Download Epithelium of Mice T Cells in the Small Intestinal δγ with Variable

This information is current as
of June 18, 2017.
T Cells in Cryptopatch Aggregates Share
TCR γ Variable Region Junctional Sequences
with γδ T Cells in the Small Intestinal
Epithelium of Mice
Bradley S. Podd, Joseph Thoits, Nicholas Whitley,
Hao-Yuan Cheng, Kimberly L. Kudla, Hiroko Taniguchi,
Joanna Halkias, Kerstin Goth and Victoria Camerini
References
Subscription
Permissions
Email Alerts
This article cites 49 articles, 20 of which you can access for free at:
http://www.jimmunol.org/content/176/11/6532.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2006 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
J Immunol 2006; 176:6532-6542; ;
doi: 10.4049/jimmunol.176.11.6532
http://www.jimmunol.org/content/176/11/6532
The Journal of Immunology
T Cells in Cryptopatch Aggregates Share TCR ␥ Variable
Region Junctional Sequences with ␥␦ T Cells in the Small
Intestinal Epithelium of Mice1
Bradley S. Podd,2*† Joseph Thoits,2‡ Nicholas Whitley,‡ Hao-Yuan Cheng,‡
Kimberly L. Kudla,* Hiroko Taniguchi,‡ Joanna Halkias,† Kerstin Goth,† and
Victoria Camerini3†
M
ost T cells developing in the fetal thymus express canonical ␥␦ TCR that give rise to dendritic epidermal T
cells (DETC)4 in the skin (1– 4). By contrast, most T
cells developing in the adult thymus express highly diverse ␣␤
TCR that are distributed widely in the body, whereas few cells
express ␥␦ TCR. Despite the paucity of ␥␦⫹ T cells in the adult
thymus and in nonmucosal sites in the periphery, ␥␦⫹ T cells are
enriched in the intestinal epithelium and in nearly every mucosal/
epithelial location in the adult mouse seemingly distributed by
their TCR ␥ (TCR ␥-chain V region; TCRGV) and ␦ variable (TCR
␦-chain V region; TCRDV) gene usage (5– 8). For example, a large
*Department of Pediatrics, University of Virginia Health Sciences Center, Charlottesville, VA 22908; †Department of Pediatrics and Department of Surgery, Childrens
Hospital Los Angeles, and Saban Research Institute, University of Southern California, Los Angeles, CA 90027; and ‡Department of Pediatrics and the Center for Immunology, University of California, Irvine, CA 92697
Received for publication June 3, 2005. Accepted for publication March 22, 2006.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by a grant from the National Institutes of Health
(AI440941).
2
B.S.P. and J.T. contributed equally to this work.
3
Address correspondence and reprint requests to Dr. Victoria Camerini, Associate
Professor of Pediatrics, Childrens Hospital Los Angeles, Saban Research Institute,
University of Southern California and the Keck School of Medicine, 4650 Sunset
Boulevard, Mailstop 31, Los Angeles, CA 90027. E-mail address: vcamerini@
chla.usc.edu
4
Abbreviations used in this paper: DETC, dendritic epidermal T cell; TCRGV; TCR
␥-chain V region; TCRDV, TCR ␦-chain V region; IEL, intestinal intraepithelial lymphocyte; ILF, intestinal lymphoid follicles; lin⫺, lineage negative; DAPI, 4⬘,6⬘-diamidino-2-phenylindole; DAB, 3⬘ 3⬘diaminobenzidine; AEC, 3-amino-9-ethylcarbazole; LMD, laser-assisted microdissection.
Copyright © 2006 by The American Association of Immunologists, Inc.
fraction of TCR ␥␦⫹ intestinal intraepithelial lymphocytes (IEL)
express TCRGV gene 5 (TCRGV5), often in conjunction with
TCRDV4 in C57BL/6 mice (nomenclature of Garman et al. (2)).
DETC express TCRGV3, and the few ␥␦⫹ T cells in nonmucosal/
epithelial sites in the periphery of mice use TCRGV1.1,
TCRGV1.2, and TCRGV2 in combination with a variety of TCRDV
gene products (9). The mechanisms responsible for the tissue localization of ␥␦⫹ T cells remain undefined (5, 9, 10). Studies in ␥␦
TCR transgenic mice demonstrate that normally nonmucosal
TCRGV gene products do not restrict the development of TCR ␥␦⫹
IEL, suggesting that tissue-specific Ags may not play a major role
in the pattern of ␥␦⫹ TCR gene usage at least in the intestine
(11–13). Studies of DETC cells, however, suggest that the expression of “skin-seeking” receptors during development in the thymus
may dictate patterns of homing that are unique to these ␥␦ T cells
(10, 12). The anatomic location and time point at which precursors
of TCR ␥␦⫹ IEL acquire “gut-seeking” signals are not known.
The extent that T cell precursors of IEL develop in the thymus
remains controversial (14 –16). In addition, the anatomic site
where extrathymic development of T cells would occur in the intestine, and whether these events lead to the generation of TCR⫹
IEL in mice is unsettled (17–22). This is particularly enigmatic in
light of the centralized and highly regulated development of T cells
known to occur in the thymus (23). The identification of cell clusters, called cryptopatch aggregates, distributed throughout the intestinal lamina propria, offered one potential site where a nonthymic pathway of T cell development would be centralized in the
intestine (24 –27). Cryptopatch aggregates, unlike Peyer’s patches
and intestinal lymphoid follicles (ILF), consist of CD117⫺, lineage
negative (lin⫺), and CD117⫹, IL-7R␣⫹, lin⫺ cells, with few TCR
0022-1767/06/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
The role of cryptopatch aggregates in the development of intestinal intraepithelial lymphocytes (IEL) is a matter of controversy.
Therefore, an important question is whether T cells in cryptopatch aggregates are lineally related to IEL. We hypothesized that
if ␥␦ⴙ IEL derive from T cells in cryptopatch aggregates, then a clonal relationship would exist between the two populations. To
test this hypothesis, we compared the sequence of rearranged TCR gamma variable region 5 genes in ␥␦ⴙ IEL and cryptopatch
cells. We purified IEL by FACS and cryptopatch cells were isolated from frozen sections of the intestine by laser-assisted microdissection. PCR showed that TCR gamma variable region 5 was rearranged in ␥␦ⴙ IEL and in CD3ⴙ cryptopatch cells, but
not in CD3ⴚ cryptopatch cells. DNA sequence analysis showed that the frequency of in-frame junctions in cryptopatch aggregates
was at a level consistent with positive selection in both wild-type and athymic nude mice. In addition, the predicted amino acid
sequences of V-J junctions present in ␥␦ⴙ IEL and cryptopatch cells were encoded by identical nucleotide sequences. By contrast,
the frequency of in-frame joints was significantly reduced in cryptopatch cells isolated from TCR ␦-deficient mice, indicating that
the enrichment of in-frame joints in cryptopatch cells must normally depend on expression of surface ␥␦ TCR. Our results are
consistent with the hypothesis that a subset of ␥␦ⴙ IEL are related to T cells in cryptopatch aggregates. The precise role of
cryptopatch aggregates in intestinal ␥␦ⴙ T cell homeostasis still needs to be determined. The Journal of Immunology, 2006, 176:
6532– 6542.
The Journal of Immunology
Materials and Methods
Mice
Mice between 6 and 12 wk of age were obtained from Taconic Farms and
The Jackson Laboratory and housed in a laminar flow barrier facility under
specific pathogen-free conditions. Male and female C57BL/6 mice
(C57BL/6NTac), TCR ␦-chain-deficient mice (TCR ␦⫺/⫺) (B6.129P2Tcrdtm1Mom) (35), and C57BL/6 nude (C57BL/6NTac-Foxn1nu) mice
were used for these studies. The Institutional Animal Care and Use Committee approved all animal protocols and procedures.
Preparation of lymphocyte populations
Intestinal lymphocytes were prepared from the small intestine of mice using our previously published procedure (36). Briefly, the small intestine
was dissected from its mesentery and washed in RPMI 1640 (Invitrogen
Life Technologies). The intestine was opened longitudinally, and the contents were removed. The intestine was cut into 0.5-cm pieces, and mononuclear cells were released from the epithelium by shaking in calcium and
magnesium-free HBSS (Invitrogen Life Technologies) supplemented with
1 mM DTT (Sigma-Aldrich). Mononuclear cells collected from the epithelial layer were filtered through stainless steel mesh, and IEL were enriched on a discontinuous 20%/40%/70% Percoll (Amersham, Biosciences)
gradient at 900 ⫻ g for 20 min. IEL were collected at the 40%/70% interface, washed with RPMI 1640 with 10% FCS, and kept on ice until use,
as noted below. Epithelial cells, enriched with mononuclear cells at the
20%/40% interface, were washed as described above and stored on ice until
use, as noted below. Mononuclear cells were released from the thymus and
spleen by mechanical disruption of the capsule between frosted glass
slides. Hypotonic lysis was used to deplete RBC from splenocytes. Mononuclear cell populations were collected by centrifugation and suspended in
RPMI 1640 with 10% FCS until use, as noted below.
Ab staining and cell sorting
Lymphocyte populations were prepared for cell sorting by suspension in
mAb staining buffer (PBS with 5% FCS (Invitrogen Life Technologies),
0.02% NaN3 (Sigma-Aldrich)) supplemented with 5.0 ␮g/ml mAb CD16/
CD32 (2.4G2) (BD Biosciences) at a concentration of 1 ⫻ 106 cells/ml.
Pretitered mAb directly conjugated to FITC, PE, biotin, and allophycocyanin were added to cell suspensions and incubated at 4°C for 30 min. Cells
were then washed in PBS and suspended in staining buffer with an optimal
concentration of streptavidin PE-Cy7 or streptavidin-PerCP (Caltag Laboratories) to detect biotin-conjugated primary mAb. Cells were incubated
at 4°C for 30 min and then washed three times with PBS before cell sorting.
The following mAbs were used for cell surface staining before cell sorting
(see below): TCR ␤ (H57 597), TCR ␥␦ (GL3), CD3␧ (145-2C11), and pan
CD45 (30-F11) (all purchased from BD Biosciences or Biolegend).
After mAb staining, intestinal mononuclear cells were suspended in
RPMI 1640 with 10% FCS on ice. Lymphocytes were defined by forward
and side scatter characteristics, and CD45⫹, CD3␧⫹, TCR ␤⫹, or TCR ␥␦⫹
IEL were distinguished from each other and from CD45⫹, CD3␧⫺, and
CD45⫹, TCR ␤⫺ or TCR ␥␦⫺ IEL subsets by gating with a half-log window between cell populations of interest on a FACSVantage Cell Sorter
(BD Immunocytometry Systems) or a MoFlo high-performance cell sorter
(DakoCytomation). TCR ␤⫹ cells were isolated from suspensions of
splenocytes using the same protocol. Sorted cell populations were 98 –
100% pure upon reanalysis. Sorted cells were collected by centrifugation at
1200 rpm for 5 min, and pellets were suspended in DNA or RNA lysis
buffer and stored at ⫺20°C until use. DNA was purified using the DNeasy
tissue kit, and RNA was purified using the RNeasy kit following the included directions (Qiagen).
Preparation of the small intestine for embedding, tissue
sectioning for immunocytochemical studies, and laser
microdissection
The small intestine was excised en bloc, opened longitudinally, cleaned,
and placed in PBS (pH 5.5; 4°C). Five- to 6-cm lengths were immersed
immediately in optimal cutting temperature compound (Miles) and frozen
on dry ice. Frozen tissue blocks were cut on a cryostat microtome, and 6to 7-␮m sections were placed on coated glass slides or on Leica membrane
slides (Leica Microsystems) pretreated with bonding agent (VECTABOND; Vector Laboratories) for microdissection. Tissue sections were
fixed in acetone and stored at ⫺80°C until use. Before staining, tissues
sections were returned to room temperature and incubated for 20 min in
PBS supplemented with 20% normal serum (Vector Laboratories) followed
by incubation with biotinylated or fluorescence-conjugated mAb specific
for CD45, TCR ␥␦ (GL-4 and GL-3), TCR ␤ (⌯57-597), CD3␧ (2C11),
CD69 (H1.2F3), or CD117 (2B8) (all purchased from BD Biosciences or
Biolegend) in PBS supplemented with 5% FCS. If the primary mAb was
not directly conjugated to a fluorescence label, tissue sections were incubated with biotinylated goat anti-hamster IgG or biotinylated rabbit anti-rat
IgG (as required) followed by incubation with avidin-HRP (ABC; avidinbiotin complex) (all obtained from Vector Laboratories). Slides examined
by fluorescence microscopy were counterstained with 4⬘,6⬘-diamidino-2phenylindole (DAPI) (Molecular Probes) and mounted in Prolong Gold
Anti-fade Mounting Medium (Molecular Probes). Slides examined by light
microscopy were incubated with 3⬘ 3⬘diaminobenzidine (DAB) or 3-amino-9-ethylcarbazole (AEC) (Vector Laboratories), and sections were counterstained by hematoxylin blue (Biomeda). Control sections were prepared
following incubation with the appropriate isotype control mAb or following addition of biotinylated mAb conjugate alone. Slides were examined
using a Leica DMLA microscope (Leica Microsystems) equipped with the
appropriate filter sets, and images were captured using an attached SPOT
camera. Positively staining cells were identified under light or fluorescence
microscopy.
In vivo labeling of lymphocytes subsets by BrdU
Mice were injected i.p. daily for three consecutive days with 100 ␮l of a 10
mg/ml solution of BrdU (Sigma-Aldrich) in PBS. On the fourth day, the
small intestine was harvested in the usual fashion for histological analysis
(see above). BrdU FITC-conjugated mAb (3D4; Caltag Laboratories or BD
Biosciences) was used for detection of incorporated BrdU. For immunofluorescent histology, 5-␮m serial sections of intestine and thymus were cut
and pretreated according to a modified protocol (Vector Laboratories).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
␥␦⫹ and TCR ␣␤⫹ cells, and a larger population of CD11c⫹ dendritic cells (25). Transfer of purified CD117⫹, IL-7R␣⫹, lin⫺
cells, but not the CD117⫺, lin⫺ counterpart, gave rise to TCR ␣␤⫹
and TCR ␥␦⫹ IEL in SCID mice, supporting the fact that CD117⫹,
IL-7R␣⫹, lin⫺ cells include precursors of IEL (26). Kinetic and
ontogenic studies have also linked cells in cryptopatch aggregates
with TCR ␥␦⫹ IEL (and TCR ␣␤⫹ IEL). Cryptopatch aggregates
are established after birth in mice, but before the expansion of TCR
␥␦⫹ IEL later in postnatal life (24, 27, 28). A similar kinetic relationship was observed in adoptive transfer studies using cryptopatch- (26, 27) and bone marrow-derived cells (25, 29). In each
case, restoration of cryptopatch aggregates preceded reconstitution
of IEL. The absence, or the marginal level of mRNA and protein
for RAG-2 and mRNA for other genes required for T cell lineage
progression has cast doubt on whether cryptopatch aggregates are
primary lymphoid organs (30 –32). Moreover, recent studies demonstrated that mice lacking cryptopatch aggregates were replete
with IEL subsets, at least at the population level, suggesting that
cryptopatch aggregates are not obligate for IEL development (33,
34). Hence, the extent to which cryptopatch aggregates are primary
lymphoid organs and give rise to T cell precursors of IEL remains
controversial.
In this study, we explored the possibility that ␥␦⫹ T cells in
cryptopatch aggregates are lineally related to TCR ␥␦⫹ IEL.
TCRGV5 was preferentially rearranged in cryptopatch aggregates,
similar to TCR ␥␦⫹ IEL. Furthermore, TCRGV5 rearrangements
were only detected in CD3⫹ cryptopatch cells but not in CD3⫺
cryptopatch cells. Moreover, the frequency of in-frame TCRGV5
segments in cryptopatch cells was greater than would be expected
to occur by chance alone and was reduced in mice unable to express a surface ␥␦ TCR. Despite evidence that cryptopatch aggregates function as primary lymphoid organs, we did not detect
mRNA for RAG-1 gene expression in cryptopatch aggregates. Finally, the same nucleotide sequence accounted for the majority of
in-frame TCRGV5 exons in cryptopatch cells and was shared with
a subset of TCR ␥␦⫹ IEL. Our data support the hypothesis that T
cells in cryptopatch aggregates are clonally related to TCR ␥␦⫹
IEL. Perhaps cryptopatch aggregates are reservoirs for Ag-selected
␥␦⫹ T cells in adult mice. This may, in turn, promote the restricted
TCR ␥␦⫹ repertoire characteristic of IEL.
6533
CRYPTOPATCH AGGREGATES AND ␥␦ T CELLS
6534
Briefly, intestinal sections were rinsed in tap water for 5 min, preheated in
distilled water at 37°C for 5 min, and finally incubated in 2 N HCl at 37°C.
In cases of dual labeling for surface CD3␧ expression, sections were incubated in 2 N HCl for 5 min, or when analyzing BrdU incorporation
alone, sections were incubated for 30 min. Slides were rinsed in tap water
and neutralized in 50 mM TBS (pH 7.4) for 10 min before standard immunofluorescent staining as noted above. Fluorescent images were obtained on a Leica fluorescence microscope (Leica Microsystems) using
OpenLab imaging software (Improvision). BrdU⫹ cells were counted per
individual cryptopatch aggregate. To normalize differences in the size of
individual cryptopatch aggregates, the number of BrdU⫹ cells was corrected for the area of the aggregate. The long and short axes of each cryptopatch aggregate were measured and the area calculated (A ⫽ ␲[xy/4]),
where x and y are the short and long axes of an ellipse, respectively. The
density of BrdU⫹ cells per unit area of cryptopatch was then determined.
Adobe Photoshop (Adobe) was used to merge single-color images.
Laser-assisted microdissection (LMD)
Nucleic acid preparation, PCR, cloning, and sequencing
Purified DNA (50 –100 ng of template or as noted) was added to a 25- to
50-␮l PCR mixture containing 100 ng of each primer in GeneChoice Taq
Reaction Buffer (PGC Scientifics) supplemented with 1.5 mM MgCl2, 2.5
mM dNTP (Amersham Biotech), and 0.5 U of thermostable DNA polymerase (Taq) (PGC Scientifics). DNA was amplified for 30 cycles in a MJ
Research Thermal Cycler using the following parameters: 94°C for 1 min,
61.5°C for 2 min, and 72°C for 2 min with a final step at 72°C for 5 min.
Genomic DNA was amplified using previously published primer pairs (16):
VG1.2, ACATTGGTACCGGCAAAAAAC; VG2, GGGGGGAATTC
CCCTCACCCATATTTTCTT; VG3, GCACTGGATCCAACTGAAA
GAAG; VG4, CCAAAGAATTCTGTGTAGTTC; VG5, TCCACTGGTAC
CGATTCCAG; JGpan, GGGAGCTTACCAGAGGGAATTACTATGAG;
p53, 5⬘- TCACTGCATGGACGATCTGTTGC; and p53, 3⬘GATGATGGTA
AGGATAGGTCGGCG (37). Linear-range amplification conditions were
confirmed by multiple PCR of TCRVG5 with varying numbers of cycles,
followed by densitometry of products. PCR amplification of cDNA was performed using 1– 8 ␮l of each cDNA reaction mix derived from equivalent
amounts of input RNA, in a final volume of 25–50 ␮l containing the manufacturer’s buffer as noted above and each primer in specified pairs. Amplifications were performed in a MTC 100 or DNA Engine Thermocycler (MJ
Research). Amplification conditions were 1 cycle of 2 min at 94°C, 1 min at
61.5°C, 2 min at 72°C followed by a total of 30 cycles, and a remaining
extension for 5 min at 72°C. cDNA was amplified in separate reactions using
the following: RAG1, 5⬘-CCAAGCTGCAGACATTCTAGCACTC;
RAG1, 3⬘-CAACATCTGCCTTCACGTCGATCC; villin, 5⬘-GCTTGAA
GTAGCTCCGGAAA; villin, 3⬘-TCCTGGCTATCCACAAGACC; 5⬘
␤-actin, 5⬘ATGGATGACGATATCGCT; and 3⬘ ␤-actin, 5⬘ATGAGG
TAGTCTGTCAGGT.
Results
Cryptopatch aggregates can be isolated by LMD of thin frozen
intestinal sections
Cryptopatch aggregates have been previously isolated for molecular and cell lineage studies from the small intestine using stereomicroscopy and manual dissection under high-power magnification (26, 27, 34). However, this technique requires specialized
equipment and training. Purification of cryptopatch cells expressing the stem cell factor receptor (c-kit ligand or CD117), but lacking multilineage-specific markers from lamina propria-derived
mononuclear cell suspensions is an alternative method (32), although the anatomic location of cells collected in this way cannot
be assured. To circumvent both limitations, we used LMD (38) to
isolate cryptopatch aggregates and distinct cell populations within
these aggregates from frozen thin sections of the intestine. Cryptopatch aggregates were distinguished from ILF by mAb staining
as described previously (24, 34). A large proportion of cells within
cryptopatch aggregates expressed CD117 (Fig. 1A), whereas fewer
cells expressed CD3␧ (Fig. 1B). For LMD, cryptopatch aggregates
were captured from intestinal tissue sections on glass slides onto
Capsure-HS caps (Fig. 2, A–C) or were dissected from slides by
membrane-based laser dissection (Fig. 2, D–F) as described in
Materials and Methods. Microscopic re-examination of the intestinal sections and visualization of isolated cryptopatch cells after
each harvest confirmed the fidelity of the isolation. To confirm that
cells in cryptopatch aggregates were isolated free of the intestinal
epithelium, a possible source of rearranged TCRGV5 gene segments in resident TCR ␥␦⫹ IEL, cryptopatch aggregates and the
epithelial layer were harvested from adjacent regions in the intestine and separately examined for the expression of villin, a protein
abundantly expressed by epithelial cells throughout the intestine
(39) (Fig. 2, D–F). mRNA for villin was detected in RNA prepared
FIGURE 1. Cryptopatch aggregates include CD3⫹ cells. Immunohistochemical identification of cryptopatch aggregates in the small intestine of
mice showing clusters of CD117⫹ (A) and individual dispersed CD3␧⫹ (B)
cells in cryptopatch aggregates in the small intestine of mice. Frozen sections of the small intestine were incubated with CD117 (A) and CD3␧ mAb
followed by biotinylated rabbit anti-rat IgG or biotinylated goat antihamster IgG, respectively. CD117⫹ (A) and CD3⫹ (B) cells were identified
after incubation with ABC and visualized with DAB (black). Cryptopatch
aggregates consist of a large population of CD117⫹ cells but contain CD3⫹
cells. CD3⫹ cells were also clustered around the perimeter of the aggregate
and in the intestinal epithelial layer. Slides were counterstained with hematoxylin and are shown at ⫻500 original magnification. Representative
sections are shown following the examination of ⬎10 mice. Control staining using isotype mAb was negative (data not shown).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Frozen sections cut at 7-␮m thickness on a cryostat microtome were placed
on uncoated glass slides (Fisher Scientific) for harvest by the PixCell II
(Arcturus Engineering) laser capture system or on Leica Membrane slides
for tissue harvest with the Leica AS LMD Microdissection system (Leica
Microsystems). In either case, intestinal sections were air dried, fixed, and
stored at ⫺80°C until use. Slides were allowed to return to room temperature before further processing by immunostaining, as noted above, or were
counterstained with either hematoxylin (Fisher Biochemicals) or Toludine
Blue O (Electron Microscopy Sciences). Slides were prepared for LMD
using two methods. Tissue sections prepared for LMD using the Leica
system were air dried before dissection, whereas tissue sections for harvest
using the Arcturus system were washed in distilled water followed by
successive washes in 70, 95, and 100% ethanol, and a final dehydration
step in xylene (Fisher Biochemicals) before air drying. Cryptopatch aggregates, the epithelium, or distinct cells within the cryptopatch aggregates
were identified under light or fluorescence conditions as noted in the figure
legends. The laser aperture, attenuation, and cutting speed were adjusted as
per the manufacturer’s recommendation and based on tissue requirements.
Imaging software captured sequential images before and after laser cutting
as well as an automated image capture of the Capsure-HS LMD cap or
PCR tube for inspection and documentation of capture. Cells, or groups of
cells on Capsure-HS caps or membranes were harvested and placed directly into DNA or RNA lysis buffer. DNA was extracted using the PicoPure DNA kit (Arcturus Engineering), and RNA was extracted using the
QIAgen Micro RNeasy kit (Qiagen) as per the manufacturer’s instructions.
After DNase treatment, total cellular RNA was used to prepare cDNA
using the First-Strand cDNA Synthesis kit (Amersham-Pharmacia) following the manufacturer’s instructions.
PCR products were resolved on a 1.8% agarose gel and visualized by
UV light following ethidium bromide staining. PCR-amplified TCRGV5
gene segments were purified using the QIAquick PCR Purification Kit as
per the manufacturer’s instructions (Qiagen). Amplified gene segments
were cloned into the TA cloning kit vector pCR2.1 as per the manufacturer’s instructions (Invitrogen Life Technologies). The sequence of cloned
TCRGV genes was determined with the ABI Prism Automated DNA Sequencer using universal primers specific for the plasmid backbone.
The Journal of Immunology
6535
TCRGV gene usage is not stochastic in cryptopatch aggregates
and is restricted to CD3⫹ cryptopatch cells
TCRGV5 rearrangements were readily detected in CD3⫹ cryptopatch cells, but not in CD3⫺ cells (Fig. 4C). Although CD3⫹ cells
were readily detected in cryptopatch aggregates (Figs. 1B, and 5,
A–C), we consistently observed fewer and variable numbers of
TCR ␥␦⫹ cells (or TCR␣␤⫹ cells; data not shown) in cryptopatch
aggregates (Fig. 5, A–C). By contrast, TCR ␥␦⫹ cells were readily
detected in the intestinal epithelium. In no case did we detect
We used PCR to determine whether TCRGV to VJ gene rearrangements had occurred in cryptopatch cells and how TCRGV gene
usage compared with IEL. Although rearranged TCRGV1.2,
TCRGV2, and TCRGV3 were detected in TCR ␣␤⫹ and TCR ␥␦⫹
IEL, rearranged TCRGV5 was enriched in TCR ␥␦⫹ IEL relative
to TCR ␣␤⫹ IEL (Fig. 3, A and B). Cryptopatch aggregates had
consistent rearrangement of TCRGV1.2 and TCRGV5 gene segments, although the level of TCRGV1.2 was lower than for
TCRGV5 (Fig. 3D). Rearrangement of TCRGV2 and TCRGV3
were inconsistently detected in DNA derived from cryptopatch
aggregates, whereas TCRGV4 was never detected (data not
shown). By contrast, rearrangement of TCRGV5 was not as abundant in DNA derived from unfractionated thymocytes when compared with other TCRGV rearrangements (Fig. 3C).
We examined whether rearranged TCRGV5 genes in cryptopatch aggregates were present in CD3⫹ or CD3⫺ cryptopatch
cells. We harvested CD3⫹ and CD3⫺ cells by LMD under light
microscopy after staining intestinal sections with mAb to CD3␧
and visualization of CD3⫹-positive cells by AEC (Fig. 4, A and B).
FIGURE 3. TCRGV5 rearrangements are enriched in TCR ␥␦⫹ IEL
and cells in cryptopatch aggregates. Genomic DNA was extracted from
IEL purified by FACS (A–B), from unfractionated thymocytes (C), and
from cryptopatch aggregates isolated by LMD (D). V to J rearrangement of
the TCRGV gene segment was determined using the TCR VG-JG primer
pairs noted. Following amplification, PCR products were resolved on a
1.8% agarose gel stained with ethidium bromide and visualized by exposure to UV light. The results are representative of a minimum of four
independent experiments for each cell subset.
from intestinal epithelial cells, but not detected in cryptopatch aggregates despite abundant mRNA for ␤-actin (Fig. 2G). Hence,
cryptopatch aggregates can be isolated by LMD free of contamination by the overlying epithelium and its resident T cells.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 2. Cryptopatch aggregates can be isolated from the small intestine using two laser dissection systems. Segments of the small intestine were
fixed in acetone before staining with H&E (A–C) or with hematoxylin (D–F). Representative cryptopatch aggregates were visualized (A), and the cellular
aggregate was captured free from surrounding intestinal cell types (B) onto the Capsure-HS cap film support (C) using standard laser settings on a PixCell
II instrument (Arcturus Engineering). Alternatively, cryptopatch aggregates were visualized after hematoxylin staining (D) and the aggregate was dissected
from the surrounding intestinal tissue (E) using the AS LMD Microdissection system (Leica Microsystems). The ability of LMD to harvest cryptopatch
cells with a high degree of purity from the adjacent epithelial cells (F) was confirmed by RT-PCR analysis of villin expression of cDNA derived separately
from cryptopatch aggregates and from the epithelium (G). RT-PCR demonstrated no detectable mRNA for villin in cryptopatch aggregates (lane 1), whereas
␤-actin mRNA was abundant (lane 2). By contrast, villin was readily detected in the epithelial layer harvested by LMD (lane 3). Lanes 5 and 6 show villin
and ␤-actin expression from mRNA derived from small intestinal epithelial cells prepared freshly from the intestine, as described for the preparation of
mucosal lymphocytes.
6536
CRYPTOPATCH AGGREGATES AND ␥␦ T CELLS
FIGURE 5. Cryptopatch aggregates contain few T cells, a subset of which expresses CD69. T cells in cryptopatch aggregates from C57BL/6 mice (A–F)
were identified in frozen sections of the small intestine after staining with mAb CD3␧ FITC (A) and TCR ␥␦ PE (B). An overlay of single-color images
is shown in (C). CD3⫹ cells are scattered throughout the cryptopatch aggregate, whereas few TCR ␥␦⫹ cells are present. A CD3␧⫹, TCR ␥␦⫹ cell residing
within the border of the cryptopatch is indicated by an arrow. Staining with CD3␧ FITC (D) and CD69 PE (E) are shown, with an overlay of single-color
images in F. A CD3␧⫹, CD69⫹ cell is indicated by an arrow. Frozen sections from a TCR ␦⫺/⫺ (G–L) mouse were stained with Abs to TCR ␤ (G), CD3␧
(H). An overlay of single-color images is shown with DAPI counterstain in (I). Close examination revealed that each TCR ␤⫹ cell costained with CD3␧,
although CD3␧ intensity varied. Original magnification, ⫻320. Frozen sections were stained with Abs to CD3␧ (J) and CD69 (K), and an overlay of
single-color images is shown with DAPI (L). Original magnification ⫻320, except for (G–I), enlarged from ⫻200. Data shown are representative of multiple
cryptopatch aggregates examined from at least three individual mice.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Rearrangement of TCRGV5 is linked to CD3␧⫹ cells in cryptopatch aggregates, although no evidence of RAG-1 gene expression was found.
Cells expressing CD3␧ were identified in cryptopatch aggregates in thin frozen sections of the small intestine following incubation with ABC visualized
with AEC (red). Tissue sections were counterstained with hematoxylin before LMD and are shown at ⫻500 original magnification. CD3⫹ and CD3⫺
cryptopatch cell populations were identified in multiple sections (A) and harvested separately by LMD as described in Materials and Methods. Postdissection images documented selective harvest of respective cell populations (B). Genomic DNA was extracted from respective CD3⫹ and CD3⫺ cryptopatch
cell subsets shown in B above and amplified using primers for TCRGV5 and p53 (C). Results are representative of experiments performed on intestines
isolated from two individual mice. RT-PCR analysis of cDNA derived from cryptopatch aggregates or thymus was serially diluted and amplified for
expression of RAG-1 and ␤-actin (D). RNA samples were reverse transcribed with random oligo priming, and the resultant reverse transcription products
were serially diluted and amplified by PCR with appropriate primer pairs as noted in the Materials and Methods. The ⫹ is the positive control using thymus
cDNA amplified in parallel with cryptopatch cDNA, and ⫺ is the negative control amplification with no added template cDNA. Data are representative
of four independent experiments.
The Journal of Immunology
6537
Table I. Percentage of in-frame V to J joints in TCRGV exons isolated from IEL and cryptopatch aggregatesa
Mouse
Strain
Cell Population
⫹
CD57BL/6
TCR ␥␦ IEL
Nude
TCR ␦⫺/⫺
TCR ␣␤⫹ IEL
Cryptopatch cellsd
CD3⫺ IEL
Cryptopatch cells
Cryptopatch cells
c
TCRGV
Gene
V to J Junctions In-Frameb
(%)
No. of
Genes
n
VG1.2
VG5
VG5
VG5
VG5
VG5
VG5
33
78
43
53e
34
57
35
40
37
46
60
42
21
65
4
3
2
4
2
1
4
a
The predicted amino acid sequence was determined from the DNA sequence generated from the IEL and cryptopatch aggregates shown.
The percentage of in-frame exons was determined from the predicted amino acid sequence across the CDR3 of the TCRGV (J) junction.
n is the number of experiments where DNA for cIEL subsets was derived from pools of 4 – 6 individual mice or DNA for d cryptopatch aggregates was derived from pools
of 6 –10 cryptopatch aggregates isolated from a minimum of two individual mice.
e
p ⫽ 0.04 when compared to the frequency of in-frame TCRGV-J joints isolated from DNA prepared from cryptopatch aggregates isolated from TCR ␦⫺/⫺ mice.
b
c
mRNA for RAG-1 (or mRNA for RAG-2; data not shown) in cryptopatch aggregates, although this gene product was abundant
among mRNA extracted from the thymus (Fig. 4D).
The frequency of in-frame TCRGV to J joints has been used to
predict lineage commitment and to estimate the probability of cellular selection mediated by surface TCR ␤ expression in thymocytes (40). We used a similar assay to compare the frequency of
in-frame TCRGV5 genes isolated from cryptopatch cells to TCR
␥␦⫹ IEL. We found on average that 78% of V to J joints in
TCRGV5 exons derived from TCR ␥␦⫹ IEL were in-frame (Table
I). By contrast, only 33% of V to J joints in TCRGV1.2 genes
isolated from TCR ␥␦⫹ IEL were in-frame, indicating that, although this gene rearrangement was detected by PCR, few TCR
␥␦⫹ IEL were selected to express this TCRGV chain. To maximize
the probability of detecting overlap between V region rearrangements in IEL and cells in cryptopatch aggregates, we focused our
analysis on TCRGV5-J exons. We found on average that 53% of
joints in TCRGV5 gene segments isolated from cryptopatch cells
were in-frame. By contrast, the frequency of in-frame joints in
exons cloned from TCR ␣␤⫹ IEL was 43%, TCR ␣␤⫹ cells isolated from the spleen was 36%, whereas IEL lacking surface CD3␧
expression had a frequency of in-frame rearrangements of 34%. To
determine whether the frequency of in-frame joints varied between
different cryptopatch aggregates, we harvested individual aggregates from the proximal, middle, and distal region of the small
intestine. The frequency of in-frame rearrangements varied from
20 to 86% in any given region, with an average frequency of 60%
(Table II) similar to the frequency of in-frame rearrangements obtained from pooled cryptopatch aggregates (Table I).
The frequency of TCRGV5 exons with in-frame joints in cryptopatch cells and the presence of TCR ␥␦⫹ cells in cryptopatch
aggregates suggested that the development or expansion of cells in
cryptopatch aggregates was dependent on functional surface ␥␦
TCR. To test this hypothesis, we examined the frequency of inframe TCRGV5 joints in cryptopatch aggregates isolated from
mice unable to express TCR ␦ protein and therefore defective in
the expression of a functional ␥␦ TCR (35). We confirmed that
whereas cryptopatch aggregates were indeed present in TCR ␦⫺/⫺
mice (24) and contain CD3⫹ TCR␤⫹ cells (Fig. 5, G–I), the frequency of in-frame joints was reduced to 35% in TCR ␦⫺/⫺ mice,
when compared with 53% in wild-type mice (Table I). Therefore,
the ability to express a cell surface ␥␦ TCR correlates with the
accumulation of in-frame TCRVG5 gene segments in cryptopatch
aggregates. By contrast, the frequency of in-frame TCRGV5 genes
in cryptopatch aggregates isolated from athymic nude mice was
Table II. Comparison of the percentage of TCRGV5 genes with
in-frame V to J joints isolated from individual cryptopatch aggregates
along the small intestinea
Relative
Region
I
II
III
Average
a
Cryptopatch
Number
1
2
3
4
5
6
7
8
9
10
11
Percentage of
Junctions InFrameb (%)
n
20
80
81
73
61
62
45
60
43
50
86
60
15
15
16
15
18
13
11
16
14
12
17
162
DNA was extracted from 11 individual cryptopatch aggregates isolated from the
proximal (I), middle (II), and distal (III) segments of the small intestine.
b
The percentage of in-frame exons was determined by generating the predicted
amino acid sequence from DNA sequences across the TCRGV-J region as noted in
Table I, where n is the number of sequences analyzed.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Selection of in-frame TCRGV5 exons in cryptopatch aggregates
is independent of the thymus but requires a functional ␥␦ TCR
nearly 60%, indicating that the accumulation of in-frame V to J
joints in cryptopatch aggregates was not dependent on the thymus.
Although a high frequency of in-frame TCRGV5 exons may imply
that T cells are actively dividing (clonally expanding) in cryptopatch aggregates, BrdU labeling indicated that few cells in cryptopatch aggregates were proliferating and that there was no significant difference in the degree of proliferation between
cryptopatch aggregates in the proximal, middle, and distal regions
of the small intestine (Fig. 6). By contrast, BrdU incorporation was
abundant in intestinal epithelial cells along the length of the gut
and in the thymus (data not shown), whereas little BrdU was detected in the muscularis layer of the intestine or in PBS-injected
mice in any location (data not shown). Dual labeling of cryptopatch cells for BrdU incorporation and CD3␧ expression indicated
that nearly 20% of cryptopatch T cells had proliferated during the
72 h of BrdU treatment (Fig. 7). Notably, CD69 staining was abundant in cryptopatch aggregates, although only a subset of T cells
expressed this activation marker (Fig. 5, D–F). Expression of
CD69 did not require expression of a surface ␥␦ receptor, because
a similar density of CD69⫹ T cells were present in the cryptopatch
aggregates of TCR␦⫺/⫺ mice (Fig. 5, J–L). Taken together, these
data indicate that a subset of cryptopatch T cells are activated, but
that the majority of cryptopatch T cells are not proliferating under
steady-state conditions.
6538
CRYPTOPATCH AGGREGATES AND ␥␦ T CELLS
TCRGV5 CDR3 DNA sequences are shared between TCR ␥␦⫹
IEL and cryptopatch cells
If ␥␦⫹ T cells in cryptopatch aggregates are lineally related to TCR
␥␦⫹ IEL, then CDR3 sequences of rearranged TCRGV5 gene segments would be shared between these populations. Three of 14
different amino acid sequences (21% of the repertoire) predicted
from DNA sequences across the CDR3 of TCRGV5 exons isolated
from cryptopatch cells were identical with those isolated from
TCR ␥␦⫹ IEL. In fact, these isolates accounted for 71% (90 of
126) of all in-frame TCRGV5 exons isolated from cryptopatch
FIGURE 7. Few T cells are proliferating in cryptopatch aggregates. Proliferating T cells in cryptopatch
aggregates (A) were identified after staining frozen
sections prepared from mice injected with BrdU after
staining with mAb BrdU FITC (a) and CD3␧ PE (b).
An overlay of single-color images counterstained
with DAPI is shown in c. Examples of CD3⫹ T cells
in cryptopatch aggregates that costained with BrdU
are indicated by arrows. B, Quantitative analysis of
proliferating T cells in cryptopatch aggregates. The
number of BrdU⫹, CD3␧⫹ cells expressed as a proportion of the total number of CD3␧⫹ cells per individual cryptopatch aggregate are shown for the proximal, middle, and distal small intestine. The data are
representative of images obtained from the analysis of
multiple cryptopatch aggregates from three individual
mice. Original magnification, ⫻320.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 6. The number of proliferating cells in
cryptopatch aggregates does not vary along the length of
the intestine. The small intestine was harvested from
mice injected with BrdU. The degree of BrdU incorporation in cryptopatch aggregates (A) in the proximal (top
panel), middle (middle panel), and distal (lower panel)
portion of the small intestine was determined from an
overlay of single-color fluorescence images (right
panel) after staining with mAb BrdU FITC (left panel)
and counterstaining with DAPI (middle panel). Few
BrdU⫹ cells are present in cryptopatch aggregates as
compared with extensive BrdU⫹ staining of intestinal
epithelial cells. B, Quantitative analysis of proliferating
cells in cryptopatch aggregates. The number of BrdU⫹
cells per individual cryptopatch aggregate corrected for
the surface area of each aggregate was determined as
described in Materials and Methods. The graphs show
the number of proliferating cells per 1000 ␮m2 of cryptopatch aggregate in the proximal, middle, and distal
third of the small intestine. ⴱ, p ⫽ NS when the proximal, middle, and distal regions were compared with
each other using the Student’s two-tailed t test. The data
are representative of images obtained from the analysis
of multiple cryptopatches from intestines derived from 3
to 5 individual mice. Original magnification, ⫻320.
The Journal of Immunology
6539
Table III. Alignment of predicted amino acid sequences encoded by CDR3 of TCRGV5 exons isolated from IEL and cryptopatch cellsa
V
Germline VG5
N
CASWA
J
SSGF
b
Overall percentage in-frame
⫹
TCR ␥␦ IEL
29/37 ⫽ 78%
V
N
J
No. of isolates
CASWA
CASWA
CASWA
CASWA
CASWA
CASWA
CASWA
CASWA
CASWA
CASWA
CASW
VY
GR
GGG
GW
IY
GY
R
SSGF
SSCF
SSGF
SSGF
SSGF
SSGF
SSGF
SSGF
SSGF
SSGF
SSGF
(3)
(2)
(1)
(2)
(1)
(8)
(1)
(1)
(1)
(1)
(8)
c
GH
Y
D
V
CASWA
CASW
CASWA
CASW
CASWA
CASWA
CASWA
CASWA
CASWA
CASWA
CASWA
CASWA
CASW
CASWA
N
VY
D
VYN
GSL
G
GY
GRY
AY
EY
ASG
VGRGP
GG
N
DG
J
No. of isolates
SSGF
SSGF
SGF
GF
SGF
SSGF
SGF
F
SSGF
SGF
GF
SGF
SSGF
SSGF
(27)
(61)
(1)
(3)
(1)
(2)
(1)
(1)
(1)
(14)
(5)
(6)
(2)
(1)
Comparison of the predicted amino acid sequences of in-frame TCRGV5-J joints isolated from TCR ␥␦⫹ IEL and cryptopatch aggregates.
Data were derived from exons isolated from IEL and cryptopatch aggregates listed in Table I and Table II withc overall percentage of in-frame exons shown for each
population.
c
Bold type denotes sequences that were present in TCR ␥␦⫹ IEL and cryptopatch cells.
a
b
cells and 66% (19 of 29) of sequences isolated from TCR ␥␦⫹ IEL
(Table III). DNA sequences across the CDR3 were identified between cryptopatch cells and TCR ␥␦⫹ IEL, supporting a clonal
relationship (Fig. 8). Isolates from TCR ␥␦⫹ IEL also included
CDR3 DNA sequences that were not present in cryptopatch aggregates. TCRGV5 exons isolated from IEL and cryptopatch cells
had N region additions, although V region deletions were uncommon (Table III, Fig. 8, and data not shown). J-segment nucleotide
removal was, however, more common in cryptopatch cells (8 of 14
exons), but not in exons isolated from TCR ␥␦⫹ IEL. Taken together, these data support that T cells in cryptopatch aggregates are
clonally related to a subset of TCR ␥␦⫹ IEL. Furthermore, sequence identity at the protein level with variability in the DNA
sequences may indicate that multiple clones sharing common antigenic pressure contribute to the TCR repertoire of IEL.
Discussion
The initial studies of cryptopatch aggregates supported their role as
primary lymphoid organs in the development of IEL (24, 29, 30).
More recent work has cast doubt on whether cryptopatch aggre-
gates function as primary lymphoid organs or are even required for
IEL development (32, 34, 41, 42). Despite this result, numerous
kinetic and ontogenic studies have linked the formation of cryptopatch aggregates with the later appearance of TCR⫹ IEL (24,
27–29), although a lineage relationship between T cells in cryptopatch aggregates and IEL has not been documented. Our data for
the first time establish a clonal relationship between cryptopatch T
cells and TCR ␥␦⫹ IEL. Furthermore, our data support the notion
that cryptopatch aggregates are quiescent lymphoid aggregates that
lack molecular evidence of primary lymphoid function in
adult mice.
We propose that cryptopatch aggregates are storage sites for T
cell progenitors of TCR ␥␦⫹ IEL. Consistent with this, TCRGV5
gene rearrangements segregated with CD3⫹ cryptopatch cells, but
not with cryptopatch cells lacking CD3 expression. Although
CD69 was expressed by a subset of cryptopatch T cells, the majority of T cells in cryptopatch aggregates were not dividing. We
could not determine whether T cells move between cryptopatch
aggregates and the epithelium or whether this movement is directional. The exchange of T cells between cryptopatch aggregates in
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
126/221 ⫽ 57%
Overall percentage in-frame
Cryptopatch
Germline JG
6540
CRYPTOPATCH AGGREGATES AND ␥␦ T CELLS
the intestine of a host mouse implanted with an intestinal graft was
found to be low (34), consistent with low levels of T cell exchange
into cryptopatch aggregates under steady-state conditions. T cell
proliferation in cryptopatch aggregates may be restricted in the
absence of high turnover in the IEL compartment. Perhaps
proliferation of cryptopatch T cells coincides with the burst of IEL
colonization evident during postnatal maturation (41) or in response to
Salmonella sp. infection where TCR ␥␦⫹ IEL expand (43).
Cryptopatch T cells expressing a surface ␥␦ TCR likely account
for the predominance of in-frame TCRGV5 rearrangements detected in cryptopatch aggregates. Whether TCR ␣␤⫹ IEL expressing CD8␣␣ contribute to the small increase in the frequency of
in-frame TCRGV5 rearrangements in TCR ␣␤⫹ IEL (compared
with TCR ␣␤⫹ splenocytes) is under investigation. Other cell subsets that have rearranged, have been selected, but have down-regulated surface TCR ␥␦ expression could also account for the
accumulation of in-frame TCRGV5 exons. Late-stage, triple-negative thymocytes are one source of cells that colonize cryptopatch
aggregates, may serve as long-lived progenitors of IEL, and included cells that gave rise to TCRGV5⫹ IEL (44). The accumulation of TCRGV5 rearrangements in thymocytes just before expression of CD4 and CD8 is consistent with this possibility (45). The
density of late-stage thymocyte precursors may, in addition, explain the variable detection of RAG gene expression documented
in prior studies (24, 29, 30). It is possible that a bona fide primary
lymphoid function for cryptopatch aggregates is present in early
ontogeny and would establish long-lived precursors of IEL. However, the absence of RAG gene expression in adult mice indicates
that this activity, if initially present, is extinguished by adult life.
The majority of TCRGV5 exons in cryptopatch aggregates of
TCR ␦⫺/⫺ mice were not in-frame (abortive), suggesting that expression of a surface ␥␦ TCR accounted for positive selection or
expansion of ␥␦ T cells in cryptopatch aggregates. It is likely that
the TCR ␤⫹ cells present in cryptopatch aggregates of TCR ␦⫺/⫺
mice account for cells with out-of-frame (abortive) TCRGV5 gene
rearrangements. The TCR ␤⫹ subset may additionally contribute
to CD3⫹ cryptopatch cells with out-of-frame rearrangements in
wild-type mice. In-frame rearrangements were high in TCR ␥␦⫹
IEL, but not 100%, presumably because ␥␦⫹ T cells using other
TCRVG genes were present in IEL. TCRGV5 exons in cryptopatch
aggregates with the same predicted amino acid sequence were
more likely to be encoded by the same DNA sequence. By contrast, TCR ␥␦⫹ IEL with the same predicted amino acid sequence
were encoded by a greater variety of DNA sequences. Of note, the
most commonly isolated TCRGV5 exons in our study were encoded by identical DNA sequences to a subset of TCRGV5 exons
previously published (8, 16). The diversity of TCRGV5 rearrangements isolated from cryptopatch aggregates was more restricted
than TCR ␥␦⫹ IEL, which encompassed a greater TCR V␥5 repertoire. Because we did not sample every cryptopatch aggregate in
the intestine, we may have examined only a limited portion of the
potential cryptopatch T cell repertoire when compared with IEL
pooled from the entire small intestine. More likely, the increased
diversity in the IEL TCR repertoire suggests ␥␦⫹ IEL derive from
multiple sources. By contrast, pauci-clonal selection or expansion
of T cells may explain the comparatively limited TCR diversity
among cryptopatch aggregates. The robust population of CD11c⫹
dendritic cells in cryptopatch aggregates could support Ag-driven
selection or expansion of these few clones (25, 29). The overlap in
predicted amino acid sequences between TCRGV5 exons isolated
from cryptopatch aggregates and TCR ␥␦⫹ IEL supports the notion of a shared antigenic pressure. The apparent independence of
IEL on the formation of cryptopatch aggregates would also support
that IEL derive from noncryptopatch pathways (34).
The enrichment of in-frame TCRGV5 exons is similar between
wild-type mice and athymic nude mice, demonstrating that the
development of cryptopatch T cells does not a priori depend on the
thymus. The reduced number of TCR ␥␦⫹ IEL in athymic nude
mice suggests that extrathymic pathways of IEL development, including a cryptopatch pathway, are alone inefficient in directing T
cells to the epithelium, in generating T cell precursors of IEL, or
that the expansion of TCR ␥␦⫹ cells requires conventional TCR
␣␤⫹ cells in trans (31, 46, 47). Whether cryptopatch aggregates in
athymic nude mice have or retain a primary lymphoid function
when compared with euthymic mice is currently under
investigation.
Cryptopatch T cells may uniquely impact the repertoire and
function of IEL. If subsets of atypical IEL arise from cryptopatch
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 8. DNA sequences across V-J joints are overlapping in TCR ␥␦⫹ IEL and cryptopatch cells. CDR3 DNA sequences encoding the same
predicted amino acid sequences isolated from TCR ␥␦⫹ IEL and cryptopatch cells were aligned across the TCR V and J region. N region nucleotides were
determined by comparison with the genomic sequence, and the predicted amino acid sequences across the CDR3 are noted. Differences in DNA nucleotide
usage are highlighted by red shading of the base pair. The title of previously published sequences is shown in italics. The number of individual isolates
for each predicted amino acid sequence is noted. Data are derived from a subset of that shown in Table III.
The Journal of Immunology
T cell precursors, or aspects of their differentiation are dependent
on cryptopatch aggregates, certain functional perturbations may be
evident in mice lacking cryptopatch aggregates. The dramatic increase in the number of IEL in mice deficient in lymphotoxin signaling (which lack cryptopatch aggregates) when compared with
IEL in wild-type mice (34) may be one indication. By contrast, in
a model of ileitis (48), defects in the formation of cryptopatch
aggregates were associated with a reduction in TCR ␥␦⫹ IEL and
the subsequent development of inflammatory bowel disease (49).
Insight into the role of cryptopatch T cells will derive from identifying cryptopatch-associated defects in IEL homeostasis. The relationship or interdependence between cryptopatch aggregates and
ILF, and their relative contribution to immune responses in the
intestine needs to be explored (33). The contribution of cryptopatch T cells to the repertoire of TCR ␥␦⫹ IEL is a question central
to immune homeostasis in the intestine.
Acknowledgments
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Disclosures
The authors have no financial conflict of interest.
References
1. Havran, W. L., and J. P. Allison. 1988. Developmentally ordered appearance of
thymocytes expressing different T-cell antigen receptors. Nature 335: 443– 445.
2. Garman, R. D., P. J. Doherty, and D. H. Raulet. 1986. Diversity, rearrangement,
and expression of murine T cell ␥ genes. Cell 45: 733–742.
3. Bonneville, M., C. A. Janeway, Jr., K. Ito, W. Haser, I. Ishida, N. Nakanishi, and
S. Tonegawa. 1988. Intestinal intraepithelial lymphocytes are a distinct set of ␥␦
T cells. Nature 336: 479 – 481.
4. Farr, A., S. Hosier, A. Nelson, S. Itohara, and S. Tonegawa. 1990. Distribution
of thymocytes expressing ␥␦ receptors in the murine thymus during development.
J. Immunol. 144: 492– 498.
5. Itohara, S., A. G. Farr, J. J. Lafaille, M. Bonneville, Y. Takagaki, W. Haas, and
S. Tonegawa. 1990. Homing of a ␥␦ thymocyte subset with homogeneous T-cell
receptors to mucosal epithelia. Nature 343: 754 –757.
6. Goodman, T., and L. Lefrancois. 1988. Expression of the ␥␦ T-cell receptor on
intestinal CD8⫹ intraepithelial lymphocytes. Nature 333: 855– 858.
7. Goodman, T., and L. Lefrancois. 1989. Intraepithelial lymphocytes: anatomical
site, not T cell receptor form, dictates phenotype and function. J. Exp. Med. 170:
1569 –1581.
8. Asarnow, D. M., T. Goodman, L. LeFrancois, and J. P. Allison. 1989. Distinct
antigen receptor repertoires of two classes of murine epithelium-associated T
cells. Nature 341: 60 – 62.
9. Allison, J. P., and D. H. Raulet. 1990. The immunobiology of ␥␦⫹ T cells. Semin.
Immunol. 2: 59 – 65.
10. Xiong, N., J. E. Baker, C. Kang, and D. H. Raulet. 2004. The genomic arrangement of T cell receptor variable genes is a determinant of the developmental
rearrangement pattern. Proc. Natl. Acad. Sci. USA 101: 260 –265.
11. Bonneville, M., S. Itohara, E. G. Krecko, P. Mombaerts, I. Ishida, M. Katsuki,
A. Berns, A. G. Farr, C. A. Janeway, Jr., and S. Tonegawa. 1990. Transgenic
mice demonstrate that epithelial homing of ␥␦ T cells is determined by cell
lineages independent of T cell receptor specificity. J. Exp. Med. 171: 1015–1026.
12. Xiong, N., C. Kang, and D. H. Raulet. 2004. Positive selection of dendritic
epidermal ␥␦ T cell precursors in the fetal thymus determines expression of
skin-homing receptors. Immunity 21: 121–131.
13. Lin, T., H. Yoshida, G. Matsuzaki, S. R. Guehler, K. Nomoto, T. A. Barrett, and
D. R. Green. 1999. Autospecific ␥␦ thymocytes that escape negative selection
find sanctuary in the intestine. J. Clin. Invest. 104: 1297–1305.
14. Bandeira, A., S. Itohara, M. Bonneville, O. Burlen-Defranoux, T. Mota-Santos,
A. Coutinho, and S. Tonegawa. 1991. Extrathymic origin of intestinal intraepithelial lymphocytes bearing T-cell antigen receptor ␥␦. Proc. Natl. Acad. Sci.
USA 88: 43– 47.
15. De Geus, B., M. Van den Enden, C. Coolen, L. Nagelkerken, P. Van der Heijden,
and J. Rozing. 1990. Phenotype of intraepithelial lymphocytes in euthymic and
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
athymic mice: implications for differentiation of cells bearing a CD3-associated
␥␦ T cell receptor. Eur. J. Immunol. 20: 291–298.
Whetsell, M., R. L. Mosley, L. Whetsell, F. V. Schaefer, K. S. Miller, and
J. R. Klein. 1991. Rearrangement and junctional-site sequence analysis of T-cell
receptor ␥ genes in intestinal intraepithelial lymphocytes from murine athymic
chimeras. Mol. Cell. Biol. 11: 5902–5909.
Guy-Grand, D., M. Malassis-Seris, C. Briottet, and P. Vassalli. 1991. Cytotoxic
differentiation of mouse gut thymo-dependent and independent intraepithelial T
lymphocytes is induced locally: correlation between functional assays, presence
of perforin and granzyme transcripts and cytoplasmic granules. J. Exp. Med. 173:
1549 –1552.
Guy-Grand, D., C. Vanden Broecke, C. Briottet, M. Malassis-Seris, F. Selz, and
P. Vassalli. 1992. Different expression of the recombination activity gene RAG-1
in various populations of thymocytes, peripheral T cells and gut thymus-independent intraepithelial lymphocytes suggests two pathways of T cell receptor
rearrangement. Eur. J. Immunol. 22: 505–510.
Lin, T., G. Matsuzaki, H. Yoshida, N. Kobayashi, H. Kenai, K. Omoto, and
K. Nomoto. 1994. CD3⫺CD8⫹ intestinal intraepithelial lymphocytes (IEL) and
the extrathymic development of IEL. Eur. J. Immunol. 24: 1080 –1087.
Page, S. T., L. Y. Bogatzki, J. A. Hamerman, C. H. Sweenie, P. J. Hogarth,
M. Malissen, R. M. Perlmutter, and A. M. Pullen. 1998. Intestinal intraepithelial
lymphocytes include precursors committed to the T cell receptor ␣␤ lineage.
Proc. Natl. Acad. Sci. USA 95: 9459 –9464.
Hamad, M., M. Whetsell, J. Wang, and J. R. Klein. 1997. T cell progenitors in the
murine small intestine. Dev. Comp. Immunol. 21: 435– 442.
Lefrancois, L., and L. Puddington. 1995. Extrathymic intestinal T-cell development: virtual reality? Immunol. Today 16: 16 –21.
Kisielow, P., and H. von Boehmer. 1995. Development and selection of T cells:
facts and puzzles. Adv. Immunol. 58: 87–209.
Kanamori, Y., K. Ishimaru, M. Nanno, K. Maki, K. Ikuta, H. Nariuchi, and
H. Ishikawa. 1996. Identification of novel lymphoid tissues in murine intestinal
mucosa where clusters of c-kit⫹ IL-7R⫹ Thy1⫹ lympho-hemopoietic progenitors
develop. J. Exp. Med. 184: 1449 –1459.
Onai, N., M. Kitabatake, Y. Y. Zhang, H. Ishikawa, S. Ishikawa, and
K. Matsushima. 2002. Pivotal role of CCL25 (TECK)-CCR9 in the formation of
gut cryptopatches and consequent appearance of intestinal intraepithelial T lymphocytes. Int. Immunol. 14: 687– 694.
Saito, H., Y. Kanamori, T. Takemori, H. Nariuchi, E. Kubota,
H. Takahashi-Iwanaga, T. Iwanaga, and H. Ishikawa. 1998. Generation of intestinal T cells from progenitors residing in gut cryptopatches. Science 280:
275–278.
Ishikawa, H., H. Saito, K. Suzuki, T. Oida, and Y. Kanamori. 1999. New gut
associated lymphoid tissue “cryptopatches” breed murine intestinal intraepithelial
T cell precursors. Immunol. Res. 20: 243–250.
Kuo, S., A. El Guindy, C. M. Panwala, P. M. Hagan, and V. Camerini. 2001.
Differential appearance of T cell subsets in the large and small intestine of neonatal mice. Pediatr. Res. 49: 543–551.
Suzuki, K., T. Oida, H. Hamada, O. Hitotsumatsu, M. Watanabe, T. Hibi,
H. Yamamoto, E. Kubota, S. Kaminogawa, and H. Ishikawa. 2000. Gut cryptopatches: direct evidence of extrathymic anatomical sites for intestinal T lymphopoiesis. Immunity 13: 691–702.
Oida, T., K. Suzuki, M. Nanno, Y. Kanamori, H. Saito, E. Kubota, S. Kato,
M. Itoh, S. Kaminogawa, and H. Ishikawa. 2000. Role of gut cryptopatches in
early extrathymic maturation of intestinal intraepithelial T cells. J. Immunol. 164:
3616 –3626.
Guy-Grand, D., O. Azogui, S. Celli, S. Darche, M. C. Nussenzweig, P. Kourilsky,
and P. Vassalli. 2003. Extrathymic T cell lymphopoiesis: ontogeny and contribution to gut intraepithelial lymphocytes in athymic and euthymic mice. J. Exp.
Med. 197: 333–341.
Lambolez, F., O. Azogui, A. M. Joret, C. Garcia, H. von Boehmer, J. Di Santo,
S. Ezine, and B. Rocha. 2002. Characterization of T cell differentiation in the
murine gut. J. Exp. Med. 195: 437– 449.
Taylor, R. T., A Lugering, K. A. Newell, and I. R. Williams. 2004. Intestinal
cryptopatch formation in mice requires lymphotoxin ␣ and the lymphotoxin ␤
receptor. J. Immunol. 173: 7183–7189.
Pabst, O., H. Herbrand, T. Worbs, M. Friedrichsen, S. Yan, M. W. Hoffmann,
H. Korner, G. Bernhardt, R. Pabst, and R. Forster. 2005. Cryptopatches and
isolated lymphoid follicles: dynamic lymphoid tissues dispensable for the generation of intraepithelial lymphocytes. Eur. J. Immunol. 35: 98 –107.
Itohara, S., P. Mombaerts, J. Lafaille, J. Iacomini, A. Nelson, A. R. Clarke,
M. L. Hooper, A. Farr, and S. Tonegawa. 1993. T cell receptor ␦ gene mutant
mice: independent generation of ␣␤ T cells and programmed rearrangements of
␥␦ TCR genes. Cell 72: 337–348.
Camerini, V., C. Panwala, and M. Kronenberg. 1993. Regional specialization of
the mucosal immune system. Intraepithelial lymphocytes of the large intestine
have a different phenotype and function than those of the small intestine. J. Immunol. 151: 1765–1776.
Oosterwegel, M. A., M. C. Haks, U. Jeffry, R. Murray, and A. M. Kruisbeek.
1997. Induction of TCR gene rearrangements in uncommitted stem cells by a
subset of IL-7 producing, MHC class-II-expressing thymic stromal cells. Immunity 6: 351–360.
Wong, M. H., J. R. Saam, T. S. Stappenbeck, C. H. Rexer, and J. I. Gordon. 2000.
Genetic mosaic analysis based on Cre recombinase and navigated laser capture
microdissection. Proc. Natl. Acad. Sci. USA 97: 12601–12606.
Robine, S., F. Jaisser, and D. Louvard. 1997. Epithelial cell growth and differ-
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
We thank Drs. Mitchell Kronenberg and David Camerini for critical reading of the manuscript, Dr. Sheree Kuo and Samar Yageneh (University of
Virginia, Charlottesville, VA) for technical assistance with LMD, and
Hyojin Han (University of Virginia) and Ida Theodor (FACS Core Facility,
Center for Immunology, University of California, Irvine, CA) for technical
assistance.
6541
6542
40.
41.
42.
43.
44.
entiation. IV. Controlled spatiotemporal expression of transgenes: new tools to
study normal and pathological states. Am. J. Physiol. 273: G759 –G762.
Mallick, C. A., E. C. Dudley, J. L. Viney, M. J. Owen, and A. C. Hayday. 1993.
Rearrangement and diversity of T cell receptor ␤ chain genes in thymocytes: a
critical role for the ␤ chain in development. Cell 73: 513–519.
Eberl, G., and D. R. Littman. 2004. Thymic origin of intestinal ␣␤ T cells revealed by fate mapping of ROR␥⫹ cells. Science 305: 248 –251.
Nonaka, S., T. Naito, H. Chen, M. Yamamoto, K. Moro, H. Kiyono, H. Hamada,
and H. Ishikawa. 2005. Intestinal ␥␦ T cells develop in mice lacking thymus, all
lymph nodes, Peyer’s patches, and isolated lymphoid follicles. J. Immunol. 174:
1906 –1912.
Mixter, P. F., V. Camerini, B. J. Stone, V. L. Miller, and M. Kronenberg. 1994.
Mouse T lymphocytes that express a ␥␦ T cell antigen receptor contribute to
resistance to Salmonella infection in vivo. Infect. Immun. 62: 4618 – 4621.
Lambolez, F., M. L. Arcangeli, A. M. Joret, V. Pasqualetto, C. Cordier,
J. P. Santo, B. Rocha, and S. Ezine. 2006. The thymus exports long-lived fully
committed T cell precursors that can colonize primary lymphoid organs. Nat.
Immunol. 7: 76 – 82
CRYPTOPATCH AGGREGATES AND ␥␦ T CELLS
45. Petrie, H. T., R. Scollay, and K. Shortman. 1992. Commitment to the T cell
receptor-␣ ␤ or -␥ ␦ lineages can occur just prior to the onset of CD4 and CD8
expression among immature thymocytes. Eur. J. Immunol. 22: 2185–2188.
46. Pennington, D. J., B. Silva-Santos, J. Shires, E. Theodoridis, C. Pollitt,
E. L. Wise, R. E. Tigelaar, M. J. Owen, and A. C. Hayday. 2003. The interrelatedness and interdependence of mouse T cell receptor ␥␦⫹ and ␣␤⫹ cells.
Nat. Immunol. 4: 991–998.
47. Silva-Santos, B., D. J. Pennington, and A. C. Hayday. 2004. Lymphotoxin-mediated regulation of ␥␦ cell differentiation by ␣␤ T cell progenitors. Science 311:
925–928.
48. Kosiewicz, M. M., C. C. Nast, A. Krishnan, J. Rivera-Nieves, C. A. Moskaluk,
S. Matsumoto, K. Kozaiwa, and F. Cominelli. 2001. Th1-type responses mediate
spontaneous ileitis in a novel murine model of Crohn’s disease. J. Clin. Invest.
107: 695–702.
49. Makita, S., T. Kanai, S. Matsumoto, R. Iiyama, K. Uraushihara, T. Totsuka,
M. Yamazaki, T. Nakamura, H. Ishikawa, and M. Watanabe. 2003. The role of
cryptopatch-derived intraepithelial lymphocytes in the development of chronic
ileocecitis. Scand. J. Immunol. 58: 428 – 435.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017