Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
194 Effects of Thyroid Hormone on a-Actin and Myosin Heavy Chain Gene Expression in Cardiac and Skeletal Muscles of the Rat: Measurement of mRNA Content Using Synthetic Oligonucleotide Probes THOMAS A. GUSTAFSON, BRUCE E. MARKHAM, AND EUGENE MORKIN Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 Effects of thyroid hormone on a-actin and myosin heavy chain gene expression were compared in ventricle, soleus, and extensor digitorum longus muscles of hypothyroid rats. Changes in mRNA content were analyzed using synthetic oligonucleotide probes complementary to the unique 3' untranslated regions of four striated myosin heavy chain mRNAs and cardiac and skeletal muscle a-actin mRNAs. The results indicate that daily treatment with 3,5,3'-triiodo-L-thyronine (2 /n.g/100 g body weight) increased a-myosin heavy chain mRNA content in heart muscle by 500% and decreased /3myosin heavy chain mRNA by 65% within 48 hours. /3-mRNA in extensor digitorum longus was decreased by 60% at 48 hours while in soleus, /3-mRNA levels were not affected by 9 weeks of treatment. Fast Ha mRNA was present in small amounts in hypothyroid soleus and increased by 150% and 200% after 7 and 9 weeks of thyroid hormone administration, respectively. Fast lib mRNA also was found in hypothyroid soleus and a small increase (60%) was observed after 1 day of treatment. In extensor digitorum longus, Fast lib mRNA increased by 200% and Fast Ha mRNA decreased by 50% after 1 week of treatment. When larger daily doses of thyroid hormone (15 /n.g/100 g body weight) were administered, similar changes in mRNA levels were observed, except that /3-mRNA content of soleus muscle was decreased slightly (25%). Expression of the cardiac form of a-actin was induced transiently in ventricle, but the skeletal form of a-actin mRNA in soleus and extensor digitorum longus did not change significantly after thyroid hormone treatment. Skeletal a-actin mRNA was not found in ventricle, and cardiac a-actin mRNA was not detected In skeletal muscles. Thus, cardiac a-actin mRNA levels are transiently stimulated in ventricle by thyroid hormone treatment while all of the myosin heavy chain genes expressed in adult striated muscles are affected in a complex, tissue-specific manner. (Circulation Research 1986;59:194-201) M YOSIN heavy chain (MHC) isoforms in striated muscles are encoded by a highly conserved multigene family.1 At least six MHCs are known to be expressed in striated muscles of the rat, including embryonic and neonatal skeletal muscle forms, fast oxidative glycolytic (Fast Ha), and fast glycolytic (Fast lib) skeletal forms, and two cardiac types, a and /3. The /3-MHC form is also expressed in slow skeletal muscles.2 Although the coding regions of these genes show a high degree of homology, the 3'untranslated sequences are not as closely conserved.3 The MHC genes show distinct patterns of tissuespecific expression that are hormonally and developmentally regulated.2"7 The effects of thyroid hormone on expression of a- and /3-MHC forms in the ventricle have been studied most extensively (see review in Morkin et al. 8 ). In the rat ventricle, there are three myosin isoforms, referred to as V,_3, in order of decreasing electrophoretic mobility on nondenaturing From the Departments of Internal Medicine and Pharmacology, University of Arizona College of Medicine, Tucson, Arizona. Supported by grants from the Arizona Affiliate of the American Heart Association, the National Institutes of Health (HL-20984) and the Gustavus and Louise Pfeiffer Research Foundation. Address for reprints: Eugene Morkin, Department of Internal Medicine, University of Arizona College of Medicine, Tucson, A2 85724. Received December 10, 1985; accepted May 13, 1986. pyrophosphate-containing gels. 9 These three forms are comprised of two types of MHC, a and /3. The V, and V3 forms contain two a-MHCs and two /3-MHCs, respectively, while the V2 form contains one MHC of each type.10 Thyroid hormone has been shown to regulate the expression of ventricular myosin isoenzymes by causing an accumulation of a-MHC mRNA and inhibiting expression of /3-MHC mRNA." Recently, similar alterations in the expression of these isoforms have been reported after thyroid hormone treatment of cultured fetal rat heart cells,12 indicating a direct action of the hormone on this target tissue. Alterations in myosin composition of various muscles may be physiologically significant, since the relative proportions of the isoforms seem to be directly related to the intrinsic speed of contraction.13 14 Thyroid hormone treatment has been shown to increase the proportion of the V, isoenyzme and the maximal velocity of shortening in isolated ventricular muscle (see review in Morkin et al). 8 Similarly, in skeletal muscle the shortening velocity of whole muscles and individual fibers has been shown to be closely related to the proportion of fast-to-slow MHCs.15-17 Alterations in thyroid status also have been reported to effect myosin isoforms in skeletal muscles. An increase in the percentage of fast (Type II) fibers in both fast- and slow-twitch skeletal muscles has been found after thyroid hormone administration. 161819 Con- Gustafson el al Control of a-Actin and MHC Gene Expression by T 3 Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 versely, slow (Type I) fibers have been shown to increase in rat skeletal muscles after thyroidectomy.18 Furthermore, during the development of skeletal and cardiac muscles the normal transition of embryonic to adult MHC isoenzyme patterns has been shown to be inhibited by hypothyroidism and accelerated by hyperthyroidism.20'21 The question naturally arises as to whether thyroid hormone produces these changes in skeletal muscles by altering the expression of MHC genes as is observed in ventricular muscle. a-Actins also represent a family of highly conserved proteins. In the adult rat, two major isoforms, a-cardiac and a-skeletal actin, are expressed in heart and skeletal muscles, respectively. The hearts of neonatal rats have been known to contain significant amounts of a-skeletal actin mRNA, and conversely, a-cardiac actin has been shown to be expressed in neonatal skeletal muscle.22 Thus, like the MHC gene family, the a-actin family appears to be developmentally regulated in the rat, but it is not clear whether thyroid hormone plays a role in regulating the expression of these genes. In this report, we have compared the effects of thyroid hormone treatment at two dosage levels on MHC and a-actin mRNA expression in ventricle, soleus, and extensor digitorum longus (EDL) muscles of the rat. To facilitate analysis of these effects, we have developed a rapid, simple dot-blot assay using synthetic [32P]-labelled oligonucleotide DNA probes constructed to be complementary to the unique 3' flanking sequences of four of the six major striated muscle myosin mRNAs and the two sarcomeric a-actin mRNAs of the rat. The results indicate that expression of all of the MHC genes is regulated by thyroid hormone in a highly complex, tissue-specific manner. Analysis of the expression of the a-actin genes after administration of 3,5,3'-triiode-L-thyronine (T3) shows a transient increase in a-cardiac actin mRNA content in the ventricle, but no a-actin isoform transitions are observed in ventricle, EDL, or soleus muscles. Materials and Methods Animal Experiments Thyroidectomized male Sprague-Dawley rats weighing approximately 200 g were obtained commercially and maintained on rat chow. Methimazole (200 mg/1) and calcium gluconate (1.5 g/1) were added to the drinking water. Animals were weighed twice weekly and considered to be hypothyroid only after cessation of growth was observed. Stock solutions of L-T3 were prepared in 0.1 N NaOH at a concentration of 2 mg/ml and diluted in physiological saline prior to administration. Animals received either 2 or 15 /Ag Tj/100 g body weight daily by intraperitoneal injection. The lower dose was found to restore normal growth to thyroidectomized rats and to result in a euthyroid myosin isoenzyme pattern.23 During treatment with the higher dosage, normal increases in body weight were also observed. Animals were killed by decapitation and the tissues quickly removed and placed in cold phosphate buffered saline. The tissues then were weighed, and RNA was prepared. 195 Isolation of RNA Total cellular RNA was isolated from ventricular and skeletal muscles using the guanidinium isothiocyanate-hot phenol method.24 All plastic and glassware was pretreated with 0.1 % diethylpyrocarbonate at 37° C for 30 minutes and autoclaved. The final RNA pellet was resuspended in distilled H2O and stored at -70°C. Preparation of Synthetic Probes Synthetic oligonucleotide probes 20 bases in length were prepared in an Applied Biosystems DNA Synthesizer (Model 380A) and purified by electrophoresis. The probes were labelled at the 5' end using T4 polynucleotide kinase23 to a specific activity of 2 to 4 x 108 cpm//xg. Labelled probe was separated from unincorporated [•y-32P]-ATP by filtration through small columns of Bio-Gel P-2 (Bio-Rad), precipitated in 70% ethanol at - 70° C, and then resuspended in deionized H2O. The sequences of the four MHC oligonucleotide probes used in this study have been reported earlier.7 The sequences of the two additional probes used here are as follows (5' to 3'): a-cardiac actin, TGCACGTGTGTAAACAAACT; and a-skeletal actin, GCAACCATAGCACGATGGTC. 22 M Dot Blot Assays RNA samples at a concentration of 0.5 to 2.0 mg/ml were denatured by heating at 65°C for 15 minutes and cooled on ice. Aliquots of 4 \x\ were spotted in triplicate directly onto dry nitrocellulose filters that had been pretreated with 3.0 M NaCl, 0.3 M Na citrate as described earlier.27 After spotting, filters were baked at 80°C for 2 hours. Denaturation of RNA samples by glyoxylation or formaldehyde treatment prior to spotting did not result in any increase in the sensitivity of the assay (data not shown). Prehybridizations, hybridizations, and wash steps were carried out essentially as described earlier,28 with some modifications. Prior to prehybridization, the filters were wet in deionized H2O and prehybridized at 45°C for at least 8 hours in buffer containing 0.1% bovine serum albumin, 0.1% polyvinylpyrrolidone, 0.1% sodium dodecyl sulfate (SDS), 0.1 % Ficoll, 10% dextran sulfate, 0.9 M NaCl, 0.18 M Tris-HCl, pH 8, 6 mM EDTA, and 0.5% Nonidet P-40. Hybridization was carried out by heating the probe-containing solution to 65° C for 10 minutes and adding it directly to the prehybridization fluid at a concentration of approximately 3 ng/ml in a volume of at least 5 ml per bag and about 2 ml per filter. After hybridization for 18-20 hours the filters were washed with four 10-minute changes of 0.9 M NaCl, 0.09 M sodium citrate at room temperature (22-23°C). A final 1-minute wash at 50° C in the same solution was performed, and the filters were allowed to air dry. Filters were wrapped in plastic and autoradiography was carried out with intensifying screens at — 70° C for 4 hours to 2 days. Afterwards, individual spots were cut from the filters and the radioactivity was determined by liquid scintillation counting in Aquasol (New Circulation Research 196 Vol 59, No 2, August 1986 England Nuclear Corp., Boston, Mass.). Aliquots of total RNA prepared from rat liver were spotted at the same concentrations as the muscle RNAs. These spots were counted and the values were considered to represent nonspecific background hybridization. Northern Blot Analysis For Northern blot analysis, 10 fig of total cellular RNA were size fractionated on 1.1% agarose gels containing 40 mM morpholinopropanesulfonic acid, pH 7.4, 10 mM Na acetate, 1 mM EDTA, and 2.2 M formaldehyde.29 The RNA was electrophoretically transferred to Nytran membranes (Schleicher and Schuell, Inc.) using the procedures recommended by the manufacturer. Filters were baked for 2 hours and hybridized with the synthetic probes using the conditions described above. Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 Results Untreated thyroidectomized rats showed no significant change in heart weight:body weight ratio throughout the duration of these experiments (Figure 1). Both low and high dosages of thyroid hormone caused a rapid increase in this ratio, which was evident by the second day of treatment. While the amount of ventricular weight gain during the first week of treatment was similar at both dosages, the higher dosage ultimately resulted in greater myocardial growth. With all of the probes used in this study the amount of radioactivity bound increased linearly as increasing amounts of total cellular RNA were applied to the filters up to about 8 fig per spot (Figure 2). In these experiments, total cellular RNA was prepared from tissues known to express each myosin isoform and spotted on nitrocellulose filters in amounts ranging from 0.5 to 8.0 fig. After hybridization and wash Time FIOURE 1. Changes in heart weight/body weight ratio of hypothyroid rats before and after treatment with two doses ofT3. Untreated hypothyroid animals (*); animals treated with 2 fig/100 g day-i (A); and 15 fig/100 g body weight day - ' (•). Data points represent mean ± SEM for four to six animals. T3 = 3,5,3' -triiodo-L-thyronine. 0 12 FIGURE 2. Standard curves for dot-blot assay of MHC and exact in mRNA. The a-MHC probe was hybridized to RNA prepared from hypothyroid ventricle 24 hours after a single intraperitoneal injection ofT3 (2 fig/100 g body weight). Thefi-MHC probe was hybridized to RNA from hypothyroid ventricle. The Fast IIa probe was hybridized to RNAfrom soleus after 7 weeks of T3 administration at this dosage. The Fast lib probe was hybridized to RNAfrom EDL after 1 week ofT3 treatment at the same dosage. Cardiac and skeletal a-actin probes were hybridized to RNA from hypothyroid ventricle and soleus muscle, respectively. Dot blots were quantitated as described in "Materials and Methods." Values are in means ± SEM of triplicate determinations. In some cases, the SEM is within the diameter of the symbol. • = radioactivity bound to total cellular RNA from various rat muscles. A = nonspecific background radioactivity obtained after hybridization of the probes with similar amounts of total RNA extracted from liver. MHC = myosin heavy chain; T3 = 3,5,3'-triiodo-L-thyronine; EDL = extensor digitorum longus. steps, the dot blots were quantitated using the procedures outlined in "Materials and Methods." Specifically bound counts were obtained as the difference between total bound radioactivity and counts bound nonspecifically to an equivalent amount of total cellular RNA from liver. The specificity of the hybridization of synthetic oligonucleotide probes to MHC mRNAs was verified by Northern blot analysis with RNA from ventricle and skeletal muscles of hypothyroid and T3-treated animals. Hybridization to blots of size-fractionated total RNA showed that all MHC probes hybridized to a single band with a mobility of about 7,100 nucleotides (Figure 3). This corresponds to the size reported for MHC mRNA.30 Duplicate samples of RNA prepared from untreated hypothyroid ventricles showed very little hybridization to the a-MHC probe (Figure 3A, lane 1) and a large amount of hybridization to the /3-MHC Gustafson et al 1 197 Control of a-Actin and MHC Gene Expression by T 3 A. Ventricle 2 3 B. EDL 4 6 7 8 C. Soleus 9 10 -MHC -28S -18S Fast lla Fast lib Fast lla Fast lib 0 Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 FIGURE 3. Demonstration of MHC probe specificity by Northern blot analysis. About 10 ng of total RNA were size fractionated and transferred to nitrocellulose as described in "Materials and Methods." (A) Duplicate blots were hybridized to either the a- orfi-MHC probes. RNA in lanes I and 3 was prepared from ventricle of untreated hypothyroid rats; RNA in lanes 2 and 4 was prepared from ventricles after 1 week ofTj treatment (2 fig/100 g daily). (B) Duplicate blots of RNA isolated from hypothyroid EDL were hybridized to Fast lla MHC probe (lane 5), Fast lib MHC probe (lane 6), andfi-MHC probe (lane 7). (C) Duplicate blots of RNA prepared from hypothyroid soleus muscle hybridized to Fast lla MHC probe (lane 8), Fast lib MHC probe (lane 9), andfi-MHC probe (lane 10). All autoradiographs were obtained by 20—36 hours exposure with intensifying screens at — 70° C, except lanes 8 and 9, which were exposed for % hours. The relative mobilities of the 18S and 28S ribosomal RNAs are indicated. EDL = extensor digitorum longus; MHC = myosin heavy chain; Tj = 3,5,3'-triiodo-L-thyronine. probe (lane 3). After 1 week of daily treatment of T3 at a dose of 2 ^ig/100 g body weight, this pattern of hybridization was markedly altered. Hybridization of the a-MHC probe increased dramatically (lane 2) whereas the duplicate filter (lane 4) showed much less hybridization of the /3-MHC probe as compared to RNA from the hypothyroid control (lane 3). Some nonspecific binding to 28s and 18s ribosomal RNA was observed. Since this background was only seen in lanes where MHC mRNA was abundant, the nonspecific binding may have been produced by hybridization of the probes to partially degraded MHC mRNAs whose migration through the gel has been retarded by interaction with the more abundant rRNA species. The absence of extensive hybridization by these probes to total RNA prepared from liver is consistent with this interpretation. As indicated in Figure 1, nonspecifically bound counts always were less than 10% of specifically bound counts and did not interfere with estimations of specific MHC mRNA levels. Northern blot analysis showed hybridization of both the Fast Ua (lane 5) and the Fast lib MHC probes (lane 6) with RNA prepared from hypothyroid EDL (Figure 3B). There also was a surprisingly large degree of hybridization to the slow /3-MHC probe (lane 7). The strong signal observed with the /3-MHC probe presumably is caused by a switch in the hypothyroid EDL from fast- to slow-type MHCs. Northern blot analysis of RNA from hypothyroid soleus (Figure 3C) showed a strong hybridization to the /3-MHC probe after 16 hours of exposure of the autoradiogram (lane 10). After longer exposure (96 hours), probes for Fast Ua MHC and Fast lib MHC showed faint hybridization with a band of similar mobility (lanes 8 and 9). Probes for fetal- and embryonicMHC skeletal mRNAs did not hybridize with MHC mRNAs either before or after T3 treatment. When analyzed by Northern blot hybridization, both cardiac and skeletal a-actin probes hybridized to a single band of total RNA with a mobility of approximately 1,650 nucleotides (data not shown). Daily administration of T3 (2 ^ig/100 g body weight) to hypothyroid rats resulted in changes in the MHC mRNA content of muscle types examined (Figure 4). In ventricle, there was a rapid increase in a-MHC mRNA, which began 6-12 hours after treatment, and by 1 day it was increased by 500% over the control value. After 1 week of treatment, a-MHC mRNA had declined from peak values and thereafter remained at about 300% of control. During the first two days of treatment, the levels of /3-MHC mRNA decreased by about 65% and then remained fairly constant. Another pattern of MHC gene regulation by T3 was observed in EDL, a predominately fast-twitch muscle (Figure 4). Levels of all three mRNAs expressed in this muscle appeared to be regulated by T3 administration, but in very different ways. As observed in the ventricle, /3-MHC mRNA was repressed by about 40% after 48 hours of treatment and by 50% after 1 week. Fast Ha MHC mRNA was decreased to about 50% of Circulation Research 198 Ventricle 500 400 300 200 I0O 0 EDL Soleus a U i i i 20 0 20 Q) "40 Ol -60 J -80 "~ 250 200 ISO 100 50 0 -50 Vol 59, No 2, August 1986 i II i i i o 2OO FIGURE 4. Dot-blot analysis of the effect of low-dose thyroid hormone administration (2 ng/100 g daily) on hybridization of synthetic oligonucleotide MHC probes with RNAfrom ventricle and skeletal muscles. The values represent the change in filter-bound radioactivity associated with RNA from animals that received T3 as compared to untreated hypothyroid animals. Each point represents the mean ± SEM of triplicate determinations on individual muscles from 4 to 8 animals. EDL = extensor digitorum longus; MHC = myosin heavy chain; T3 = 3,5,3''-triiodo-L-thyronine. Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 ISO 100 SO 0 SO Time control levels by 1 week. By contrast, Fast lib MHC mRNA increased during this time to about 200% of hypothyroid values. Interesting differences also were noted between expression of the /3-MHC gene in ventricle and soleus, a slow-twitch skeletal muscle that expresses predominantly /3-MHC mRNA (Figure 4). Rapid repression of /3-MHC mRNA by T3 dosing is observed in ventricle, whereas in soleus this mRNA is not repressed significantly even by 9 weeks of treatment. Furthermore, in soleus, T3 administration stimulates production of Fast Ila MHC mRNA, which has been shown to be produced in a small number of soleus fibers in euthyroid rats.31 After 7 weeks of daily treatment, Fast Ha is increased by 150% and by 200% after 9 weeks. Binding of a second fast MHC mRNA form, designated as Fast lib, showed smaller increases (60—80%) over the same period. With minor exceptions, daily administration of larger doses of T3 (15 /u.g/100 g body weight) produced similar effects on MHC gene expression (Figure 5). aMHC mRNA was induced only in ventricle and reached levels comparable to those achieved with lower doses. At the higher dosage of T3, /3-MHC mRNA was repressed to the same degree in ventricle as with the lower dosage but was inhibited to a greater degree in EDL (75% inhibition versus 50%). In soleus, /3MHC gene expression was slightly more sensitive to the higher dose of T3, as evidenced by a 30% reduction in /8-MHC mRNA after 1 week of treatment. The Fast MHC mRNAs showed similar patterns of regulation. Fast lib MHC mRNA was increased in EDL by 300%, and Fast Ha MHC mRNA was repressed by 60% after 1 week. In soleus, Fast Ila MHC mRNA was induced, but only after 1 week of treatment. Daily administration of the lower dose of T3 (2 /xg/100 g body weight) caused accumulation of acardiac actin mRNA to levels 100% and 150% above the control after 1 and 2 days of treatment, respectively, but returned toward control levels after 1 week of treatment (Figure 6). Very little hybridization of the askeletal actin probe with ventricular RNA was observed, and this did not change after T3 injection (data not shown). Skeletal a-actin levels did not change significantly in either soleus or EDL muscles, and cardiac a-actin mRNA did not appear to be expressed in these muscles. Discussion Recently, we have demonstrated the usefulness of synthetic oligonucleotide DNA probes in a simple dotblot assay for studying mRNA expression in a highly conserved multigene family.7 Evidence was presented to suggest that a low dose of T3 was able to alter MHC expression in ventricle and soleus muscle in a tissue specific manner. Here we have extended our preliminary findings by examining the effects of two dosage levels of T3 on the expression of the MHC mRNAs and skeletal and cardiac a-actin mRNAs. The tissues examined included ventricle, soleus (a predominantly slow-twitch muscle), and EDL (a predominantly fasttwitch muscle). The results obtained in this study warrant further discussion in terms of the highly complex and tissue-specific actions of thyroid hormone on MHC and a-actin gene expression. Although the assay used to measure MHC mRNA levels does not differentiate between changes in transcriptional activity and alterations in mRNA stability, the reciprocal regulation of the same MHC mRNAs in different tissues and the rapid induction of a-MHC Gustafson et al Control of a-Actin and MHC Gene Expression by T 3 Ventricle EDL 199 Soleus FIGURE 5. Dot-blot analysis of the effects of high-dose thyroid hormone administration (15 fj.g/100 g) on hybridization of synthetic oligonucleotide MHC probes with RNAfrom ventricle and skeletal muscles. The assay was performed as described in Figure 3. Each point represents the mean ± SEM of triplicate determinations on individual muscles from 4 to 6 animals. EDL = extensor digitorum longus. Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 Time mRNA from negligible levels in the ventricle are consistent with transcriptional control. The results can be summarized as follows (Figure 7). First, a-MHC mRNA is regulated by thyroid hormone only in ventricle, and this gene does not appear to be expressed in skeletal muscles. Similarly, the two Fast-MHC mRNAs are controlled by thyroid hormone only in skeletal muscles and are not expressed in ventricle. Secondly, /3-MHC mRNA is induced by hypothyroidism to varying degrees in ventricle and skeletal muscles, and is repressed by thyroid hormone treatment, although not to the same extent in all tissues. It should also be noted that in those tissues where T3 causes repression of MHC mRNA expression, this process is not complete. Third, both Fast MHC mRNAs are sensitive to thyroid status in skeletal muscles, but in an unexpectedly complex manner. For example, Fast Ila MHC mRNA is induced in soleus by thyroid hormone treatment, but it is repressed in EDL. Finally, a-actin isoform transitions do not occur in response to changes in thyroid status. However, there is a transient increase in the amount of the cardiac isoform of a-actin mRNA during the first two days of T3 treatment that approximately parallels the increase in a-MHC mRNA. These findings suggest that MHC gene expression is subject to at least two types of regulation. One type involves the stable repression of MHC genes within a particular muscle type. MHC genes repressed in this manner are unresponsive to changes in thyroid status. The second mechanism involves regulation of MHC genes in a manner that allows the gene to respond to changes in thyroid status with either increased or decreased expression. Processes such as tissue-specific DNA methylation might be envisioned in the first type of control, whereas binding of protein activator or repressor molecules to regulatory regions of the responsive genes might underlie the second type of regulation. Control of /3-MHC gene expression provides an example of the second type of regulation. This gene is constitutively expressed in ventricular, soleus, and EDL muscles in the hypothyroid state. In ventricle and EDL, the /3-MHC gene may be affected by a negative regulatory factor that itself is under the control of thyroid hormone. This putative regulatory factor may be absent, or present only at very low levels, in soleus muscle and may act as a positive regulator of a-MHC synthesis in ventricle. Alternatively, thyroid hormone may repress the expression of a positive regulatory factor that activates /3-MHC expression in the hypothyroid state. The apparently simultaneous activation of the aMHC gene and repression of the /3-MHC gene suggests the existence of a common control mechanism, but independent control of the two genetically linked genes cannot be ruled out. Any plausible explanation of MHC gene control also must explain the marked difference in time of response to T3 administration. The delayed onset of T3 action on Fast Ila MHC mRNA expression, for example, is consistent with earlier results indicating that at least 6 weeks of high-dose thyroid hormone administration are required to increase the proportion of fast oxidative fibers (Ha) in soleus muscle from the normal value of 12% to 26%. 16 The slow onset of T3 action on Fast Ila MHC mRNA expression in soleus as compared with the rapid effect on a-MHC mRNA accumulation in ventricle might be related to a larger number of T-, nuclear receptors in Circulation Research 200 Ventricle Cardiac Actin Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 -SO . Time I 1 11 13 5 7 wk FIGURE 6. Effects ofT3 administration on cardiac and skeletal a-actin mRNA content in the ventricle, EDL, and soleus. Total cellular RNA was preparedfrom ventricle at various times after daily administration of 2 fxg T3ll00 g body weight (top) and hybridized with the synthetic cardiac a-actin probe. The synthetic skeletal a-actin probe also was hybridized to RNA preparedfrom EDL (middle) and soleus muscles (bottom). EDL = extensor digitorumlongus.Tj = 3,5,3' -triiodo-L-thyromne. ventricle as compared with skeletal muscles.8 Alternatively, the delay in accumulation of the Fast Ha MHC mRNA in soleus muscle may be related to slower accumulation of an intermediate signal in the steps between binding of T3 to its nuclear receptors and stimulation of specific genes.23 The time required to accumulate an essential regulatory factor also might explain the delay in /3-MHC mRNA repression after T3 dosing in soleus and EDL as compared with ventricle. It should be noted that soleus muscle has not been reported to contain Type lib fibers in either the euthyroid or hyperthyroid state by histological criteria.15-l6 Possibly, the histochemical properties designated as a VENTRICLE SOLEUS EDL — FAST FAST IIA IIB — — o OfiDIAC ACTIN Vol 59, No 2, August 1986 Type Ila may reflect the combined ATPase activities of the two myosin isoforms within the same fiber. Different effects of thyroid hormone on the same protein in different tissues have been reported earlier. For example, synthesis of phosphoenolpyruvate kinase has been found to be increased in the liver of hyperthyroid animals, whereas decreased synthesis was found in the kidney, despite similar levels of nuclear occupancy in both organs.32 Also, the specific activity of mitochondrial a-glycerolphosphate dehydrogenase (aGPDH) has been shown to be affected differently by thyroid hormone in fast and slow skeletal muscles and cardiac muscle of the rat.33 Increases in the activity of aGPDH were found in soleus and heart after administration of high doses of T3, but no changes were observed in the rectus femoris, a fast muscle. The induction of various components of the /3-adrenergic receptor system have also been shown to be differentially regulated by thyroid hormone in a tissue-specific manner. 3435 In most tissues, including heart and adipose tissue, hyperthyroidism increases, and hypothyroidism decreases, synthesis of these proteins, but in liver the opposite pattern is observed. Many hypotheses have been proposed to account for these tissuespecific responses including differences in the entry or conversion of thyroid hormones at the tissue level* and quantitative and/or qualitative differences in the nuclear T3 receptors. To date, however, little evidence has been presented to support these hypotheses. Although the a-actin mRNAs have been shown to undergo developmental isoform transitions in cardiac and skeletal muscles in the neonatal rat,22 the present results indicate that isoform transitions are not regulated by thyroid hormone in adult ventricle or skeletal muscles. On the other hand, a transient accumulation of a-cardiac actin was observed in ventricle following thyroid hormone administration, suggesting that the hormone also may modulate the level of expression of other muscle-specific genes. The stimulation of a-actin in ventricle would be consistent with the accumulation of actin related to cardiac growth (Figure 1). It is unclear whether this is caused by direct actions of thyroid hormone on the actin gene or by a more general stimulus to growth that might involve a number of muscle protein genes. These effects of thyroid hormone on the expression of muscle-specific proteins other than MHC in the myocardium deserve further study. SKELETAL ACTIN — — nc — nc FIGURE 7. Schematic representation of changes in expression of MHC and a-actin mRNAs after administration ofT3 to hypothyroid rats. The arrows represent the direction and relative degree of the change observed. The dashes represent a lack of expression of the particular mRNA. The asterisk denotes a transient change in mRNA levels. NC = no significant change in the mRNA levels; EDL = extensor digitorum longus; T} = 3,5,3'triiodo-L-thyronine. Gustafson et al Control of a-Actin and MHC Gene Expression by T 3 References Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 1. Nguyen HT, Gubits RM, Wydro RM, Nadal-Ginard B: Sarcomeric myosin heavy chain is coded by a highly conserved multigene family. Proc Natl Acad Sci USA 1982;79: 5230-5234 2. Lompre A-M, Nadal-Ginard B, Mahdavi VJ: Expression of the cardiac ventricular a- and /3-myosin heavy chain genes is developmentally and hormonally regulated. J Biol Chem 1984; 259:6437-6446 3. Nadal-Ginard B, Medford RM, Nguyen HT, Periasamy M, Wydro RM, Horning D, Gubits R, Garflnkel LI, Weiczorek DF, Bekesi E, Mahdavi VJ: Structure and regulation of a mammalian sarcomeric myosin heavy chain gene, in Pearson ML and Epstein HF (eds): Muscle Development: Molecular and Cellular Control. New York, Cold Spring Harbor Laboratories, pp 143-168 4. Whalen RG, Sell M, Butler-Browne GS, Schwartz K, Beuveret P, Pinsel-Harstrom P: Three myosin heavy chain isozymes appear sequentially in rat muscle development. Nature 198I;292:805-809 5. Butler-Browne GS, Whalen RG: Myosin isozyme transitions occurring during the postnatal development of the rat soleus muscle. Dev Biol 1984; 102:324-334 6. Periasamy M, Wieczorek DF, Nadal-Ginard B: Characterization of a developmentally regulated perinatal myosin heavy chain gene expressed in skeletal muscle. J Biol Chem 1984; 259:13573-13578 7. Gustafson TA, Markham BE, Morkin E: Analysis of thyroid hormone effects on myosin heavy chain gene expression in cardiac and soleus muscles using a novel dot-blot mRNA assay. Biochem Biophys Res Commun 1985; 130:1161—1167 8. Morkin E, Flink IL, Goldman S: Biochemical and physiologic effects of thyroid hormone on cardiac performance. Prog Cardiovasc Dis 1983;25:435-463 9. Hoh JFY, McGrath PA, Hale HT: Electrophoretic analysis of multiple forms of rat cardiac myosin: effects of hypophysectomy and thyroxine replacement. J Mol Cell Cardiol 1978; 10:1053-1076 10. Hoh JFY, Yeoh GPS, Thomas MAW, Higginbottom L: Differences in the heavy chains of rat ventricular myosin isoenzymes. FEBS Lett 1979;97:330-334 11. Everett AW, Sinha AM, Umeda P, Jakovic S, Rabinowitz M, Zak R: Regulation of myosin synthesis by thyroid hormone: Relative change in the a and /3-myosin heavy chain mRNA levels in rabbit heart. Biochemistry 1984;23:1596-1599 12. Nag AC, Cheng M: Expression of myosin isoenzymes in cardiac muscle cells in culture. Biochem J 1984;221:21-26 13. Barany M: ATPase activity of myosin correlated with speed of muscle shortening. J Gen Physiol 1967;50(suppl): 197-216 14. Schwartz K, Lecarpentier Y, Martin JL, Lompre A-M, Mercadier J-J, Swynghedauw B: Myosin isoenzymic distribution correlates with speed of myocardial contraction. J Mol Cell Cardiol 1981;13:1071-1075 15. Fitts RH, Winder WW, Brooke MH, Kaiser KK, Holloszy JO: Contractile, biochemical, and histochemical properties of fhyrotoxic rat soleus muscle. Am J Physiol 1980;238:C15-C20 16. Nicol DJM, Bruce DS: Effect of hyperthyroidism on the contractile and histochemical properties of fast and slow twitch skeletal muscle in the rat. Pflugers Arch 1981 ;390:73-79 17. Reiser PJ, Moss RL, Giulian GG, Greaser ML: Shortening velocity in single fibers from adult rabbit soleus muscles is correlated with myosin heavy chain composition. J Biol Chem 1985;260: 9077-9080 18. Ianuzzo D, Patel P, Chen V, O'Brien P, Williams C: Thyroidal trophic influence on skeletal muscle myosin. Nature 1977;270: 74-76 19. Nwoye L, Mommaerts WFHM, Simpson DR, Seraydarian K, Marusich M: Evidence for a direct action of thyroid hormone in 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 201 specifying muscle properties. Am J Physiol 1982;242: R401-R408 Gambke B, Lyons GE, Haselgrove AM, Kelly AM, Rubinstein NA: Thyroidal and neural control of myosin transitions during development of rat fast and slow muscles. FEBS Lett 1983;156:335-339 Butler-Browne GS, Herlicoviez D, Whalen RG: Effects of hypothyroidism on myosin isozyme transitions in developing rat muscle. FEBS Lett 1984;66:71-75 Mayer Y, Czosnek H, Zeelon PE, Yaffe D, Nudel U: Expression of the genes coding for the skeletal muscle and cardiac actins in the heart. Nucleic Acids Res 1984; 12:1087-1100 Sheer D, Morkin E: Myosin isoenzyme expression in rat ventricle: Effects of thyroid hormone analogs, catecholamines, glucocorticoids and high carbohydrate diet. J Pharmacol Exp Ther 1984;229:872-879 Maniatis T, Fritsch EF, Sambrook J: Isolation of total cellular RNA, in Molecular Cloning: A Laboratory Manual, New York, Cold Spring Harbor Laboratory, pp 189-195 Maxam AM, Gilbert W: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymology 1980; 65:499-559 Shani M, Nudel U, Zevin-Sonkin D, Zakut R, Givol D, Kat off-Carmon Y, Reiter J, Frischauf AM, Yaffe D: Skeletal muscle actin mRNA: Characterization of the 3' untranslated region. Nucleic Acids Res 1981;9:579-589 Thomas PS: Hybridization of denatured RNA transferred or dotted to nitrocellulose paper. Methods Enzymol 1983; 100: 255-266 Conner BJ, Reyes AA, Morin C, Itakura K, Teplitz RL, Wallace RB: Detection of sickle cell /3s-globin allele by hybridization with synthetic oligonucleotides. Proc Natl Acad Sci USA 1983;80:278-282 Lehrach H, Diamond D, Wozney JM, Boedtker H: RNA molecular weight determinations by gel electrophoresis under denaturing conditions: a critical reexamination. Biochemistry 1977; 16: 4743-4753 Medford RM, Wydro RM, Nguyen HT, Nadal-Ginard B: Cytoplasmic processing of myosin heavy chain mRNA: evidence provided by using a recombinant DNA plasmid. Proc Natl Acad Sci USA 1980;77:5749-5753 Ariano MA, Armstrong RB, Edgerton VR: Hindlimb muscle fiber populations of five mammals. J Histochem Cytochem 1973;21:51-55 Muller MJ, Thomsen A, Sibrowski W, Seitz HJ: 3,5,3'Triiodo-thyronine-induced synthesis of rat liver phosphoenolpyruvate carboxykinase. Endocrinology 1982;111:1469-1475 Kubista V, Kubistova J, Pette D: Thyroid hormone induced changes in the enzyme activity pattern of energy-supplying metabolism of fast (white), slow (red), and heart muscle of the rat. EurJ Biochem 1971;18:553-560 Williams LT, Lefkowitz RJ, Watanabe AM: Thyroid hormone regulation of /3-adrenergic receptor number. J Biol Chem 1977;252:2767-2769 Malbon CC, Greenberg ML: 3,3',5',-Triiodothyronine administration in vivo modulates the hormone sensitive adenylate cyclase system of rat hepatocytes. J Clin Invest 1982;69: 414-429 van Hardeveld C, Kassenaar AAH: Thyroid hormone uptake and T 4 derived T 3 formation in different skeletal muscle types of normal and hyperthyroid rats. Ada Endocrinol (Copenhagen) 1978;88:306-320 KEY WORDS • myosin heavy chain • a-actin • gene regulation • thyroid hormone • dot blot assay Effects of thyroid hormone on alpha-actin and myosin heavy chain gene expression in cardiac and skeletal muscles of the rat: measurement of mRNA content using synthetic oligonucleotide probes. T A Gustafson, B E Markham and E Morkin Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 Circ Res. 1986;59:194-201 doi: 10.1161/01.RES.59.2.194 Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 1986 American Heart Association, Inc. All rights reserved. Print ISSN: 0009-7330. Online ISSN: 1524-4571 The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circres.ahajournals.org/content/59/2/194 Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Circulation Research is online at: http://circres.ahajournals.org//subscriptions/