Download DNA/RNA Chapter Review

DNA/RNA Chapter Review
Answer All Questions On A Separate Sheet Of Paper!
Due Day of Test, Or On Review Day For Extra Credit!
1. Who was Frederick Griffith? Describe his experiment.
Chapter Notes:
2. What is transformation?
- The Information Within Us
3. Who was Oswald Avery? Describe his experiment.
- DNA Replication and RNA
4. What did Hershey & Chase study?
- RNA Translation
5. What is a bacteriophage?
- Mutation
6. What is a nucleotide?
7. What are the 3 parts of a nucleotide in DNA?
8. Nitrogen Bases can be separated into what TWO categories?
9. What are the four nitrogen bases in a DNA nucleotide? Which bases match together?
10. Who was Rosalind Franklin? Why was she so important?
11. Who were Watson and Crick? What are they famous for?
12. What is the official shape of DNA?
13. What holds together the two strands of DNA?
14. The process in which your DNA copies itself is known as what?
15. The 2nd strand of matching DNA is known as what?
16. Explain how DNA copies itself.
17. What chemical helps to proofread the DNA after it is copied?
18. The sequence of letters found on DNA is a code to help make specific what?
19. What does RNA stand for?
20. What are three differences between DNA and RNA?
21. When matching DNA to RNA, give the following pairs…
a. DNA = A,T,G,C
/
RNA = ?, ?,?,?
22. What are the three types of RNA?
23. Which type of RNA reads the DNA and delivers the message to the ribosome?
24. Which type of RNA takes the message and helps to assemble the parts?
25. Which type of RNA delivers the amino acids and assembles them in the right order?
26. The process of RNA reading the DNA is known as what?
a. Explain how this process works.
27. What is the “garbage” language of DNA known as? What about the good language?
28. Every three letters on RNA is known as a what?
29. What three letters make up the start codon? What are the stop codons?
30. The process of decoding RNA into amino acids is known as what?
31. Using your decoding chart, translate the following…
a. AGAUAUGAGGACUGGUAGGAAAACGCAG
b. GAGUAUGGGUCCUUGGUGAGGUCGC
32. The change in the structure or amount of genetic material is known as what?
33. An individual born with an abnormal trait is known as what?
34. What are the two types of mutations?
35. What can cause a mutation?
36. Name and explain the following mutations…
a.
b.
c.
d.
37. Explain what a point mutation is. Give an example.
38. Explain what a frameshift mutation is. Give an example.
39. Which of the previous two mutations are worse? Explain why.
40. What is the human genome project and what benefits could possibly occur from the results?