Download Complete nucleotide sequence of Colorado tick fever virus

Journal
of General Virology (1997), 78, 2895–2899. Printed in Great Britain
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .SHORT
.
COMMUNICATION
Complete nucleotide sequence of Colorado tick fever virus
segments M6, S1 and S2
Houssam Attoui, Philippe De Micco and Xavier de Lamballerie
Laboratoire de Virologie Mole! culaire, Tropicale et Transfusionnelle, Faculte! de Me! decine de Marseille, Universite! de la Me! diterrane! e,
27 Boulevard Jean Moulin, 13385 Marseille Cedex 5, France
The nucleotide sequences of the tenth (M6),
eleventh (S1) and twelfth (S2) dsRNA genomic
segments of the Florio strain (N-7180) of Colorado
tick fever virus were determined and found to be
675, 998 and 1884 bp, respectively, in length. A
nonanucleotide motif and a hexanucleotide motif
were found to be highly conserved in the 5« and 3«
non-coding regions (NCRs), respectively, of the
three segments. The first and last three nucleotides
of each segment were of inverted complementarity,
and segment-specific inverted terminal repeats
were detected in the NCRs of the three segments.
These findings suggest the occurrence of intracellular panhandle structures for the RNA transcripts. A readthrough phenomenon is suspected in
segment M6. The environment surrounding the
opal codon (position 1052–1054) of segment M6
conforms to that of leaky opal codons described in
the literature.
Viruses classified as members of the family Reoviridae have
been isolated from a wide range of hosts including vertebrates,
invertebrates and plants (Joklik, 1983). All of them exhibit a
multisegmented double-stranded (ds) RNA genomic pattern.
Phylogenetic studies based on sequence analysis of RNA
polymerases suggest that these viruses have a polyphyletic
origin (Koonin, 1992). They are classified into nine genera
(Murphy et al., 1995) namely Aquareovirus, Coltivirus, Cypovirus, Fijivirus, Orbivirus, Orthoreovirus, Oryzavirus, Phytoreovirus and Rotavirus. Genus Coltivirus, the type species of which
is Colorado tick fever (CTF) virus, encompasses those viruses
isolated from humans, animals and insects exhibiting a 12
dsRNA segmented genomic pattern. CTF virus was characterized by L. Florio and co-workers 50 years ago as being the
Author for correspondence : Xavier de Lamballerie.
Fax ­33 4 91 18 95 98. e-mail virophdm!lac.gulliver.fr
The GenBank accession numbers of the sequences reported in this
paper are : U53227, U72694 and AF000720.
aetiological agent of a severe tick-borne disease, CTF, which is
usually self-limiting and appears following the bite of the
infected adult Rocky Mountain wood tick, Dermacentor
andersoni (Florio et al., 1946, 1950).
Antigenic variants of CTF virus have been reported
(Karabatsos et al., 1987). Other members of the genus include
Eyach virus, two Eyach antigenic variants (Ar}T577 and
Ar}T578), and other probable members isolated in Indonesia
and China (Murphy et al., 1995). The 12 dsRNA segments of
CTF virus have been arranged into three classes, the L1–4
(long) class, the M1–6 (medium) class and the S1–2 (short)
class. The total genome comprises approximately 28 000
nucleotides (Brown et al., 1993). In this paper we report the
sequence and genetic organization of the M6, S1 and S2
genomic segments of CTF virus.
The Florio strain (N-7180) of CTF virus was purchased
from the ATCC. BHK-21 cells were grown in suspension in SEagle’s minimum essential medium (S-EMEM) with 10 % foetal
bovine serum (FBS), 100 IU}ml penicillin G, 100 µg}ml
kanamycin and 100 µg}ml streptomycin at 37 °C under 5 %
CO . Virus infectivity was titrated as described previously
#
(Deig & Watkins, 1964) and recorded as p.f.u.}ml.
Cells adjusted to 10' cells}ml were infected with CTF virus
(10 p.f.u. per cell) and incubated until gross cytopathic effect
was detected (5 days p.i.). Infected cells were allowed to settle
overnight at 4 °C, centrifuged at 800 g and treated with Freon
113 as described elsewhere (McCrae, 1985). The virus was
purified on a discontinuous sucrose gradient consisting of onethird 66 % (w}w) sucrose and two-thirds 40 % (w}v) sucrose in
0±2 M Tris–HCl pH 7±8 (Mertens et al., 1987) and centrifuged
using an SW40 rotor at 27 000 r.p.m. at 4 °C for 2 h. The viral
band was recovered, diluted in 0±2 M Tris–HCl buffer pH 7±8,
recentrifuged at 100 000 g to remove the sucrose, and
resuspended in EMEM.
DsRNA was extracted from infected cells and purified virus
using a guanidinium thiocyanate-derived procedure (RNA
NOW, Biogentex). Extracted RNA from infected cells was
precipitated overnight in 2 M LiCl at 4 °C and centrifuged at
18 000 g for 5 min in order to precipitate high molecular mass
RNA transcripts (Ramig et al., 1977). The supernatant was
precipitated at ®20 ° for 2 h with 1±5 vol. isopropanol and
0±5 vol. 7±5 M ammonium acetate, washed with 70 % ethanol
0001-4944 # 1997 SGM
CIJF
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 07:19:49
H. Attoui, P. De Micco and X. de Lamballerie
(a)
(b)
(c)
Fig. 1. Northern blot hybridization of CTF virus genome using DIG-labelled PCR probes derived from segments M6, S1 and S2
and PCR amplification of full-length segments. (a) Electrophoretic separation of CTF dsRNAs (V) on a 1±5 % agarose gel,
stained with ethidium bromide. Size markers (M) are indicated in nucleotides. (b) Chemiluminescence detection of
hybridization products after the RNA in (a) was transferred to a nylon membrane. Lanes M and V show DIG-labelled molecular
mass marker (labelled in bp ; prepared from pBR328 plasmid cleaved with BglI­pBR328 cleaved with HinfI), and complete
CTF virus genome, respectively. Hybridization signals were detected only with M6, S1 and S2 segments. (c) Amplification of
CTF virus dsRNA segment S2, S1 and M6 templates using specific primer sets S2COMPS/S2COMPA, S1COMPS/S1COMPA
and M6COMPS/M6COMPA. Lane M shows size marker. Lanes 1, 2 and 3, respectively, show full-length segments S2, S1 and
M6.
and vacuum dried. The RNA was further purified by treatment
with RNase-free DNase I, (Boehringer Mannheim). DsRNA
segments were fractionated by electrophoresis on a 10 %
acrylamide slab gel (Laemmli, 1970). RNA bands were excised
and recovered from the acrylamide by shaking overnight in
2 ml TNE buffer. The RNA was precipitated by adding 10 vols
butanol and recovered using an RNaid kit (BIO 101).
The cloning process of viral segments was based on the
single primer amplification method (Lambden et al., 1992) with
some modifications. The 3« ddATP blocked primer A1 (PO -5«
%
CCACGTGCCAGATGCTCTGGA-ddA 3«) (2±5 mM) was
ligated to both 3« ends of viral dsRNA (150 ng) using 10 U of
T4 RNA ligase (Boehringer Mannheim). Ligation efficiency
was monitored by chemiluminescent detection of ligated 3«DIG-11-ddUTP blocked oligonucleotides (data not shown).
The ligation product was gel purified and cDNA was
synthesized using RNase H− reverse transcriptase. dsRNA was
denatured at 99 °C for 1 min in 15 % dimethyl sulfoxide
(DMSO). Reverse transcription was carried out at 42 °C for
1 h in a final volume of 20 µl containing 7 % DMSO, 50 mM
Tris–HCl pH 8±3, 75 mM KCl, 3 mM MgCl , 10 mM DTT,
#
0±2 mM each dNTP, 200 ng primer A1 tailed segment S2, 0±6
mM primer A2 (PO -5« GGTGCACGGTCTACGAGACCT
%
3«) complementary to primer A1, 20 U of RNase inhibitor
(Boehringer Mannheim) and 200 U of MMuLV Superscript II
(Gibco BRL) ; the reaction mixture was heated to 70 °C for
15 min, and the RNA template was digested with 1 unit of
RNase H (Boehringer Mannheim) at 37 °C for 45 min.
Full-length cDNA was amplified by PCR using 2±5 U of
Taq polymerase (Boehringer Mannheim) and 1 µM primer A2
under standard conditions. PCR products were gel purified and
ligated into pGEM-T vector (Promega). According to our
results, there was no need either for purification of the cDNA
or for annealing at 65 °C for 16 h as previously described
CIJG
(Lambden et al., 1992) to obtain full-length segments. Moreover, the repair step of the annealed partial cDNA was
achieved within the PCR reaction mixture by Taq polymerase.
These modifications resulted in a shorter and simpler protocol.
The identity of the amplified product was confirmed by
hybridization of DIG-dUTP labelled full-length PCR products
with complete CTF virus genome by Northern blot analysis
(Dyall-Smith et al., 1983). Before transfer to Hybond-N nylon
membrane (Amersham), CTF virus genomic segments were
fractionated on a 1±5 % (w}v) agarose gel which was further
treated with 50 mM NaOH for 45 min, and with 250 mM
sodium acetate pH 5±2 for 15 min. Hybridization products
were revealed by chemiluminescence using the Boehringer
Mannheim DIG detection kit (Fig. 1 a, b).
Recombinant plasmids containing full-length PCR products
were transfected into E. coli JM109. Both strands of the cloned
PCR product were sequenced with pUC}M13 forward and
reverse primers using an Amplicycle sequencing kit (Perkin
Elmer) and an LKB ALF sequencer (Pharmacia).
Analysis of the nucleotide sequences of segments S2, S1
and M6 showed them to be 675, 998 and 1884 bp long,
respectively, and sequences were deposited in the GenBank
database under accession numbers U53227 (S2 segment),
U72694 (S1 segment) and AF000720 (M6 segment).
Comparison of our sequences with those available from
nucleic acid and protein databanks was done by using the
BioSCAN (University of North Carolina, USA) and FASTA
(Stanford University, USA) software programs. Sequence
analysis of the three segments showed no significant homology
with reported Reoviridae sequences at either nucleotide or
amino acid levels. This is consistent with previous data which
indicated that significant similarities (over 20 %) between
sequences from members of the family Reoviridae exist only for
genes encoding RNA polymerases (Koonin, 1992).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 07:19:49
Colorado tick fever virus sequences
(a)
(b)
(c)
Fig. 2. Terminal sequences of (a) CTF virus segment S2, (b) segment S1
and (c) segment M6. The possible secondary structures due to segmentspecific inverted terminal repeats were generated with the help of the
MacStan software program. ‘ I ’ or ‘ ® ’ denote conventional base pairing
while ‘ : : ’ denotes non-conventional, although possible, base pairing.
In all three segments, conserved motifs were identified in
the 5« NCR (a nonanucleotide, ACATTTTGT) and in the 3«
NCR (a hexanucleotide, TGCAGT). Such conserved motifs can
be detected in many viruses possessing multisegmented
genomes. Virus- or segment-specific sequences would probably play an important role in transcription, replication and
packaging of RNA as well as in virus maturation. It has been
suggested that these motifs may act as sorting signals, bringing
a single copy of each genomic segment into the viral capsid
(Anzola et al., 1987 ; Xu et al., 1989). Moreover, the first three
nucleotides in the 5« NCRs (GAC for segments S2 and M6 and
CAC for segment S1) of each of the segments were found to
be inverted complements of the last three nucleotides in the 3«
NCRs (GTC for segments S2 and M6 and GTG for segment
S1). A number of segment-specific inverted terminal repeats
(ITRs), involving the conserved motifs, were detected. These
ITRs could interact by homologous base pairing, thus forming
secondary structures. Such possible secondary structures were
generated with the help of the MacStan software program
(Gast, 1994) and are displayed in Fig. 2.
The complementarity of sequences in the 5« and 3« NCRs
suggests that each RNA transcript could be held in a circular
form either by itself or via protein components (Anzola et al.,
1987 ; Theron & Nel, 1997). This finding has been reported
previously for viruses such as infectious bursal disease virus
(IBDV) (Mundt & Mu$ ller, 1995), wound tumour virus (Anzola
et al., 1987) and influenza virus (Hsu et al., 1987), where a
panhandle structure was described that might possibly function
as a guiding site for the virus-specific RNA-dependent RNA
polymerase.
The motif CGTTCC was found in the 5« NCR of segment
S1, and the motif CGTTCA was found twice with five
intervening nucleotides in the 5« NCR of segment M6. These
two motifs are partially complementary to the 3« end 18S
human ribosomal RNA motif GGAAGG (GenBank accession
number M10098, position 1916–1921). The significance of
such partial complementarity is unclear, but was previously
described for pestiviruses (Deng & Brock, 1993), picornaviruses
(Le et al., 1993) and IBDV (Mundt & Mu$ ller, 1995).
Analysis of the sequences of the three segments for open
reading frames (ORFs) using the DNA Strider 1.1 software
Table 1. Primers used in amplification of full-length segments
Primer name
Sequence
Segment
Map position Orientation
M6COMPS
M6COMPA
S1COMPS
S1COMPA
S2COMPS
S2COMPA
GACATTTTGTGTCACGAACGTT
GACTGCAAGGATTCCCTATATG
CACATTTTGTCTCTGTGATCCC
CACTGCATTTGTATCCAGGCC
GACATTTTGTCTCAGAACGATGC
GACTGCAATTACCCGTCCCGGGA
M6
M6
S1
S1
S2
S2
1–22
1862–1884
1–22
978–998
1–23
653–675
Sense
Antisense
Sense
Antisense
Sense
Antisense
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 07:19:49
CIJH
H. Attoui, P. De Micco and X. de Lamballerie
program (Institut de Recherche Fondamentale, CEA, France)
permitted identification of a 558 bp ORF in segment S2 and a
750 bp ORF in segment S1, encoding putative proteins of 185
and 249 amino acids, respectively. In segment M6 the analysis
revealed two possible ORFs. The first extends from base 41 to
base 1051, ending at the opal TGA stop codon, and encodes a
putative protein of 337 amino acids. A second possible ORF
(nt 41–1846) could exist if readthrough of the opal codon (nt
1052–1054), which is followed by a cytosine residue, occurs.
The corresponding putative protein would consist of 602
amino acids. Similar situations have been reported in retroviruses (Feng et al., 1990) and alphaviruses (Strauss & Strauss,
1994). Such opal codons have been shown to be leaky,
allowing a readthrough phenomenon resulting from the
incorporation of arginine, cysteine or tryptophan in place of
the opal codon (Feng et al., 1990). The suppression of this
codon was found to be directly dependent on the presence of
the flanking cytosine (Strauss & Strauss, 1994). The significance
and the probability of readthrough of this opal codon remain
unclear and require further investigation. Analysis of hydropathy profiles using the Kyte–Doolittle algorithm (Kyte &
Doolittle, 1982) revealed that the putative proteins are
hydrophilic. However, the absence of significant homologies
with other viral proteins means that assigning specific functions
to the predicted proteins requires further analysis.
Three sets of specific primers for PCR amplification of the
viral segments were selected from the determined full-length
sequences with the help of the PrimerM software program (V.
Proutski, University of Oxford, UK). These sets were used to
amplify the complete sequence of the segments on which they
are located (Table 1). Reverse transcription was performed as
described above in the presence of 1 µM of each primer using
genomic CTF virus RNA. PCR amplification was carried out
using 35 cycles of denaturation at 94 °C for 50 s, annealing at
62 °C for 50 s and extension at 72 °C for 2 min, with a final
extension step at 72 °C for 5 min. This generated full-length
amplification products. The results are displayed in Fig. 1 (c).
The molecular approach used in this study has contributed
to our understanding of the CTF virus genomic segments S2,
S1 and M6. Together with further sequencing data, these
results should reveal the structural and antigenic properties of
the virus and permit the elaboration of molecular diagnostic
and epidemiological procedures.
The authors wish to thank Drs C. Chastel and E. A. Gould who kindly
provided viral strains and cell lines, respectively, for the coltivirus studies
currently being carried out in our laboratory. This work was funded by
a grant from the A. DE. RE. M.
References
Anzola, J. V., Xu, Z., Asamizu, T. & Nuss, D. L. (1987). Segment-specific
inverted repeats found adjacent to conserved terminal sequences in
wound tumour virus genome and defective interfering RNAs. Proceedings
of the National Academy of Sciences, USA 84, 8301–8305.
CIJI
Brown, S. E., Gorman, M., Tesh, R. B. & Knudson, D. L. (1993).
Coltiviruses isolated from mosquitoes collected in Indonesia. Virology
196, 363–367.
Deig, E. F. & Watkins, H. M. S. (1964). Plaque assay procedure for
Colorado tick fever virus. Journal of Bacteriology 88, 42–47.
Deng, R. & Brock, K. V. (1993). 5« and 3« untranslated regions of
pestivirus genome : primary and secondary structure analyses. Nucleic
Acids Research 21, 1949–1957.
Dyall-Smith, M. L., Azad, A. A. & Holmes, I. H. (1983). Gene mapping
of rotavirus double-stranded RNA segments by Northern blot hybridization : application to segments 7, 8 and 9. Journal of Virology 46,
317–320.
Feng, Y. X., Copeland, T. D., Oroszlan, S., Rein, A. & Levin, G. (1990).
Identification of amino acids inserted during suppression of UAA and
UGA termination codons at the gag–pol junction of Moloney murine
leukemia virus. Proceedings of the National Academy of Sciences, USA 87,
8860–8863.
Florio, L., Stewart, M. & Mugrage, E. R. (1946). The etiology of
Colorado tick fever. Journal of Experimental Medicine 83, 1–10.
Florio, L., Miller, M. S. & Mugrage, E. R. (1950). Colorado tick fever.
Isolation of the virus from Dermacentor andersoni in nature and laboratory
study of the transmission of the virus in the tick. Journal of Immunology
64, 257–263.
Gast, F. U. (1994). A Macintosh program for the versatile generation of
random nucleic acid sequences and their structural analysis. Computer
Aplications in the Biosciences 10, 49–51.
Hsu, M. T., Parvin, J. D., Gupta, S., Krystal, M. & Palese, P. (1987).
Genomic RNA of influenza viruses are held in a circular conformation in
virions and in infected cells by a terminal panhandle. Proceedings of the
National Academy of Sciences, USA 84, 8140–8144.
Joklik, W. K. (1983). The Reoviridae. New York : Plenum Press.
Karabatsos, N., Poland, J. D., Emmons, R. W., Mathews, J. H., Calisher,
C. H. & Wolff, K. L. (1987). Antigenic variants of Colorado tick fever
virus. Journal of General Virology 68, 1463–1469.
Koonin, E. V. (1992). Evolution of double-stranded RNA viruses : a case
for polyphyletic origin from different groups of positive-stranded RNA
viruses. Seminars in Virology 3, 327–339.
Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the
hydropathic character of a protein. Journal of Molecular Biology 157,
105–132.
Laemmli, U. K. (1970). Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680–685.
Lambden, P., Cooke, S. J., Caul, E. O. & Clarke, I. N. (1992). Cloning
of noncultivable human rotavirus by single primer amplification. Journal
of Virology 66, 1817–1822.
Le, S. Y., Chen, J. H., Sonenberg, N. & Mainzel, V. J., Jr (1993).
Conserved tertiary structural elements in the 5« nontranslated region of
cardiovirus, aphthovirus and hepatitis A virus RNAs. Nucleic Acids
Research 21, 2445–2451.
McCrae, M. A. (1985). Double-stranded RNA viruses. In Virology : A
Practical Approach, pp. 151–168. Edited by B. W. J. Mahy. Oxford &
Washington : IRL Press.
Mertens, P. P. C., Burroughs, J. N. & Anderson, J. (1987). Purification
and properties of virus particles, infectious subviral particles, and cores of
bluetongue virus serotypes 1 and 4. Virology 157, 375–386.
Mundt, E. & Mu$ ller, H. (1995). Complete nucleotide sequences of 5«and 3«-noncoding regions of both genome segments of different strains
of infectious bursal disease virus. Virology 209, 10–18.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 07:19:49
Colorado tick fever virus sequences
Murphy, F. A., Fauquet, C. M., Bishop, D. H. L., Ghabrial, S. A., Jarvis,
A. W., Martelli, G. P., Mayo, M. A. & Summers, M. D. (editors) (1995).
Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of
Viruses. Vienna & New York : Springer-Verlag.
Ramig, R. F., Cross, R. K. & Fields, B. (1977). Genome RNAs and
polypeptides of reovirus serotypes 1, 2 and 3. Journal of Virology 22,
726–733.
Strauss, J. H. & Strauss, E. G. (1994). The alphaviruses : gene
expression, replication, and evolution. Microbiological Reviews 58,
491–562.
Theron, J. & Nel, L. H. (1997). Stable protein–RNA interaction involves
the terminal domains of bluetongue virus mRNA but not the terminally
conserved sequences. Virology 229, 134–142.
Xu, Z., Anzola, J. V., Nalin, C. M. & Nuss, D. L. (1989). The 3«-terminal
sequence of wound tumor virus transcripts can influence conformational
and functional properties associated with the 5« terminus. Virology 170,
511–522.
Received 13 May 1997 ; Accepted 1 July 1997
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 07:19:49
CIJJ