significantly reduces branching in transgenic plants.
AtDOF4.2 may achieve this function through the up-regulation
of three branching-related genes, AtSTM (A. thaliana SHOOT
MERISTEMLESS), AtTFL1 (A. thaliana TERMINAL FLOWER1)
and AtCYP83B1 (A. thaliana CYTOCHROME P450 83B1). The
seeds of an AtDOF4.2-overexpressing plant show a collapse-like
morphology in the epidermal cells of the seed coat. The mucilage
contents and the concentration and composition of mucilage
monosaccharides are significantly changed in the seed coat of
transgenic plants. AtDOF4.2 may exert its effects on the seed
epidermis through the direct binding and activation of the cell
wall loosening-related gene AtEXPA9 (A. thaliana EXPANSINA9). The dof4.2 mutant did not exhibit changes in branching or
its seed coat; however, the silique length and seed yield were
increased. AtDOF4.4, which is a close homologue of AtDOF4.2,
also promotes shoot branching and affects silique size and seed
yield. Manipulation of these genes should have a practical use in
the improvement of agronomic traits in important crops.
INTRODUCTION
vulgare), HvSAD (H. vulgare scutellum and aleurone-expressed
DOF), HvDOF17 and HvDOF19 control seed germination
by affecting the expression of different aleurone hydrolase
genes [7–9]. DOF proteins from Arabidopsis have been found
to be mediators of many biological processes, including the
light response [10], flowering [11], plant growth [12,13],
hormone response [14,15], cell-cycle regulation [16], secondary
metabolism [17], interfascicular cambium formation and vascular
tissue development [18], and seed germination [15,19]. In
addition, DOF transcription factors also control other biological
processes, such as ammonium assimilation [20], carbohydrate
metabolism [21] and fatty acid synthesis [22].
Shoot branching is one of the most important processes during
plant growth and development and has a direct relationship
with plant biomass and crop yield. Various architectures found
in plants are primarily defined by the degree of shoot branching
[23,24]. Shoot branching is determined by environmental factors,
hormones, developmental signals and genetic factors [25–27].
Mutants with abnormal patterns of shoot branching have been
identified in several species, including rice, maize, Arabidopsis,
peas and tomatoes [28]. Genes underlying these mutants are
classified into three groups according to the stage of meristem
development they affect [28,29]. The first group, including
PIN1 (PINFORMED1), PID (PINOID), YUC (YUCCA)/SPI1
(SPARSE INFLORESCENCE1), LAX (LAX PANICLE)/BA1
DOF (DNA-binding with one finger) proteins are a group of plantspecific transcription factors. A typical DOF protein consists of
a conserved N-terminal DNA BD (binding domain), a divergent
C-terminal end for transcriptional regulation and the conjunctive
sequences with a possible NLS (nuclear localization sequence)
[1]. The N-terminal DNA BD can both interact with other proteins
and bind to DNA sequences harbouring an AAAG core motif
[2,3]. Unlike other transcription factors such as MYB, WRKY
and GT, which may have several DNA BDs, DOF proteins have
a single conserved zinc finger DNA BD (DOF domain) in their
N-terminal region [1]. The C-terminal end is the variable region
that contains the transcriptional regulatory element. The 48 amino
acids located in the C-terminus of ZmDOF (Zea mays DOF) 1
have been shown to be responsible for the transactivation activity
of the protein. Divergent C-terminal domains may reflect various
functions of different DOF proteins [4,5].
Plenty of DOF proteins have been found to participate in
different biological processes in several plant species since the
first DOF protein ZmDOF1 was determined to be a regulator
for the light response in maize [2]. Another two maize DOF
proteins, ZmDOF2 and ZmPBF [Z. mays PBF (prolamin boxbinding factor)], are involved in the light response and seed
germination respectively [4,6]. In barley, HvPBF (Hordeum
Key words: Arabidopsis, AtDOF4.2, AtDOF4.4, seed trait, shoot
branching, transcription factor.
Abbreviations used: AtEXPA9, Arabidopsis thaliana EXPANSIN-A9; BD, binding domain; CaMV, Cauliflower mosaic virus; CYP83B1, CYTOCHROME
P450 83B1; AtCYP83B1, A . thaliana CYP83B1; DOF, DNA-binding with one finger; AtDOF, A. thaliana DOF; AtEXP9, A . thaliana EXPANSIN-A9; GAL4,
yeast transcription activator Gal4; GFP, green fluorescent protein; GmDOF, Glycine max DOF; LEA, LATE EMBRYOGENESIS ABUNDANT; LEC, LEAFY
COTYLEDON; LUC, luciferase; NLS, nuclear localization sequence; PBF, prolamin box-binding factor; Rha, rhamnose; RNAi, RNA interference; RT, realtime; SD/ − His, synthetic defined, histidine dropout; STM, SHOOT MERISTEMLESS; AtSTM, A . thaliana STM; TFL1, TERMINAL FLOWER1; AtTFL1, A .
thaliana TFL1; ZmDOF, Zea mays DOF.
1
These authors contributed equally to this work.
2
Correspondence may be addressed to either of these authors (email [email protected] or [email protected]).
The microarray data has been deposited into the GEO database under the accession number GSE41682.
c The Authors Journal compilation c 2013 Biochemical Society
374
H.-F. Zou and others
(BARREN STALK1), MOC1 (MONOCULM1)/SPA (SMALL
PANICLE)/LAS/LS (LATERAL SUPPRESSOR), STM (SHOOT
MERISTEMLESS), CUC (CUP-SHAPED COTYLEDON),
REV (REVOLUTA), TFL1 (TERMINAL FLOWER1) and
RAX (REGULATOR OF AXILLARY MERISTEMS)/BL
(BLIND), affects meristem initiation [30–33]. The second
group, including MAX (MORE AXILLARY GROWTH), RMS
(RAMOSUS), DAD (DECREASED APICAL DOMINANCE),
TIL1 (TILLING1), CYP83B1 (CYTOCHROME P450 83B1)
and BRC1 (BRANCHED1), affects meristem outgrowth [34–
36]. The third group, including SPS (SUPERSHOOT)/ BUS
(BUSHY) and TB1 (TEOSINTE BRANCHED1), affects both
meristem initiation and meristem outgrowth [37,38]. However,
overexpression of some of these genes led to opposite branching
phenotypes compared with their mutants [34]. Different types of
transcription factors have been shown to regulate shoot branching
[33,39]. AtDOF (Arabidopsis thaliana DOF) 4.2 has also been
reported to enhance branching; however, repression of this gene
through RNAi (RNA interference) did not affect branching [17].
Seed and silique development is a key process in the lifecycle
of higher plants and is controlled by multiple factors [40]. In
Arabidopsis, four master regulators have been identified that
play roles in seed maturation. These include ABI3, FUS3, LEC
(LEAFY COTYLEDON) 2 and LEC1 [40]. The ABI3 regulon
has recently been further explored [41]. Le et al. [42] also
found seed-specific genes, including transcription factor genes
from Arabidopsis. Gene profiling analysis revealed many genes
involved in seed development in legumes [43]. The plant hormone
ethylene also participates in seed/silique development [44,45].
In addition, miRNAs and DNA methylation may regulate seed
development [46,47].
Previously, we found that the soybean genes GmDOF (Glycine
max DOF) 4 and GmDOF11 enhanced fatty acid biosynthesis and
thousand-seed mass in transgenic Arabidopsis plants [22]. In the
present paper we report functional characterization of a siliqueabundant gene AtDOF4.2, which belongs to the Arabidopsis
DOF transcription factor family. Transgenic plants overexpressing
AtDOF4.2 exhibit an obvious change in shoot branching patterns.
The epidermal structure of transgenic seeds was severely affected. The roles of AtDOF4.2 may be achieved through the
regulation of AtSTM (A. thaliana STM), AtTFL1 (A. thaliana
TFL1) and AtCYP83B1 (A. thaliana CYP83B1) for branching
and the alteration of AtEXPA9 (A. thaliana EXPANSIN-A9) for
the seed phenotype. The subcellular localization, DNA-binding
specificity and motifs for transactivation of AtDOF4.2 were also
investigated. A close homologue, AtDOF4.4, also had major roles
in shoot branching and seed/silique development. These analyses
uncover new roles of the DOF protein in shoot branching and seed
formation.
EXPERIMENTAL
Plant material and growth conditions
A. thaliana (ecotype Columbia-0, Col-0) was used. A T-DNA
insertion mutant dof4.2 (CS813276) was ordered from the
Arabidopsis Biological Resource Center. All Arabidopsis lines
were grown in a growth chamber at 22 ◦ C with a photoperiod of
16 h/8 h (light/dark) per day.
RNA isolation and gene expression analysis
The roots, stems, leaves, flowers and siliques of 5-week-old
Arabidopsis were harvested for RNA isolation using RNAPlant
c The Authors Journal compilation c 2013 Biochemical Society
kit for siliques and Trizol reagent (Tiangen Biotech) for other
organs. First-strand cDNA was produced using TIANScript
RT kit (Tiangen Biotech) and subjected to RT (real-time)PCR analysis with specific primers (Supplementary Table
S1 at http://www.biochemj.org/bj/449/bj4490373add.htm). The
Arabidopsis ACTIN gene was amplified as a control.
The cDNAs produced above were also used for RT quantitative
PCR. RT-PCR was performed with a MJ PTC-200 Peltier Thermal
Cycler using RealMasterMix kit (SYBR Green, Tiangen Biotech)
according to the manufacturer’s protocol. The PCR mixtures
were preheated at 95 ◦ C for 2 min, followed by 40 cycles of
amplification (95 ◦ C for 10 s, 50–60 ◦ C for 30 s and 68 ◦ C for 30 s).
The RT-PCR results were analysed using Opticon MonitorTM
analysis software 3.1 (Bio-Rad Laboratories).
Subcellular localization of AtDOF proteins in protoplasts and onion
epidermal cells
Normal or mutated AtDOF4.2 sequences were cloned into the
GFP221 vector to construct a fusion plasmid using specific
primers containing BamHI and SalI sites. Mutations were made
using a primer-directed site-specific mutagenesis method. A
GFP221 plasmid containing a 35S-driven GFP (green fluorescent
protein) gene was used as a control. The fusion construct or control
plasmid was then introduced into Arabidopsis protoplasts or onion
epidermal cells by particle bombardment. Transfected cells were
observed under a Leica TCS SP5 microscope.
Gel-shift analysis of AtDOF4.2 and AtDOF4.3
The coding sequences for AtDOF4.2 and AtDOF4.3 were
cloned into a BamHI/SalI-digested pGEX-6P-1 vector to generate
expression plasmids for GST–AtDOF fusion proteins. The fusion
proteins were expressed in Escherichia coli strain BL21 cells
and purified by glutathione 4B chromatography. The elements
used in this experiment are listed in Figures 1(D) and 9(B). Two
complementary single-stranded oligonucleotides were annealed
in 50 mM NaCl, heated at 70 ◦ C for 5 min and then cooled
slowly to room temperature (25 ◦ C). Each annealed element was
labelled with [γ -32 P]ATP (∼ 110 TBq/mmol, Amersham) using
T4 polynucleotide kinase (Takara) and used as a probe. The
competitive experiment was performed by adding an excess of
50× unlabelled probes in addition to the 32 P-labelled probes.
Transactivation analysis in yeast cells and Arabidopsis protoplasts
A yeast strain (YRG2) containing the HIS3 (imidazoleglycerolphosphate dehydratase) and LacZ reporter genes was used to
analyse transactivation of AtDOF4.2, AtDOF4.3 and AtDOF4.4.
Genes were cloned into the DNA BD vector pBD. pBD-AtDOF
vectors were introduced into YRG2 cells and the pBD and GAL
vectors were used as negative and positive control respectively.
The transactivation activity of these proteins were evaluated
according to the growth on SD/ − His (synthetic defined, histidine
dropout) plates or the activity of β-galactosidase.
The transactivation activity was also examined in the
Arabidopsis protoplast system. The reporter was a plasmid
harbouring firefly LUC (luciferase) gene which was controlled
by a modified 35S promoter with 5× the UAS (upstream
activating sequence) in it. AtDOF genes were fused to the GAL4
(yeast transcription activator Gal4) DNA BD-coding sequence
and constructed into pRT107 to generate effector plasmid pRTBD-AtDOFs. The fusion genes were under the control of 35S
promoter. pRT107 vector containing the BD sequence and the
AtDOF4.2 affects branching and seed coat phenotype
BD-VP16 fusion sequence were used as negative and positive
control respectively. A pPTRL plasmid that contained a CaMV
(Cauliflower mosaic virus) 35S promoter and Renilla LUC, was
used as an internal control [48].
375
by RT-PCR analysis using independently isolated RNA samples.
The chip data has been deposited into the GEO database under
the accession number of GSE41682.
Statistical analysis
Generation of transgenic plants
The full-length coding regions of AtDOF4.2, a mutated AtDOF4.2
named AtDOF4.2m and AtDOF4.4 were cloned into the pBIN438
vector by the BamHI/KpnI sites. The expression plasmids were
transfected into agrobacterium GV3101 and then transformed
into Arabidopsis plants (Col-0) using the floral dip method.
Expression of the transgene was examined by RT quantitative
PCR or Northern blotting.
For inhibition of AtDOF4.4 expression, a 630-bp fragment of
AtDOF4.4 was amplified with the primers 5 -gcTCTAGAGAGCTCatggataacttgaatgttttcgct-3 and 5 -acgcGTCGACGGTACCtgattcatgttcatagcgtggttg-3 (upper case letters signify the
restriction enzyme sites) and inserted into the pZH01 vector in an
inversely oriented manner to generate the RNAi construct. The
construct was transfected into GV3101 cells and then transformed
into Col-0 or dof4.2 mutant. The lines with no or very low
expression of the AtDOF4.4 were selected for analysis.
Scanning electron microscopy
For scanning electron microscopy matured Arabidopsis seeds
were harvested and dried thoroughly. The seeds were sputtercoated with gold and further visualized using a Hitachi S-3000N
scanning electron microscope.
Ruthenium Red staining of seed mucilage
Matured seeds were placed in small tubes and shaken in 1 ml
0.01 % Ruthenium Red for 15 min on an orbital shaker with
sufficient speed to keep seeds suspended in liquid. Seeds were
viewed under a dissection microscope for phenotypic analysis.
Extraction of seed mucilage and determination of soluble
monosaccharides
Extraction of seed mucilage was performed as follows. Dry seeds
(50 mg) were ground and incubated in 0.2 % ammonium oxalate
with vigorous shaking for 2 h at 30 ◦ C; insoluble material was
removed by centrifugation (15 000 g for 1 min at 25 ◦ C), and the
supernatant was precipitated with 5 vol. of ethanol for 3 h. To
determine the soluble polysaccharides, 20 μg of myo-inositol was
added to the precipitated materials as an inner standard, before
they were hydrolysed with 2 M trifluoroacetic acid for 90 min
at 121 ◦ C. After centrifugation (15 000 g for 1 min at 25 ◦ C),
10 mg/ml of NaBH4 was added to the supernatant to reduce for
90 min at 4.4 ◦ C, and the reduction reaction was stopped by adding
0.2 ml of acetic acid. The solution was evaporated under a stream
of nitrogen. Derivatization to alditol acetates was performed as
described by Gibeaut and Carpita [49]. The monosaccharide was
determined by GC-MS (Agilent 7890A/5975C).
Microarray analysis
Seedlings (2-week-old, aerial part) of Col-0 and AtDOF4.4overexpressing transgenic lines 4.4-1 and 4.4-5 were used for
extraction of total RNA and subjected to chip analysis using
Agilent Arabidopsis Oligo Microarray (4×44K; ShanghaiBio).
Genes with at least a 10-fold expression difference in both the
4.4-1 and 4.4-5 lines above the Col-0 line were further examined
A LSD-t (least significant difference) test of ANOVA was
performed to determine the significant differences between
sample values using SPSS 11.5.
RESULTS
AtDOF4.2 gene expression and protein subcellular localization
Previously, we have demonstrated that GmDOF4 and GmDOF11
from soybeans regulate the biosynthesis of fatty acids and enhance
the thousand-seed weight in transgenic Arabidopsis seeds [22].
We further determined whether any DOF genes in Arabidopsis
will affect seed-related traits or other processes. A total of 36
DOF genes have been identified in the Arabidopsis genome [1].
Expression of these genes was examined (Supplementary Figure
S1 at http://www.biochemj.org/bj/449/bj4490373add.htm) and
AtDOF4.2 (TAIR locus At4g21030) was found to be expressed
in siliques, but not or only weakly expressed in other organs
that were tested (Figure 1A). This gene was further investigated.
Previous cluster analysis has revealed that AtDOF4.2 was grouped
with AtDOF4.4 (TAIR locus At4g21050), AtDOF4.3 (TAIR
locus At4g21040) and AtDOF4.5 (TAIR locus At4g21080) [1],
suggesting a close relationship among these proteins. AtDOF4.3,
AtDOF4.4 and AtDOF4.5 were also mainly expressed in siliques
(Supplementary Figure S1).
To localize AtDOF4.2 at the subcellular level, the AtDOF4.2–
GFP fusion gene construct and the GFP control plasmid, both
driven by the CaMV 35S promoter, were transformed into
Arabidopsis protoplasts and onion epidermal cells. Figures 1(B)
and 1(C) show that the AtDOF4.2-GFP protein was localized in
the nuclei of protoplasts and onion epidermal cells, whereas GFP
control was present in both the nuclei and cytoplasm of these
cells. We further analysed a putative NLS that usually contains
basic amino acids. The protein localization did not change for the
K72G or K77G mutants (results not shown). However, the K100G
plus K101G mutant of AtDOF4.2Mut–GFP changed localization
patterns and green fluorescence was detected in both the nucleus
and cytoplasm (Figures 1B and 1C). These results indicate that
AtDOF4.2 is a nuclear protein and that K100 plus K101 play
important roles in nuclear localization.
DNA-binding specificity of AtDOF4.2
Most DOFs bind to the AAAG core motif [1,2]. We investigated
whether AtDOF4.2 and AtDOF4.3 can bind to the AAAG motif.
Eight double-stranded DNA elements named E1 to E8, each
with four tandem repeats of AAAAGT or its mutations, were
used in the binding experiments (Figure 1D). Both AtDOF4.2
and AtDOF4.3 can bind to elements E1–E4, which harbour
AAAG core sequences, and the addition of non-labelled probes
(competitors) significantly reduced the DNA-binding ability,
suggesting that both DOF proteins specifically bind to the AAAG
core motif (Figure 1D). Nucleotide changes upstream of the core
sequence in E1–E4 caused some variations in the binding affinity
of AtDOF4.2 and AtDOF4.3, and AtDOF4.2 preferred A or C,
whereas AtDOF4.3 preferred A or T at this position (Figure 1D).
Substitutions in the core motif in E5–E8 completely abolished
the binding activities of both proteins. In addition, the binding
c The Authors Journal compilation c 2013 Biochemical Society
376
H.-F. Zou and others
that AtDOF4.2 and AtDOF4.3 have specific binding affinity for
the AAAG element.
Transcriptional activation ability of AtDOF4.2
Figure 1 Gene expression, protein localization and DNA-binding of
AtDOF4.2
(A) AtDOF4.2 expression in different organs of Arabidopsis revealed by RT-PCR. Actin was
amplified as a control. (B) Subcellular localization of AtDOF4.2-GFP in Arabidopsis protoplasts.
Green fluorescence indicates the location of GFP control or GFP fusion proteins. Red fluorescence
indicates the positions of chloroplasts. AtDOF4.2Mut has mutations (K100G and K101G) that
led to altered distribution. Scale bar, 10 μm. (C) Subcellular localization of AtDOF4.2–GFP in
onion epidermal cells. Scale bar, 20 μm. Other indications are as in (B). (D) Gel-shift analysis of
AtDOF4.2 and AtDOF4.3. AtDOF4.2 and AtDOF4.3 were incubated with labelled probes (E1–E8)
in the presence or absence of an excess of 50× unlabelled probes (competitor). Arrows indicate
protein–DNA complexes.
affinity for the AAAG core motif was substantially weaker in
AtDOF4.2 than in AtDOF4.3 (Figure 1D). These results indicate
c The Authors Journal compilation c 2013 Biochemical Society
The transcriptional activation abilities of AtDOFs were
investigated using a yeast assay system. Coding regions of AtDOF
genes were cloned into the pBD-GAL4 vector to generate pBDAtDOF, and the fusion plasmids were transformed into yeast
strain YRG-2. The growth of transformants containing pBDAtDOF4.2 on selective medium (SD/ − His) and blue staining
in an X-gal (5-bromo-4-chloroindol-3-yl β-D-galactopyranoside)
assay indicate that the protein has transcriptional activation
ability (Figure 2A). AtDOF4.4 also had transcriptional
activation activity, whereas AtDOF4.3 did not have this ability
(Figure 2A). Similar results were obtained when transcriptional
activation was examined in the Arabidopsis protoplast system
(Figure 2B).
We examined the subdomain or motifs that may be responsible
for transcriptional activation in AtDOF4.2. A series of truncations
were made (Figure 2C, upper panel) and tested using a
protoplast assay system. Deletions in AtDOF4.2-M1 (amino
acids 173–194) or AtDOF4.2-M2 (amino acids 137–194) from
the C-terminal region led to a complete loss of transactivation
activity (Figure 2C), suggesting that this region is required for
transactivation. Removal of the N-terminal sequences containing
the DOF domain in AtDOF4.2-M3 (amino acids 51–194) or in
AtDOF4.2-M4 (amino acids 101–194) did not significantly affect
the transactivation activity compared with normal AtDOF4.2
(Figure 2C). Further deletions in AtDOF4.2-M5 (amino acids
118–194) or AtDOF4.2-M6 (amino acids 122–194) resulted in an
apparent increase in activation ability. Further removal from the
N-terminal end caused a continuous decrease in transactivation
activity, and the activity of AtDOF4.2-M9 (amino acids 154–
194) was similar to that of the negative control (Figure 2C).
These results indicate that the amino acids 118–153 region
may contain motifs important for transcriptional activation in
AtDOF4.2.
We further compared amino acid sequences of AtDOF4.2,
AtDOF4.4 and AtDOF4.3 (Figure 3A). The DD (positions 124
and 14.4) motif was only present in AtDOF4.2, whereas the TMD
motif (positions 142–144) was found in AtDOF4.2 and AtDOF4.4
(Figure 3A), both of which possessed transcriptional activation
abilities, but not in AtDOF4.3 without transactivation (Figures 2A
and 2B). The DD motif in AtDOF4.2-M6 was mutated to
GG and the resulting AtDOF4.2-M10 had a reduced transcriptional activation (Figure 3B). Similarly, the TMD motif in
AtDOF4.2-M8 was mutated to GGG, and the resulting AtDOF4.2M11 also had reduced activity (Figure 3B). Full-length AtDOF4.2
was also mutated in its DD or TMD motifs. The mutation
of DD to GG in AtDOF4.2-M12 decreased the transactivation
activity of AtDOF4.2 slightly, whereas the mutation of TMD to
GGG in AtDOF4.2-M13 almost completely abolished its activity
(Figure 3C). These results indicate that the TMD motif may play
a large role in the transcriptional activation of AtDOF4.2.
We also investigated the function of the TMD motif in
AtDOF4.3 and AtDOF4.4. AtDOF4.4 harboured a TMD motif,
whereas AtDOF4.3 did not. The TMD in AtDOF4.4 was mutated
to GGG and the resulting AtDOF4.4-MUT almost completely
lacked activity, indicating that the TMD motif is essential
for transcriptional activation in AtDOF4.4 (Figure 3E). The
corresponding amino acids at the same positions in AtDOF4.3
were replaced with TMD. However, this mutation did not
significantly alter the activation activity (Figure 3D). All these
AtDOF4.2 affects branching and seed coat phenotype
Figure 2
377
Transcriptional activation of AtDOFs
(A) Transactivation activity of AtDOF4.2, AtDOF4.3 and AtDOF4.4 in a yeast assay. Transformants harbouring pBD-AtDOFs, the positive control pGAL4 or the negative control pBD were streaked
onto YPAD (top row) or SD-His (middle row) to determine growth. LacZ expression was examined by an X-Gal (5-bromo-4-chloroindol-3-yl β-D-galactopyranoside) assay (bottom row). (B)
Transactivation activity of AtDOF4.2, AtDOF4.3 and AtDOF4.4 in Arabidopsis protoplasts. VP16 and GAL4DBD were used as positive and negative controls respectively. (C) Schematic representation
(upper panel) and transactivation activity (lower panel) of truncated AtDOF4.2. AtDOF4.2-M1 to AtDOF4.2-M9 represent constructs with different truncated versions of AtDOF4.2. Vertical broken
lines from the left-hand side to the right-hand side (upper panel) indicate positions of amino acids 50, 100 and 150. The error bars represent the S.D. (n = 4).
results indicate that the TMD motif may be critical for
transcriptional activation in both AtDOF4.2 and AtDOF4.4.
AtDOF4.2 increases shoot branching in transgenic plants
To investigate the function of AtDOF4.2, an expression vector
harbouring a 35S promoter-driven AtDOF4.2 was transformed
into Arabidopsis plants. Two homozygous lines (4.2-4 and 4.2-8)
with higher AtDOF4.2 gene expression were selected for analysis
(Figure 4A). A T-DNA insertion mutant dof4.2 (CS813276)
without AtDOF4.2 expression was identified and the insertion
site was between 153 and 154 bp from the ATG (Figure 4B).
The transgenic lines overexpressing AtDOF4.2 (4.2-4 and 4.28) had more shoot branches and exhibited a bushy phenotype
compared with Col-0 (Figure 4C). The number of primary and
c The Authors Journal compilation c 2013 Biochemical Society
378
Figure 3
H.-F. Zou and others
Mutations in AtDOF4.2, AtDOF4.3 and AtDOF4.4 affect the transactivation activity
(A) Alignment of AtDOF amino acid sequences. Asterisks indicate positions of mutated residues. Identical residues are shaded in black. (B) Schematic representation of mutations (left-hand panel)
and transactivation activity (right-hand panel) of truncated AtDOF4.2. AtDOF4.2-M10, derived from AtDOF4.2-M6, has mutations D124G and D14.4G. AtDOF4.2-M11, derived from AtDOF4.2-M8,
has the mutations T142G, M143G and D144G. (C) Schematic representation (left-hand panel) and transactivation activity (right-hand panel) of two mutated full-length AtDOF4.2s. AtDOF4.2-M12 has
the mutations D124G and D14.4G. AtDOF4.2-M13 has the mutations T142G, M143G and D144G. (D) Transactivation activity of AtDOF4.3 and its mutant AtDOF4.3-MUT. AtDOF4.3-MUT has the
mutations P152T, N153M and H154D at positions corresponding to TMD in AtDOF4.2. (E) Transactivation activity of AtDOF4.4 and its mutant AtDOF4.4-MUT. AtDOF4.4-MUT has the mutations
(T150G, M151G and D152G) at the TMD motif. The error bars represent the S.D. (n = 4).
secondary rosette branches (RI and RII) and the secondary cauline
leaf branches (CII) in two AtDOF4.2-overexpressing lines were
significantly higher than that of Col-0 (Figures 4D, 4E and 4G).
However, the number of primary cauline leaf branches (CI) was
similar to Col-0 in the 4.2-4 line, but higher than the Col-0
c The Authors Journal compilation c 2013 Biochemical Society
line in the 4.2-8 line (Figure 4F). The dof4.2 did not show a
significant difference in shoot branching, except that the number
of RII branches may be slightly less than that of the Col-0 line
(Figures 4C and 4E). Plant heights and the first internode lengths
of two transgenic lines were substantially lower than that of the
AtDOF4.2 affects branching and seed coat phenotype
Figure 4
379
Overexpression of AtDOF4.2 promotes shoot branching in transgenic plants
(A) AtDOF4.2 expression in various transgenic lines as revealed by Northern blot analysis. The rRNAs are shown as loading controls. (B) Identification of the AtDOF4.2 T-DNA insertion mutant
dof4.2 . No AtDOF4.2 expression was found in dof4.2 (right-hand panel). (C) Shoot phenotype in different plants. AtDOF4.2 -overexpression lines 4.2-4 and 4.2-8 show a bushy phenotype.
(D) Number of primary rosette branches (RI). (E) Number of secondary rosette branches (RII). (F) Number of primary cauline branches (CI). (G) Number of secondary cauline branches (CII).
(H) Plant height of different plant lines. (I) First internode length of different lines. (D–I) **Highly significant differences compared with the Col-0 plants (P < 0.01). Error bars indicate S.D. (n = 32).
Col-0 and dof4.2 lines (Figures 4H and 4I). These results indicate
that AtDOF4.2 regulates shoot branching.
The effect of AtDOF4.2 on shoot branching is related to its
transcriptional activation activity
To investigate whether AtDOF4.2 exerts effects on shoot
branching through its transactivation activity, a mutated
AtDOF4.2 gene encoding a protein with a TMD to GGG mutation,
driven by a 35S promoter, was transformed into Arabidopsis
plants. Two transgenic lines (4.2-m-16 and 4.2-m-17) harbouring
the mutated gene, with transgene expression comparable with
that of AtDOF4.2 in transgenic lines 4.2-4 and 4.2-8, were
analysed (Figures 5A and 5B). The lines (4.2-m-16 and 4.2-m-17)
harbouring the mutant AtDOF4.2 exhibited a higher number of
rosette leaf branches (RI and RII) than Col-0, but a lower number
than the transgenic line 4.2-4 overexpressing normal AtDOF4.2
(Figures 5C and 5D). For cauline leaf branching, the 4.2-m-16 and
4.2-m-17 lines had an unexpectedly lower number of CI branches
than the Col-0 and the 4.2-4 lines (Figure 5E). The CII branch
numbers of the 4.2-m-16 and 4.2-m-17 lines were similar to that
of the Col-0 line, but were significantly lower than that of 4.2-4
(Figure 5F). Moreover, the plant heights and first internode lengths
of 4.2-m16 and 4.2-m-17 were close to those of the Col-0 line,
but higher than those in 4.2-4 (Figures 5G and 5H). These results
indicate that the loss of transcriptional activation significantly
affects the roles of AtDOF4.2 in shoot branching.
AtDOF4.2 alters the expression of genes related to branch
outgrowth in transgenic plants
Because AtDOF4.2 participated in the shoot branching process,
we investigated whether the expression of known branchingrelated genes was changed. Of the genes tested (Supplementary
Table S2 at http://www.biochemj.org/bj/449/bj4490373add.htm),
only three (AtSTM, AtTFL1 and AtCYP83B1) showed enhanced
expression in transgenic lines (4.2-4 and 4.2-8) overexpressing
AtDOF4.2 (Figure 6). Expression of the three genes was slightly
increased in the 4.2-m-17 line overexpressing mutated AtDOF4.2
(Figure 6). In the dof4.2 mutant, expression of the three genes was
reduced (Figure 6). AtSTM encodes a KNOTTED-like protein and
plays a role in shoot apical meristem formation [50]. AtTFL1
promotes branching [51]. AtCYP83B1 encodes a cytochrome
P450 and affects auxin production and branching [34]. These
analyses indicate that AtDOF4.2 may promote shoot branching
through the up-regulation of AtSTM, AtTFL1 and AtCYP83B1.
The mutation of the TMD motif in AtDOF4.2 or the disruption of
AtDOF4.2 in the mutant significantly affected the expression
of branching-related genes.
c The Authors Journal compilation c 2013 Biochemical Society
380
Figure 5
H.-F. Zou and others
TMD mutations in AtDOF4.2 affects shoot branching in transgenic plants
(A) Transgene expression in various lines revealed by RT quantitative PCR. 4.2-4 and 4.2-8 are lines overexpressed AtDOF4.2 . 4.2-m-16 and 4.2-m-17 are lines overexpressing mutated AtDOF4.2
with TMD mutations. Mutated AtDOF4.2 lost transactivation activity. (B) Shoot branching phenotype in various transgenic lines. (C) Comparison of primary rosette branches (RI) in various plant
lines. (D) Comparison of secondary rosette branches (RII) in the plant lines. (E) Number of primary cauline branches (CI) in the plants. (F) Number of secondary cauline branches (CII) in the plants.
(G) Comparison of plant height. (H) Comparison of first internode length in different lines. (C–H) a, b or c, Significant difference between the compared values (P < 0.05). Error bars indicate S.D.
(n = 32).
AtDOF4.2 alters cotyledon size and seed coat phenotype
in transgenic plants
After seed germination the plant cotyledon size was compared.
At different stages the AtDOF4.2-overexpressing lines (4.2-4
and 4.2-8) had large cotyledons compared with the Col-0 line
(Figure 7). However, transgenic lines that overexpressed mutatedAtDOF4.2 (4.2-m-16 and 4.2-m-17) showed no significant
difference compared with the Col-0 line. These results indicate
that AtDOF4.2 increases cotyledon size and that this function is
mainly achieved through its transcriptional activation activity.
Because AtDOF4.2 was primarily expressed in siliques, we
examined whether seed-related phenotypes were changed in
AtDOF4.2-transgenic plants. Using scanning electron microscopy
the Col-0 and dof4.2 mutant seed coats showed a reticulate
appearance owing to the presence of thickened radial cell walls
and a raised columella in the centre of each epidermal cell
(Figures 8A and 8B). However, transgenic lines 4.2-4 and 4.2-8
exhibited a collapsed profile and the boundaries of seed epidermal
cells became ambiguous owing to collapsed cell walls (Figures 8A
and 8B). In contrast, the epidermal cells of the seed coat from
lines with mutated AtDOF4.2 (4.2-m-16 and 4.2-m-17) were
c The Authors Journal compilation c 2013 Biochemical Society
similar to those of the Col-0 line. These results indicate that
AtDOF4.2 overexpression causes abnormal seed coats and
that transcriptional activation activity of AtDOF4.2 is required
for this process.
AtDOF4.2 regulates content of seed coat mucilage
Arabidopsis mutants with abnormal seed coat cell walls usually
show defects in mucilage synthesis or mucilage extrusion [52].
Arabidopsis seeds form a gelatinous coating when in contact with
water due to mucilage release. This coating can be visualized
by staining with Ruthenium Red, a dye that stains negatively
charged biopolymers such as pectin and DNA [52]. Most seeds
from 4.2-m-17 and Col-0 lines were wrapped with a pink capsule
(Figures 8C and 8D). In contrast, only ∼ 40 % of the seeds
from the 4.2-4 and 4.2-8 lines were stained (Figure 8C and 8D).
These data indicate that the overexpression of AtDOF4.2 disrupts
mucilage synthesis and/or mucilage extrusion.
To determine whether there were changes in the mucilage
content or composition, we measured the monosaccharide content
in seed coats from the 4.2-4, 4.2-m-17 and Col-0 lines. Rha
AtDOF4.2 affects branching and seed coat phenotype
381
Figure 6 Expression of shoot branching-related genes in AtDOF4.2 transgenic plants and the dof4.2 mutant
The 4.2-4 and 4.2-8 lines overexpressed AtDOF4.2 . 4.2-m-17 overexpressed mutated AtDOF4.2 .
dof4.2 is a mutant of AtDOF4.2 expression. Relative expressions of AtSTM (TAIR locus
AT1G64.260), AtTFL1 (TAIR locus AT5G03840) and AtCYP83B1 (TAIR locus AT4G31500) were
determined by RT quantitative PCR. Error bars indicate S.D. (n = 4).
(rhamnose) accounted for the majority of the total mucilage,
whereas other monosaccharides accounted for only a minor
part in all tested lines (Table 1). A dramatic decrease of total
mucilage in line 4.2-4 seed coats was noted, whereas no significant
changes were found in line 4.2-m-17 seed coats compared with
those of Col-0 (Table 1). The reduced mucilage content in line
4.2-4 seed coats was primarily owing to a decrease in Rha
content. These results indicate that AtDOF4.2 overexpression
affects mucilage content and composition in transgenic seed coats
and that these changes rely on the transactivation activity of
AtDOF4.2.
AtDOF4.2 enhances AtEXPA9 expression through direct binding
to the promoter region
We investigated whether AtDOF4.2 affects seed coats through
the regulation of downstream genes. The expression of
several genes whose mutants showed defects in seed coat
formation was not significantly changed in the transgenic lines
compared with the Col-0 line (Supplementary Figure S2 at
http://www.biochemj.org/bj/449/bj4490373add.htm). However,
expression of AtEXPA9, a member of the Arabidopsis expansin
family, increased significantly in the lines (4.2-4 and 4.2-8)
overexpressing AtDOF4.2, but only slightly in the 4.2-m-17 line,
which overexpressed mutated AtDOF4.2 (Figure 9A). In the
dof4.2 mutant, AtEXPA9 expression was reduced (Figure 9A).
The expansin family is a group of proteins that induce cell walls
to extend, leading to the loosening of cell walls [53]. These results
Figure 7
Overexpression of AtDOF4.2 affects cotyledon size
(A) Seedlings (upper panel) and cotyledons (lower panel) from 5-day-old plants. Transgenic
lines overexpressing normal AtDOF4.2 (4.2-4 and 4.2-8) or mutated AtDOF4.2 (4.2-m-16 and
4.2-m-17) were compared. (B) Seedlings (upper panel) and cotyledons (lower panel) from
9-day-old plants. (C) Comparison of cotyledons size of transgenic and Col-0 lines. The areas
of 5- and 9-day-old cotyledons are shown. **Significant differences from the Col-0 plants
(P < 0.01). Error bars indicate S.D. (n = 32).
indicate that AtEXPA9 may be a putative target of AtDOF4.2
during seed coat development. We found a further 37 DOFbinding elements in the 2.2 kb promoter region of AtEXPA9
(results not shown) and a 45-bp DNA sequence (from − 459
to − 415) in this region, containing five AAAG elements, was
selected for DNA-binding analysis. AtDOF4.2 can specifically
bind to this region (Figure 9B). These results indicate that
AtDOF4.2 can bind to the promoter of AtEXPA9 and enhance
its expression.
AtDOF4.4 affects shoot branching and silique length
Because AtDOF4.4 and AtDOF4.2 were clustered [1] and both
had transcriptional activation activity (Figures 2A and 2B), we
examined whether AtDOF4.4 plays any role in plant development.
Three lines (4.4-1, 4.4-5 and 4.4-6) that overexpressed AtDOF4.4
were analysed (Figure 10A). AtDOF4.4 transgenic plants showed
c The Authors Journal compilation c 2013 Biochemical Society
382
Figure 8
H.-F. Zou and others
Seed coat phenotypes of various plants
Mutant dof4.2 and lines overexpressing AtDOF4.2 (4.2-4 and 4.2-8) or mutated AtDOF4.2 (4.2-m-16 and 4.2-m-17) were compared with the Col-0 plants. (A) Scanning electron micrograph of seed
coat. Scale bar, 40 μm. (B) Scanning electron micrograph of epidermal cells in seed coat. Scale bar, 10 μm. (C) Ruthenium Red staining of seeds. Seeds of transgenic lines 4.2-4 and 4.2-8 showed
different staining patterns from those of the 4.2-m-17 and Col-0 line. Scale bar, 500 μm. (D) The percentage of stained seeds in various plants. **Significant difference from Col-0 (P < 0.01). Error
bars indicate S.D. (n = 3).
a slightly more severe bushy phenotype than Col-0 and AtDOF4.2overexpressing plants (Figures 4C and 10B). Rosette branching
(RI and RII) and secondary cauline leaf branching (CII) were all
significantly enhanced compared with the Col-0 line (Figure 10C).
However, CI branching was not affected. The plant heights
of lines 4.4-1, 4.4-5 and 4.4-6 were decreased compared with
the Col-0 line (Figure 10D). Additionally, the silique length
and seed yield per plant were reduced in the three transgenic
lines (Figures 10E–10G). These results indicate that AtDOF4.4
regulates shoot branching and seed/silique-related traits.
Altered gene expression was studied in AtDOF4.4overexpressing plants based on a microarray analysis (GO
c The Authors Journal compilation c 2013 Biochemical Society
accession number GSE41682). The genes from the microarray
analysis with at least a 10-fold expression difference in both 4.41 and 4.4-5 lines compared with the Col-0 line (Supplementary
Table S3 at http://www.biochemj.org/bj/449/bj4490373add.htm)
were further examined by semi-quantitative PCR using
independently isolated RNAs, and 19 genes were found to be
up-regulated and one gene was down-regulated (Figure 10H). Of
these, At2S3 encodes a model storage protein (2S albumin gene
3). AtGASA3 is Gibberellin-regulated and accumulates in siliques
and seeds. CRU2 and CRU3 are major seed protein 12S globulin
cruciferins. AtPER1 (A. thaliana 1-cysteine peroxiredoxin 1) is
primarily expressed in embryos and mature seeds and is also
AtDOF4.2 affects branching and seed coat phenotype
Figure 9
383
AtDOF4.2 promotes AtEXPA9 expression and binds to its promoter
(A) Expression of cell wall loosening-related gene AtEXPA9 . Relative expressions of the gene was determined by RT quantitative PCR in lines overexpressing AtDOF4.2 (4.2-4 and 4.2-8) or mutated
AtDOF4.2 (4.2-m-17), and in the dof4.2 mutant. Error bars indicate S.D. (n = 4). (B) AtDOF4.2 binds to the promoter of AtEXPA9 . DNA fragments of the AtEXPA9 gene promoter ( − 459 to − 415)
were used as probes and the core elements are underlined.
Table 1 Monosaccharide contents in transgenic seeds overexpressing
AtDOF4.2 (4.2-4) or mutated AtDOF4.2 (4.2-m-17) compared with that in
Col-0 seeds
Results are +
− S.E.M. calculated from three independent samples. Ara, arabinose; Fuc, fucose;
Gal, galactose; Glc, glucose; Man, mannose; Xyl, xylose.
Contents (μg/100 mg of seeds)
Sugar
Col-0
4.2-4
4.2-m-17
Rha
Fuc
Ara
Xyl
Man
Gal
Glc
Total
625.1 +
− 7.3
4.4 +
− 0.2
7.6 +
− 0.3
28.7 +
− 0.5
6.7 +
− 0.1
13.9 +
− 0.4
7.9 + 0.2
694.2 +
− 7.6
425.1 +
− 9.3†
3.6 +
− 0.1†
8.7 +
− 0.7
19.3 +
− 0.3†
5.7 +
− 0.1†
13.9 +
− 0.5
7.0 + 0.1*
483.2 +
− 9.6†
636.4 +
− 21.1
4.1 +
− 0.3
7.4 +
− 0.1
28.8 +
− 0.1
6.3 +
− 0.2
14.1 +
− 0.3
7.9 + 0.1
704.9 +
− 21.9
*Significantly different from Col-0 (P < 0.05).
†Significantly different from Col-0 (P < 0.01).
expressed in meristems and stem branching points. AtOLE2
(A. thaliana oleosin 2) is an oleosin in seeds. At3g15670 encodes a
LEA (LATE EMBRYOGENESIS ABUNDANT) 76 homologue.
At3g56350 encodes a superoxide dismutase. At1g07645 encodes
a desiccation-induced 1VOC superfamily protein. At3g21720
encodes a putative isocitrate lyase. At1g73190 encodes a putative
aquaporin TIP3-1. At4g22630 encodes lipid-transfer protein/seed
storage 2S albumin-like protein. At2g41260 encodes a putative
LEA(M17). At4g21020 encodes a LEA-containing protein. All
these genes may contribute to AtDOF4.4 function in shoot
branching and seed-related traits.
The effects of reduced AtDOF4.2 and AtDOF4.4 expression on
shoot branching, silique length and seed yield
Although both AtDOF4.2 and AtDOF4.4 promote shoot
branching in overexpression transgenic plants (Figures 4 and 10),
the dof4.2 mutant exhibited no change in branching, and the effect
of an AtDOF4.4 loss-of-function mutation is not known. We then
generated transgenic plants with reduced AtDOF4.4 expression
(DOF4.4 RNAi lines 4, 10 and 13) using an RNAi-based approach
(Figure 11A). The AtDOF4.4 RNAi construct was also introduced
into dof4.2 mutant to produce plants with reduced expression
of both AtDOF4.4 and AtDOF4.2 (dof4.2/DOF4.4RNAi double
mutant lines 11, 13 and 16) (Figures 11A and 11B).
The branching of these plants was measured, and no
significant difference was observed (Supplementary Figure
S3 at http://www.biochemj.org/bj/449/bj4490373add.htm). The
DOF4.4 RNAi lines and dof4.2/DOF4.4RNAi double mutant
lines all had taller inflorescences compared with the Col-0
and dof4.2 lines (Figures 11C and 11D). The silique length
and seed yield per plant in these lines were also substantially
higher than those of the Col-0 plants (Figures 11E–11G). In
the dof4.2 mutant, the silique length and seed yield per plant
were increased compared with the Col-0 plants (Figures 11E–
11G). The expressions of putative downstream genes were also
examined and a 2S seed storage protein gene (At4g27140)
was significantly inhibited in the dof4.2, DOF4.4 RNAi and
dof4.2/DOF4.4RNAi lines (Figure 11H). Expression of the other
three genes, encoding uncharacterized protein (At1g05510),
DNA-binding protein (At2g42940) and glycine-rich protein
(At5g35660) was also decreased (Supplementary Figure S4
at http://www.biochemj.org/bj/449/bj4490373add.htm). These
results indicate that reduction of AtDOF4.4 and/or AtDOF4.2
enhances silique length and seed yield in Arabidopsis, probably
through the regulation of downstream genes. However, branching
was not affected by inhibition of these two genes.
DISCUSSION
DOF proteins are plant-specific transcription factors and function
in different developmental and physiological processes [1–22].
In the present study AtDOF4.2 and AtDOF4.4 were found to
have transcriptional activation ability and participated in shoot
branching and seed/silique development.
The features of transcription factors are often determined by
certain amino acids or motifs. The AtDOF4.2 protein was found
to be localized in the nuclear region (Figure 1); however, no
apparent NLS was identified in this protein. Interestingly, all
the other Arabidopsis DOF proteins have an atypical bipartite
NLS with a 17 amino acid-long linker between the flanking
c The Authors Journal compilation c 2013 Biochemical Society
384
Figure 10
H.-F. Zou and others
Phenotypes of AtDOF4.4 -overexpressing plants
(A) AtDOF4.4 expression in various transgenic lines shown by RT-PCR. ACTIN was amplified as a control. (B) Bushy phenotype of transgenic lines (4.4-1, 4.4-5 and 4.4-6) overexpressing
AtDOF4.4 . (C) Branches in transgenic plants. RI, RII, CI and CII are as in Figure 4. Error bars indicate S.D. (n = 32). (D) Plant height of different lines. Error bars indicate S.D. (n = 32).
(E) AtDOF4.4 -overexpressing plants have short siliques. (F) Comparison of silique length. Error bars indicate S.D. (n = 36). (G) Comparison of seed mass per plant. Error bars indicate S.D. (n = 6).
(H) Altered gene expressions in AtDOF4.4-transgenic plants (4.4-1 and 4.4-5) examined by RT-PCR. (C–G) **Significant differences from the Col-0 plants (P < 0.01).
basic regions [54]. Through mutational analyses, two basic amino
acids in AtDOF4.2, Lys100 and Lys101 , were found to be essential
for its nuclear localization (Figure 1), suggesting a new NLS
feature different from those of other proteins. Both AtDOF4.2
and AtDOF4.4 have transcriptional activation activity by yeast
assays and protoplast assays. The TMD motifs in the C-terminal
region of the two proteins are essential for the transactivation
ability, as determined by results of the protoplast assay (Figure 3).
However, this motif was not found in two other DOF proteins,
AtDOF4.3 and AtDOF4.5, both of which appear to have no
transcriptional activation ability (Figure 2 and results not shown).
In the transcription factor VP16, a specific phenylalanine (Phe442 )
c The Authors Journal compilation c 2013 Biochemical Society
is essential for its transactivation activity [55]. In maize DOF1,
a tryptophan residue in its activation domain is important for
transcriptional activation of the target genes [5].
The roles of the TMD motif in AtDOF4.2 were further
demonstrated through transgenic analysis. Transgenic plants that
overexpressed normal AtDOF4.2 had more rosette branches (RI
and RII) and cauline secondary branches (CII) than the Col-0
plants (Figures 4 and 5). However, when the TMD was mutated
to GGG, transgenic plants harbouring mutated AtDOF4.2 showed
reduced RI, RII and CII branch numbers compared with the
transgenic plants with normal AtDOF4.2 (Figure 5). It should
be noted that only the CII branch number was reduced to the
AtDOF4.2 affects branching and seed coat phenotype
Figure 11
385
Phenotypic changes in the dof4.2 mutant, DOF4.4 RNAi and dof4.2/DOF4.4RNAi lines
(A) AtDOF4.4 expression in various lines. Error bars indicate S.D. (n = 4). (B) AtDOF4.2 expression in plant lines. Error bars indicate S.D. (n = 4). (C) Plant growth at the maturation stage. (D) Plant
height at the maturation stage. Error bars indicate S.D. (n = 24). (E) Comparison of siliques from various plants. (F) Comparison of silique length. Error bars indicate S.D. (n = 33). (G) Relative
seed mass in various plants. Error bars indicate S.D. (n = 14). The seed mass in the Col-0 plants was set to be 1 and the other values relative to 1. (H) Downstream gene expression in plant lines.
Error bars indicate S.D. (n = 4). (D, F and G) *Significant differences compared with the Col-0 plants (P < 0.05); **significant differences compared with the Col-0 plants (P < 0.01).
Col-0 plant level (Figure 5F), whereas the RI and RII branch
numbers were still higher than that of the Col-0 plants (Figures 5C
and 5D). These analyses indicate that the TMD motif may
play a large role in CII branching, but have only a partial
role in RI and RII branching. Other motifs may also act in
these processes. Additionally, the TMD motif may play a major
role in the regulation of cotyledon size, seed coat phenotype
and monosaccharide content in seeds because mutation of the
motif in AtDOF4.2 caused phenotypes or parameters similar
to those in the Col-0 plants (Figures 7 and 8, and Table 1).
c The Authors Journal compilation c 2013 Biochemical Society
386
H.-F. Zou and others
From expression of putative downstream genes, including AtSTM,
AtTFL1, AtCYP83B1 and AtEXPA9, it seems that the TMD motif
plays a partial role in the regulation of these genes because the
mutation of TMD reduced, but did not abolish, their expression
in transgenic plants when compared with the expression
levels in transgenic plants with normal AtDOF4.2 and the Col-0
plants (Figures 6 and 9). Collectively, the TMD motif may play a
major role in some aspects, but only a partial role in other aspects.
AtDOF4.4 also has roles in branching and silique-related traits
(Figure 10). Whether the TMD motif of this protein has any roles
in different processes requires further investigation.
Previously, when studying the roles of AtDOF4.2 in
phenylpropanoid metabolism, Skirycz et al. [17] found that this
gene was highly expressed in the axillary buds of flower stalks
and its overexpression resulted in a bushy phenotype. In the
present study AtDOF4.2 and its close homologue AtDOF4.4
affect both the primary and secondary branches of rosette leaves
and the cauline leaf secondary branches (Figures 4 and 10).
A series of genes have been shown to participate in the shoot
branching processes by analysis of the phenotypes of their
functional deficit mutants, and these mutants always increase
the number of primary shoot branches [25,27–29,35]. AtDOF4.2
and AtDOF4.4, however, primarily regulated the secondary
shoot branches and only mildly affected the primary shoot
branches. It is thus proposed that AtDOF4.2 and AtDOF4.4
may function redundantly to regulate shoot branching processes
through alternative mechanisms. It should be mentioned that our
dof4.2 mutant appeared to have no strong branching phenotypic
change compared with the Col-0 line (Figure 4). This result is
consistent with that of Skirycz et al. [17], who reported that
knockdown of AtDOF4.2 did not lead to a visible morphological
change. Inhibition of AtDOF4.4 in RNAi lines also did not affect
the branching phenotype (Supplementary Figure S3). Further
knockdown of AtDOF4.4 expression in the dof4.2 mutant did
not result in a change in the branching phenotype (Supplementary
Figure S3), suggesting that other homologues, e.g. AtDOF4.3 and
AtDOF4.5, may also contribute to branching. Alternatively, other
mechanisms may be involved in the process.
AtDOF4.2 may fulfil its function in transgenic plants through
activation of AtSTM, AtTFL1 and AtCYP83B1. AtSTM, a member
of the Arabidopsis KNOTTED transcription factor family, was
found to be expressed in the apical shoot meristem, lateral shoot
meristem and floral meristem. Its mutant stm-1 blocks SAM
initiation [50]. AtSTM affects the shoot meristem by regulating
the expression of downstream genes. The AtTFL1 gene was found
to participate in several stages of stem development. The tfl1-1
mutation causes early flowering and limits the development of
normally indeterminate inflorescence by promoting the formation
of a terminal floral meristem. The AtTFL1-transgenic plants,
in contrast, show extended life phases and highly branched
inflorescences [51]. The cytochrome P450 gene AtCYP83B1
encodes a protein at the metabolic branch point in auxin
and indole glucosinolate biosynthesis. The knockout mutant
of AtCYP83B1 shows strong apical dominance and had only
one single inflorescence, whereas the AtCYP83B1-overexpression
plant has more shoot branches compared with the wild-type plant
[34]. Other unknown genes may also be involved in AtDOF4.2regulated branching processes. Whether AtDOF4.2 regulates
these genes though direct binding to their promoters or through
indirect mechanisms remains to be further elucidated.
Many genes, including regulatory and functional genes, affect
the epidermal cell shape of seed coat. Mutants of these genes
show defects in the development of seed coat to varying degrees,
and mucilage defects are often associated with various abnormal
seed coats [52]. The results of the present study show that the
c The Authors Journal compilation c 2013 Biochemical Society
AtDOF4.2-overexpressing lines show defects in the cell wall of
the seed coat and exhibit a collapsed style of epidermal cells. This
phenotype is different from those of the above-reported mutants,
suggesting that AtDOF4.2 regulates the development of cell wall
in seed coats through different pathways. The collapsed cell wall
structures may be related to the reduced mucilage contents in
AtDOF4.2 transgenic seed coats (Figure 8 and Table 1). It has
been reported that a decrease in the total amount of mucilage
could lead to a failure in mucilage extrusion [56]. Moreover, the
changes in mucilage components could also lead to defects in
mucilage release [52,56]. An increase of Ara (arabinose) in the
seed coat would lead to a defect in mucilage extrusion [57]. In
the AtDOF4.2 transgenic seed coat, Rha is the major component
and was significantly reduced (Table 1). This decrease, together
with reductions in other minor components (Table 1), may result
in a defect in mucilage extrusion, leading to abnormal seed coats
in AtDOF4.2-overexpressing plants.
AtDOF4.2-enhanced expression of the expansin gene AtEXPA9
may act through direct binding to the promoter region (Figure 9).
Arabidopsis expansins belong to a large group of proteins that
are responsible for cell wall loosening and participate in several
physiological processes, including cell growth, fruit softening
and pollen tube elongation [53]. Higher levels of AtEXPA9
in AtDOF4.2-overexpressing plants may be specifically related
to the cell wall collapse observed in the seed coats because
epidermal cells in other organs of the transgenic plants were not
significantly different from those of the Col-0 line (results not
shown). Overexpression of the LeEXP1 gene in tomato plants
leads to smaller and more rubbery fruits but normal vegetative
organs [58]. In the Zinnia xylem, expansin mRNAs are expressed
only in the ends of the cells, which indicates that they may
function during targeted secretion of expansins to specific cell
walls [53,59].
In addition to branching and seed coat formation, AtDOF4.2
also plays roles in regulation of silique length and seed
yield because the dof4.2 mutant had longer siliques and a
higher seed yield than the Col-0 plants (Figure 11). However,
AtDOF4.2 overexpression appeared to not affect these traits
(results not shown). In contrast, AtDOF4.4 overexpression and
the RNAi lines showed silique lengths and seed yields that
were altered in the opposite direction (Figures 10 and 11),
suggesting that AtDOF4.4 may play a major role in the control
of seed-related traits. Considering that AtDOF4.4 regulates the
expression of many storage protein-related genes and lipidrelated genes (Figures 10 and 11, and Supplementary Figure
S4 at http://www.biochemj.org/bj/449/bj4490373add.htm), it is
probable that AtDOF4.4 represents a novel master regulator of
seed development and controls seed storage reserve accumulation.
It should be noted that a reduction in the expression of AtDOF4.4
in the dof4.2 mutant does not further enhance the silique length
and seed mass, suggesting that the two genes may act in the same
pathway to regulate seed traits. Alternatively, the two proteins
may form a complex that affects the seed/silique formation. Other
possibilities may also be present.
Taken together, both AtDOF4.2 and AtDOF4.4 play roles
in shoot branching and seed-related traits. The TMD motif of
AtDOF4.2 is essential for transcriptional activation and is largely
required for the phenotypic change in AtDOF4.2-overexpressing
plants. Manipulation of these genes has potential for use in
improving agronomic-related traits in crops.
AUTHOR CONTRIBUTION
The experiments were carried out by Hong-Feng Zou, Yu-Qin Zhang, Wei Wei, Hao-Wei
Chen, Qing-Xin Song, Yun-Feng Liu, Ming-Yu Zhao, Fang Wang and Bao-Cai Zhang.
AtDOF4.2 affects branching and seed coat phenotype
Qing Lin, Wan-Ke Zhang, Biao Ma and Yi-Hua Zhou provided tools and analysed the data.
Jin-Song Zhang, Shou-Yi Chen and Hong-Feng Zou designed the study, analysed the
data and wrote the paper.
FUNDING
This work was supported by the National Key Basic Research Projects [grant number
2009CB118402], the National Transgenic Research Project [grant numbers 2011ZX08009003-004 and 2011ZX08009-004] and the National Natural Science Foundation of China
[grant number 30925006].
REFERENCES
1 Yanagisawa, S. (2002) The Dof family of plant transcription factors. Trends Plant Sci. 7,
555–560
2 Yanagisawa, S. and Izui, K. (1993) Molecular cloning of 2 DNA-binding proteins of maize
that are structurally different but interact with the same sequence motif. J. Biol. Chem.
268, 16028–16036
3 Zhang, B., Chen, W., Foley, R. C., Buttner, M. and Singh, K. B. (1995) Interactions
between distinct types of DNA binding proteins enhance binding to ocs element promoter
sequences. Plant Cell 7, 2241–2252
4 Yanagisawa, S. and Sheen, J. (1998) Involvement of maize Dof zinc finger proteins in
tissue-specific and light-regulated gene expression. Plant Cell 10, 75–89
5 Yanagisawa, S. (2001) The transcriptional activation domain of the plant-specific Dof1
factor functions in plant, animal, and yeast cells. Plant Cell Physiol. 42, 813–822
6 VicenteCarbajosa, J., Moose, S. P., Parsons, R. L. and Schmidt, R. J. (1997) A maize
zinc-finger protein binds the prolamin box in zein gene promoters and interacts with the
basic leucine zipper transcriptional activator Opaque2. Proc. Natl. Acad. Sci. U.S.A. 94,
7685–7690
7 Diaz, I., Martinez, M., Isabel-LaMoneda, I., Rubio-Somoza, I. and Carbonero, P. (2005)
The DOF protein, SAD, interacts with GAMYB in plant nuclei and activates transcription of
endosperm-specific genes during barley seed development. Plant J. 42, 652–662
8 Mena, M., Cejudo, F. J., Isabel-Lamoneda, I. and Carbonero, P. (2002) A role for the DOF
transcription factor BPBF in the regulation of gibberellin-responsive genes in barley
aleurone. Plant Physiol. 130, 111–119
9 Moreno-Risueno, M. A., Diaz, I., Carrillo, L., Fuentes, R. and Carbonero, P. (2007) The
HvDOF19 transcription factor mediates the abscisic aciddependent repression of
hydrolase genes in germinating barley aleurone. Plant J. 51, 352–365
10 Park, D. H., Lim, P. O., Kim, J. S., Cho, D. S., Hong, S. H. and Nam, H. G. (2003) The
Arabidopsis COG1 gene encodes a Dof domain transcription factor and negatively
regulates phytochrome signaling. Plant J. 34, 161–171
11 Wei, P. C., Tan, F., Gao, X. Q., Zhang, X. Q., Wang, G. Q., Xu, H., Li, L. J., Chen, J. and
Wang, X. C. (2010) Overexpression of AtDOF4.7, an Arabidopsis DOF family
transcription factor, induces floral organ abscission deficiency in Arabidopsis. Plant
Physiol. 153, 1031–1045
12 Kang, H. G., Foley, R. C., Onate-Sanchez, L., Lin, C. G. T. and Singh, K. B. (2003) Target
genes for OBP3, a Dof transcription factor, include novel basic helix-loop-helix domain
proteins inducible by salicylic acid. Plant J. 35, 362–372
13 Ward, J. M., Cufr, C. A., Denzel, M. A. and Neff, M. M. (2005) The Dof transcription factor
OBP3 modulates phytochrome and cryptochrome signaling in Arabidopsis . Plant Cell 17,
475–485
14 Chen, W. Q., Chao, G. and Singh, K. B. (1996) The promoter of a H2 O2 -inducible
Arabidopsis glutathione S-transferase gene contains closely linked OBF- and
OBP1-binding sites. Plant J. 10, 955–966
15 Gabriele, S., Rizza, A., Martone, J., Circelli, P., Costantino, P. and Vittorioso, P. (2010) The
Dof protein DAG1 mediates PIL5 activity on seed germination by negatively regulating GA
biosynthetic gene AtGA3ox1. Plant J. 61, 312–323
16 Skirycz, A., Radziejwoski, A., Busch, W., Hannah, M. A., Czeszejko, J., Kwasniewski, M.,
Zanor, M. I., Lohmann, J. U., De Veylder, L., Witt, I. and Mueller-Roeber, B. (2008) The
DOF transcription factor OBP1 is involved in cell cycle regulation in Arabidopsis thaliana .
Plant J. 56, 779–792
17 Skirycz, A., Jozefczuk, S., Stobiecki, M., Muth, D., Zanor, M. I., Witt, I. and
Mueller-Roeber, B. (2007) Transcription factor AtDOF4.2 affects phenylpropanoid
metabolism in Arabidopsis thaliana . New Phytol. 175, 425–438
18 Guo, Y., Qin, G. J., Gu, H. Y. and Qu, L. J. (2009) Dof5.6/HCA2, a Dof transcription factor
gene, regulates interfascicular cambium formation and vascular tissue development in
Arabidopsis . Plant Cell 21, 3518–3534
19 Gualberti, G., Papi, M., Bellucci, L., Ricci, L., Bouchez, D., Camilleri, C., Costantino, P.
and Vittorioso, P. (2002) Mutations in the Dof zinc finger genes DAG2 and DAG1 influence
with opposite effects the germination of Arabidopsis seeds. Plant Cell 14, 1253–1263
387
20 Kumar, R., Taware, R., Gaur, V. S., Guru, S. K. and Kumar, A. (2009) Influence of nitrogen
on the expression of TaDof1 transcription factor in wheat and its relationship with photo
synthetic and ammonium assimilating efficiency. Mol. Biol. Rep. 36, 2209–2220
21 Tanaka, M., Takahata, Y., Nakayama, H., Nakatani, M. and Tahara, M. (2009) Altered
carbohydrate metabolism in the storage roots of sweetpotato plants overexpressing the
SRF1 gene, which encodes a Dof zinc finger transcription factor. Planta 230, 737–746
22 Wang, H. W., Zhang, B., Hao, Y. J., Huang, J., Tian, A. G., Liao, Y., Zhang, J. S. and Chen,
S. Y. (2007) The soybean Dof-type transcription factor genes, GmDof4 and GmDof11,
enhance lipid content in the seeds of transgenic Arabidopsis plants. Plant J. 52, 716–729
23 Schmitz, G. and Theres, K. (1999) Genetic control of branching in Arabidopsis and
tomato. Curr. Opin. Plant Biol. 2, 51–55
24 Aguilar-Martinez, J. A., Poza-Carrion, C. and Cubas, P. (2007) Arabidopsis BRANCHED1
acts as an integrator of branching signals within axillary buds. Plant Cell 19, 458–472
25 Leyser, O. (2003) Regulation of shoot branching by auxin. Trends Plant Sci. 8, 541–545
26 Shani, E., Yanai, O. and Ori, N. (2006) The role of hormones in shoot apical meristem
function. Curr. Opin. Plant Biol. 9, 484–489
27 Lin, H., Wang, R., Qian, Q., Yan, M., Meng, X., Fu, Z., Yan, C., Jiang, B., Su, Z., Li, J. and
Wang, Y. (2009) DWARF27, an iron-containing protein required for the biosynthesis of
strigolactones, regulates rice tiller bud outgrowth. Plant Cell 21, 1512–1525
28 McSteen, P. (2009) Hormonal regulation of branching in grasses. Plant Physiol. 149,
46–55
29 Ward, S. P. and Leyser, O. (2004) Shoot branching. Curr. Opin. Plant Biol. 7, 73–78
30 Gallavotti, A., Zhao, Q., Kyozuka, J., Meeley, R. B., Ritter, M., Doebley, J. F., Pe, M. E. and
Schmidt, R. J. (2004) The role of barren stalk1 in the architecture of maize. Nature 432,
630–635
31 Li, X. Y., Qian, Q., Fu, Z. M., Wang, Y. H., Xiong, G. S., Zeng, D. L., Wang, X. Q., Liu, X. F.,
Teng, S., Hiroshi, F. et al. (2003) Control of tillering in rice. Nature 422, 618–621
32 Gallavotti, A., Yang, Y., Schmidt, R. J. and Jackson, D. (2008) The relationship between
auxin transport and maize branching. Plant Physiol. 147, 1913–1923
33 Komatsu, K., Maekawa, M., Ujiie, S., Satake, Y., Furutani, I., Okamoto, H., Shimamoto, K.
and Kyozuka, J. (2003) LAX and SPA: major regulators of shoot branching in rice. Proc.
Natl. Acad. Sci. U.S.A. 100, 11765–11770
34 Bak, S., Tax, F. E., Feldmann, K. A., Galbraith, D. W. and Feyereisen, R. (2001) CYP83B1,
a cytochrome P450 at the metabolic branch paint in auxin and indole glucosinolate
biosynthesis in Arabidopsis . Plant Cell 13, 101–111
35 Zou, J. H., Zhang, S. Y., Zhang, W. P., Li, G., Chen, Z. X., Zhai, W. X., Zhao, X. F., Pan,
X. B., Xie, Q. and Zhu, L. H. (2006) The rice HIGH-TILLERING DWARF1 encoding an
ortholog of Arabidopsis MAX3 is required for negative regulation of the outgrowth of
axillary buds. Plant J. 48, 687–696
36 Stirnberg, P., Furner, I. J. and Leyser, H. M. O. (2007) MAX2 participates in an SCF
complex which acts locally at the node to suppress shoot branching. Plant J. 50, 80–94
37 Tantikanjana, T., Yong, J. W. H., Letham, D. S., Griffith, M., Hussain, M., Ljung, K.,
Sandberg, G. and Sundaresan, V. (2001) Control of axillary bud initiation and shoot
architecture in Arabidopsis through the SUPERSHOOT gene. Genes Dev. 15, 1577–1588
38 Takeda, T., Suwa, Y., Suzuki, M., Kitano, H., Ueguchi-Tanaka, M., Ashikari, M., Matsuoka,
M. and Ueguchi, C. (2003) The OsTB1 gene negatively regulates lateral branching in rice.
Plant J. 33, 513–520
39 Muller, D., Schmitz, G. and Theres, K. (2006) Blind homologous R2R3 Myb genes control
the pattern of lateral meristem initiation in Arabidopsis . Plant Cell 18, 586–597
40 Baud, S., Dubreucq, B., Miquiel, M., Rochat, C. and Lepiniec, L. (2008) Storage reserve
accumulation in Arabidopsis : metabolic and developmental control of seed filling.
Arabidopsis Book 6, 1–24
41 Monke, G., Seifert, M., Keilwagen, J., Mohr, M., Grosse, I., Hahnel, U., Junker, A.,
Weisshaar, B., Conrad, U., Baumlein, H. and Altschmied, L. (2012) Toward the
identification and regulation of the Arabidopsis thaliana ABI3 regulon. Nucleic Acids Res.
40, 8240–8254
42 Le, B. H., Cheng, C., Bui, A. Q., Wagmaister, J. A., Henry, K. F., Pelletier, J., Kwong, L.,
Belmonte, M., Kirkbride, R., Horvath, S. et al. (2010) Global analysis of gene activity
during Arabidopsis seed development and identification of seed-specific transcription
factors. Proc. Natl. Acad. Sci. U.S.A. 107, 8063–8070
43 Jones, S., Gonzalez, D. O. and Wodkin, L. O. (2010) Flux of transcript patterns during
soybean seed development. BMC Genomics 11, 136
44 Wuriyanghan, H., Zhang, B., Cao, W. H., Ma, B., Lei, G., Liu, Y. F., Wei, W., Wu, H. J.,
Chen, L. J., Chen, H. W. et al. (2009) The ethylene receptor ETR2 delays floral transition
and affects starch accumulation in rice. Plant Cell 21, 1473–1494
45 Zhang, B., Chen, H. W., Mu, R. L., Zhang, W. K., Zhao, M. Y., Wei, W., Wang, F., Yu, H.,
Lei, G., Zou, H. F. et al. (2011) NIMA-related kinase NEK6 affects plant growth and stress
response in Arabidopsis . Plant J. 68, 830–843
46 Zemach, A., Kim, M. Y., Silva, P., Rodrigues, J. A., Dotson, B., Brooks, M. D. and
Zilberman, D. (2010) Local DNA hypomethylation activates genes in rice endosperm.
Proc. Natl. Acad. Sci. U.S.A. 107, 18729–18734
c The Authors Journal compilation c 2013 Biochemical Society
388
H.-F. Zou and others
47 Song, Q. X., Liu, Y. F., Hu, X. Y., Zhang, W. K., Ma, B., Chen, S. Y. and Zhang, J. S. (2011)
Identification of miRNAs and their target genes in developing soybean seeds by deep
sequencing. BMC Plant Biol. 11, 5
48 Ohta, M., Ohme-Takagi, M. and Shinshi, H. (2000) Three ethylene-responsive
transcription factors in tobacco with distinct transactivation functions. Plant J. 22, 29–38
49 Gibeaut, D. M. and Carpita, N. C. (1991) Tracing cell-wall biogenesis in intact-cells and
plants: selective turnover and alteration of soluble and cell-wall polysaccharides in
grasses. Plant Physiol. 97, 551–561
50 Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996) A member of the
KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis .
Nature 379, 66–69
51 Ratcliffe, O. J., Amaya, I., Vincent, C. A., Rothstein, S., Carpenter, R., Coen, E. S. and
Bradley, D. J. (1998) A common mechanism controls the life cycle and architecture of
plants. Development 125, 1609–1615
52 Penfield, S., Meissner, R. C., Shoue, D. A., Carpita, N. C. and Bevan, M. W. (2001)
MYB61 is required for mucilage deposition and extrusion in the Arabidopsis seed coat.
Plant Cell 13, 2777–2791
53 Cosgrove, D. J. (2000) Loosening of plant cell walls by expansins. Nature 407, 321–326
Received 10 January 2011/20 October 2012; accepted 24 October 2012
Published as BJ Immediate Publication 24 October 2012, doi:10.1042/BJ20110060
c The Authors Journal compilation c 2013 Biochemical Society
54 Krebs, J., Mueller-Roeber, B. and Ruzicic, S. (2010) A novel bipartite nuclear localization
signal with an atypically long linker in DOF transcription factors. J. Plant Physiol. 167,
583–586
55 Cress, W. D. and Triezenberg, S. J. (1991) Critical structural elements of the Vp16
transcriptional activation domain. Science 251, 87–90
56 Western, T. L., Young, D. S., Dean, G. H., Tan, W. L., Samuels, A. L. and Haughn, G. W.
(2004) MUCILAGE-MODIFIED4 encodes a putative pectin biosynthetic enzyme
developmentally regulated by APETALA2, TRANSPARENT TESTA GLABRA1, and
GLABRA2 in the Arabidopsis seed coat. Plant Physiol. 134, 296–306
57 Arsovski, A. A., Popma, T. M., Haughn, G. W., Carpita, N. C., McCann, M. C. and
Western, T. L. (2009) AtBXL1 encodes a bifunctional
β-D-xylosidase/α-L-arabinofuranosidase required for pectic arabinan modification in
Arabidopsis mucilage secretory cells. Plant Physiol. 150, 1219–1224
58 Brummell, D. A., Harpster, M. H., Civello, P. M., Palys, J. M., Bennett, A. B. and
Dunsmuir, P. (1999) Modification of expansin protein abundance in tomato fruit alters
softening and cell wall polymer metabolism during ripening. Plant Cell 11, 2203–2216
59 Im, K. H., Cosgrove, D. J. and Jones, A. M. (2000) Subcellular localization of expansin
mRNA in xylem cells. Plant Physiol. 123, 463–470
Biochem. J. (2013) 449, 373–388 (Printed in Great Britain)
doi:10.1042/BJ20110060
SUPPLEMENTARY ONLINE DATA
The transcription factor AtDOF4.2 regulates shoot branching and seed coat
formation in Arabidopsis
Hong-Feng ZOU1 , Yu-Qin ZHANG1 , Wei WEI, Hao-Wei CHEN, Qing-Xin SONG, Yun-Feng LIU, Ming-Yu ZHAO, Fang WANG,
Bao-Cai ZHANG, Qing LIN, Wan-Ke ZHANG, Biao MA, Yi-Hua ZHOU, Jin-Song ZHANG2 and Shou-Yi CHEN2
State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China
Figure S1
Expression of AtDOF genes in different organs of Arabidopsis shown by RT-PCR
Figure S2 Expressions of genes related to seed coat formation in Col0, transgenic plants overexpressing AtDOF4.2 (4.2-4, 4.2-8) or transgenic
plants overexpressing TMD-mutated AtDOF4.2
1
These authors contributed equally to this work.
Correspondence may be addressed to either of these authors (email [email protected] or [email protected]).
The microarray been deposited into GEO database under the accession number GSE41682.
2
c The Authors Journal compilation c 2013 Biochemical Society
H. F. Zou and others
Figure S3 Shoot branching in various plant lines including Col-0, dof4.2 mutant, DOF4.4 RNAi lines with AtDOF4.4 suppression, and dof4.2/DOF4.4RNAi
lines with suppression of both the AtDOF4.2 and AtDOF4.4 genes
Error bars indicate S.D. (n = 15).
c The Authors Journal compilation c 2013 Biochemical Society
AtDOF4.2 affects branching and seed coat phenotype
Table S1
Primers of 36 AtDOF genes
F, forward; R, reverse.
Figure S4 Downstream gene expressions in dof4.2, DOF4.4 RNAi and
dof4.2/DOF4.4 RNAi plants
Error bars represent the S.D.
Primer name
Locus
Primer sequence (5 →3 )
At Dof1.1 F
AtDof1.1 R
AtDof1.2 F
AtDof1.2 R
AtDof1.3 F
AtDof1.3 R
AtDof1.4 F
AtDof1.4 R
AtDof1.5 F
AtDof1.5 R
AtDof1.6 F
AtDof1.6 R
AtDof1.7 F
AtDof1.7 R
AtDof1.8 F
AtDof1.8 R
AtDof1.10 F
AtDof1.10 R
AtDof2.1 F
AtDof2.1 R
AtDof2.2 F
AtDof2.2 R
AtDof2.3 F
AtDof2.3 R
AtDof2.4 F
AtDof2.4R
AtDof2.5 F
AtDof2.5 R
AtDof3.1 F
AtDof3.1R
AtDof3.2 F
AtDof3.2 R
AtDof3.3 F
AtDof3.3 R
AtDof3.4 F
AtDof3.4 R
AtDof3.5 F
AtDof3.5R
AtDof3.6 F
AtDof3.6 R
AtDof3.7 F
AtDof3.7R
AtDof4.1 F
AtDof4.1 R
AtDof4.2 F
AtDof4.2 R
AtDof4.3 F
AtDof4.3 R
AtDof4.4 F
AtDof4.4 R
AtDof4.5 F
AtDof4.5 R
AtDof4.6 F
AtDof4.6 R
AtDof4.7 F
AtDof4.7R
AtDof5.1 F
AtDof5.1R
AtDof5.2 F
AtDof5.2 R
AtDof5.3 F
AtDof5.3 R
AtDof5.4 F
AtDof5.4 R
AtDof5.5 F
AtDof5.5 R
AtDof5.6 F
AtDof5.6 R
AtDof5.7 F
AtDof5.7 R
AtDof5.8 F
AtDof5.8 R
AT1G07640
TGGCAACAACCAAGCTCAC
CCAAATAGTCTGCGGAGGC
AGCCCTCCTGGTTCTGATA
GTCTCCTCGGTCTGGTCAA
TACCACATGCCCGTCTACT
TTCTCGTCGTTGTTGTCTA
CTTCTATCGGGTCTATTCG
TCACAACAGTTACCTCGTA
AACATTCAACGCCAACATC
ACTTCTCCGAGGCAACAAT
CCGTTACTGGACTCAAGGT
ACTCATAACCCATAGAACCTC
CCGTCGCTGAGAAACCTGA
CCCAAGCCATGCCTCCTCA
GGTGAAGCAGCCGCTACTAAA
GAGTGCGGGACGAAAGTAC
ACGCTAGTTTCTACCCTGTC
TCCCTTTGTCGTTGTCTTC
GATCCACTTCAGAACCCTT
CACAATACCCAAATACAGG
GAATAAGAAGGGTAAATCCG
AGAAGATAACCACGATGATCC
CAAGAAGCCACAATAGCCG
GCACAGCACCAACCATACG
TACAGCCTCACTCAACCACG
CTTACCTCTAGCCGCAGAA
TTCCTCGTCGTCTCCTGTT
ACCTATAACCTCACCCTAC
CTCACAGCCTCGTCACTTT
ATACCTCTAACCACCTTCG
CGGCAAATCATTCCCAACG
CACCTCCGCCATACCTCGT
AAAGGTCTCAAACGGTGCT
GGAATGACCTGGTAGGGTT
ACTCTTCTTCCTCCTCTGTTT
CCAATAACCATAGCCTCCA
AACCGCTAATTCTGGCAACC
CGGAGGTAAAGGACCACTT
TACCTCCATCACAACAAGC
CCCTCCATTGTCAAGAACC
ACTACAGTCTCACGCAACC
GGTTTAGGGATTATTCAGT
TAATGACCTCAGCCTATCC
TAATCTGTCCTTGCTCCTT
GGTTTCTCAAATGATCTTG
GCAACTTGTGTTCATCTTTGT
TTGGTGGGAGTAGTCGTGC
CTGGTTTAGTAGCGGATCG
GAGTTTGTTCGATCTTTTGAC
TGATTCATGTTCATAGCGTGG
TTTCAGCCACGATACTTCT
ACCACCATACCATTGTTTA
GATTAGGACCAACTTCACTG
TCTTCTTCCACCTCTTCCA
CAAGTGTCCGAGATGTGATT
GATTGAAGTTGGAACGGAGC
GCAACGACCAATACCACCA
CCACCTTCGTCACCTCCTC
AACAGTCAGCCCGTTACCA
CTGCTCTTGCGACGACTTG
TACAGTCTCACTCAGCCTCG
ACCTTCCATACAAACCCTG
GCTTCGTCGGTTATTCCAG
ATACCCTAAACTTGGCAAC
CCAACTTCACATTACCACCAT
CTGCTTCTGCTCTGCCACT
CCAACATCGTTACCGCCAATA
CCCTAAAGATGCCCTCCGT
ATTCATCCAAATTCTTCCCTC
CCTCGTTCGCTGCCTTTGA
TATTCCTCTGCCGCTACCA
AAAACCAGAACCCGAACCA
AT1G21340
AT1G26790
AT1G28310
AT1G29160
AT1G47655
AT1G51700
AT1G64620
AT1G69570
AT2G28510
AT2G28810
AT2G34140
AT2G37590
AT2G46590
AT3G21270
AT3G45610
AT3G47500
AT3G50410
AT3G52440
AT3G55370
AT3G61850
AT4G00940
AT4G21030
AT4G21040
AT4G21050
AT4G21080
AT4G24060
AT4G38000
AT5G02460
AT5G39660
AT5G60200
AT5G60850
AT5G62430
AT5G62940
AT5G65590
AT5G66940
c The Authors Journal compilation c 2013 Biochemical Society
H. F. Zou and others
Table S2
Primers of 42 branching-related genes
Table S2
F, forward; R, reverse.
Primer name
Primer name
Locus
Primer sequence (5 →3 )
PINF
PINR
PIDF
PIDR
YUC1F
YUC1R
YUC2F
YUC2R
YUC4F
YUC4R
YUC6F
YUC6R
LASF
LASR
CUC1F
CUC1R
CUC2F
CUC2R
CUC3F
CUC3R
REVF
REVR
RAX1F
RAX1R
RAX2F
RAX2R
RAX3F
RAX3R
MAX1F
MAX1R
MAX2F
MAX2R
MAX3F
MAX3R
MAX4F
MAX4R
BRC1F
BRC1R
BUD1F
BUD1R
BRC2F
BRC2R
AMP1F
AMP1R
ARGOSF
ARGOSR
AXR1F
AXR1R
AXR2F
AXR2R
AXR3F
AXR3R
AXR6F
AXR6R
BPF
BPR
CALF
CALR
CKI1F
CKI1R
EMF1F
AT1G73590
CTGGTCCCTCATTTCCTTC
CAAACGGTACTATTCCTTGC
CGGCGACTATGTTTGAGCT
TGACGACGGAAGAAGGAAT
GGAGCAAAGTTTATGGATGG
CTGCACATATTCCTGGTGG
CATGTGGCTAAAGGGAGTG
TTAACAATGTTGAGGACGAG
AAACTCCCGTTCTTGATGT
TAAGCCAATCGGGTACATT
GCTTGTTGACCGTTTCCTT
TTGATGCTCCACTAATCCC
ACGGTGGTTCGGTAAGGAG
TGCCAGCCAAGAAACAAAG
AAGCGGCGTAGTTAGTAGA
GATGATCCCAAATCCAGAA
CCTGTTTCTCCACTGTCCCTA
ACCGACCTTTGACTCATTCTC
CTAACCAACTTCCCATCAC
AACCCAACAGACCATAACT
AGCGACGACTCGGTACTAAA
AAGGCAAGCAAGCAAATCC
CTCGGACAGCAACAACAAC
AGATGAACCTGAACCACCC
GGGAATAATGTTGTTGAGT
TAATCTTCCATCACTACCG
TTTTGCGACCAAGAAGATG
GTGGAGGCTCCTGAGAACA
CAAGGGAAACTGCTAAAGA
GGATGAAAGCGTATGGATG
TTTTGACGCCATTACCTAT
GAATCTTTCCCATAAACTCA
TCTAAACGGGTGGAACAAG
GACCACGACAATGTAACCA
GCTCAACGACCTTGTAACTT
TTGGCTCTTGCTATTTCTTC
AGCCAAGTGAATCGGAGTT
TGATGCTGCTCAATGGAAT
AGACATCAAACCTGCGAATC
AAAGGGTGACCGAGAAGC
TGAGACCTCGGAAACAATT
CTCATCCACCGTTGCTATT
CGCATCAGAGGGAATAAT
GTGTTTGTTTCATAAATGG
CAAGAGTTACGGCGGAGTT
AGCAGCATAAACGGAGGC
ATGTGGTTTCTGCCTTTG
CTCTGTTTCAAGCCAATG
TACGAGGACAAAGATGGT
GGTGATAGCCACATACAAT
GACTATGTTCCCTCTTATG
CGATACCACTTATCCTTT
GAGCAACTTAGCCGAATG
TGAGCCAACCACTTCCAT
GCACCACGCAGCTCTGTA
CTCAAACTCCCCGAACGA
ACGCCGCTTGAATAGACT
CATTGCTCCCCGAAATAC
TGCCAAATGCCAGAAATG
GCTGCGTGCTGTCTACTT
TCCTGAACCTGGGAATGT
AT2G34650
AT4G32540
AT4G13260
AT5G11320
AT5G25620
AT1G55580
AT3G15170
AT5G53950
AT1G76420
AT5G60690
AT5G23000
AT2G36890
AT3G49690
AT2G26170
AT2G42620
AT2G44990
AT4G32810
AT3G18550
AT1G18350
AT1G68800
AT1G68800
At3g54720
At3g59900
At1g05180
At3g23050
At1g04250
At4g02570
At4g08150
At1g26310
At2g47430
At5g11530
Received 10 January 2011/20 October 2012; accepted 24 October 2012
Published as BJ Immediate Publication 24 October 2012, doi:10.1042/BJ20110060
c The Authors Journal compilation c 2013 Biochemical Society
EMF1R
ERF
ERR
ERA1F
ERA1R
LFYF
LFYR
MPF
MPR
PNHF
PNHR
SEUF
SEUR
SPS1F
SPS1R
STMF
STMR
TFL1F
TFL1R
TIR1F
TIR1R
CYP83B1F
CYP83B1R
Continued
Locus
At2g26330
At5g40280
At5g61850
At1g19850
At5g43810
At1g43850
At1g16410
At1g62360
At5g03840
At3g62980
AT4G31500
Primer sequence (5 →3 )
CCCTCTGCCTCAGTATCT
TGCTATCGGAACAACCAC
TTAAAGATTCTCCTCCTAAC
GACACTCCTCCTTTGACTC
TTCCCATACATTAGCAACAA
ACGGAGGTAGTGGTTTGG
TTATGTAACTCGCTCCTGATT
TGCGTAAGGTGCATAAGG
GGTCTCAAATCGGAACAA
CAGCGTATTATGCTCATC
CCGAACTACAAGCAAACAACCAAAC
AGCCGTGATATTGTGCTT
CCTGATGATGTGCCCTAA
ACGCCTTGTTTCTTTCTC
TTATTATGAAGTGACGGAG
CCAGAGGAAACGGCATTG
ATACCGAGAACCATAGATT
TTCTTCTGTTTCCTCCAA
AACCTATGTATCCCTATGC
CTGAATGTGGAAGTCATCG
TGTACCTCGTTTCTTTGTC
CTTGCACCAACGAAACAC
ATTAAAGGGACCCGAATA