Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Genetic and Physical Mapping of Human Recoverin: A Gene Expressed in Retinal Photoreceptors Allan F. Wiechmann,*§ Gita Akots,^ James A. Hammarback,* Mark J. Pettenati,X P. Nagesh Rao,% and Donald W. Bowden\ Purpose. Recoverin is a calcium-binding protein thai may be involved in phototransduciion in mammalian retinal photoreceptors, and is considered to be a candidate gene for retinitis pigmeniosa. This study was undertaken to develop the recoverin locus into a polymorphic marker for future linkage studies on retinitis pigmeniosa families. Methods. A human genomic cosmid clone was isolated and used to map the recoverin gene to a human chromosome through hybridization to a panel of somatic hybrid cell line DNAs, and lo human metaphase chromosomes by fluorescence in situ hybridization. A dinucleotide repeat polymorphism located within the coding region of the recoverin gene was identified, and used to genetically map the recoverin gene relative to index markers. In addition, three restriction fragment length polymorphisms revealed by the cosmic! clone were identified and characterized. Results. Hybridization to the somatic hybrid cell line DNAs localized the recoverin gene to chromosome I 7. Recoverin was further localized to .17p.l 2-pl 3 by fluorescence in situ hybridization. The dinucleotide repeat polymorphism and restriction fragment length polymorphisms at the recoverin locus have a cumulative polymorphic information content = 0.71. Conclusions. These polymorphic markers and additional closely linked markers will be useful for linkage analysis of families with retinitis pigmeniosa. Invest Ophthalmol Vis Sci. 1994;35:32:>-331. I n the process of visual phototransduction, absorption of light by rhodopsin initiates an enzymatic cascade that leads to hydrolysis of cyclic guanosine monophosphate (cGMP) and closure of cGMP-gated sodium/calcium channels resulting in photoreceptor hyperpolarization.1 Recoverin is a calcium-binding protein that until recently was believed to reverse the effects of light on cGMP levels by activating guanylate cyclase at low calcium concentration.2-3 Recent findings, however, have cast, some doubt on the ability of recoverin to affect guanylate cyclase activity.4-5 From thi; Departments of "Nenrobiology and Anatomy, •[Biochemistry, and %Pedialrics, and the Molecular ('•enetics I'rogram and §Wake Forest University Eye Center, Bowman (Way School of Medicine, Wake Forest University, WimtonSalem, North Carolina. This work was supported try grants from the National Eye Institute (EY08006 and EY1008I) to A.F.W., and North Carolina Baptist Hospital Developmental Technology Grant A-007-92 and Brenner Children's Hospital (I'.N.R. ami M.J.P.). Submitted for publication: July 6, 1993; accepted August 13, 1993. Proprietary interest category: N. Reprint requests: Allan F. Wiechmann, Department of Neurobiology and Anatomy, Bowman Gray School of Medicine, Medical Ce?iter Boulevard, Wimton-Salem, NC 27157-1010. Investigative Ophihahnology & Visual .Science, February 1904, Vol. 'tf>. No. Copyright © Association for Research in Vision and Ophthalmology Downloaded From: http://iovs.arvojournals.org/ on 06/17/2017 The complementary DNA (cDNA) encoding human retinal recoverin has been cloned and sequenced.6"8 The human nucleotide sequence is 88% identical to the bovine sequence,910 and contains a 600 base pair open reading frame encoding 200 amino acids. Recoverin-like immunoreactivity has been localized to the photoreceptors and a subpopulation of bipolar cells in the human retina.11-8 The human recoverin gene is a 9 to 10 kb single-copy gene with three exons (which together contain the entire coding sequence) and two introns, and has been mapped to human chromosome .17 by hybridization to a panel of human/rodent hybrid DNAs.6 Northern blot analysis of human retina, brain, lung, liver, and skin fibroblasts reveals a transcript only in the retina.6 The most likely candidates for gene mutations that result in retinal degeneration are those that serve crucial functions within the photoreceptor cell. It is known that abnormal levels of cyclic nucleotides lead to photoreceptor cell death.12 Because recoverin was thought to be involved in regulating cGMP levels in the photoreceptor, it therefore was a candidate for 325 326 Investigative Ophthalmology & Visual Science, February 1994, Vol. 35, No. 2 involvement in retinitis pigmentosa. Although the precise role of recoverin in the human retina is not well understood, it remains a potentially important molecule in photoreceptor physiology. To evaluate the possible role of the recoverin molecule in inherited forms of retinal degenerations, we cloned a genomic cosmid containing the recoverin gene, which was used to physically localize the recoverin gene. In addition, multiple recoverin polymorphisms were identified and used to genetically map the gene. MATERIALS AND METHODS DNA Probes A full-length recoverin cDNA probe isolated from human retina was prepared as described previously.8 Briefly, a set of oligonucleotide primers complementary to the 5' and 3' ends of the human recoverin cDN A sequence were used with a recoverin bacteriophage clone as a template for polymerase chain reaction (PCR) amplification of recoverin cDNA. The probe was labeled with 35S-dATP (1000 Ci/rnmol; Amersham, Arlington Heights, IL) using a Random Primer labeling kit (Promega, Madison, WI). Using the recoverin cDNA as a probe, a genomic cosmid clone, designated 2A/S.110, was isolated from a human genomic library prepared from peripheral blood lymphocytes as described previously.13 The cosmid contained approximately 40 kb of human genomic DNA. Double-stranded DNA sequencing (USB Sequenase kit; United States Biochemical, Cleveland, OH) was performed using two different oligonucleotides (5'[AAGTGCTGGAGATCGTCATG]3' and 5'[TGGAGGGAGGACAGCTGJ3') complementary to different regions of the recoverin cDNA as primers. Hybridization With Somatic Cell Hybrid Panel The recoverin cosmid was radiolabeled with 32P-dCTP (3000 Ci/mmol; New England Nuclear, Boston, MA) using Random Primer labeling (Promega), and hybridized to a Southern blot containing a panel of genomic DNAs from somatic cell hybrid cell lines, NIGMS Human/Rodent Somatic Cell Hybrid Mapping Panel # 1 , containing different complements of human chromosomes. In Situ Hybridization Fluorescence in situ hybridization of the cosmid to metaphase chromosomes was performed as described previously.1415 Briefly, peripheral blood leukocytes from chromosomally normal donors were cultured and chromosomes were prepared using colcemid and ethidium bromide.15 The recoverin cosmid probe was labeled by nick-translation with biotin-14-dATP Downloaded From: http://iovs.arvojournals.org/ on 06/17/2017 (Gibco-BRL; Gaithersburg, MD) using the BioNick Labeling System (Gibco-BRL). Fluorescence in situ hybridization was carried out with the recoverin probe singly or in combination with the chromosome 17 centromere-specific probe D17Z1 (ONCOR; Gaithersburg, MD) using modifications of the manufacturer's Blockit. Restriction Fragment Length Polymorphism Identification Restriction fragment length polymorphisms (RFLPs) identified in this study were found by hybridizing EcoRI fragments derived from the parent cosmid 2A/ SI 10 to Southern blots containing panels of five different human genomic DNAs digested with one of eight different restriction enzymes (BamHl, Bgl II, EcoRI, Hinc II, Hind III, Msp I, Pst I, Rsa I, and Taq I). RFLP loci were evaluated using methods for purification and radiolabeling of probe DNAs, restriction enzyme digests of human DNAs, agarose gel electrophoresis and Southern blot transfer of the human DNAs, hybridization, and autoradiography as described previously.1617 Polymorphic information content (PIC) values were calculated using the LINKAGE utility program PIC version 1.3,18 using data from the genotyping of Centre d'Etude du Polymorphisme Humain (CEPH) parents. The procedures followed the tenets of the Declaration of Helsinki. Informed consent was obtained from all subjects, and institutional human experimentation committee approval was granted for this study. Identification of Recoverin Dinucleotide Repeat Polymorphism A dinucleotide repeat sequence was identified in the 3' noncoding region of the recoverin cDNA with the interrupted sequence: (CA)7TG(CA)5(CG)4(CA)9, beginning at nucleotide position 666.8 Oligonucleotides corresponding to nucleotide position 640-657 (5'[TCACATGACACCCGTGAG]3'; primer 1), and position 839-819 (5'[AGTAGTGGAG GGAATGCTGAA]3'; primer 2) of the human recoverin sequence8 were synthesized for PCR amplification of the dinucleotide repeat sequence. Primer 1 (640-657) was endlabeled with 32P-ATP (4500 Ci/mmol; ICN) and polynucleotide kinase (Promega), and used in the PCR reaction with the other primer, and the genornic DNA of the CEPH family members. PCR reactions were carried out in a 15 fi\ volume containing 250 ng of genomic DNA, 6 ng of primer 1 end-labeled with 32PATP, 30 ng of unlabeled primer 1, 30 ng of primer 2, and components from a Gene-Amp PCR kit (Perkin Elmer Cetus, Norwalk, CT). Samples were processed through 30 temperature cycles consisting of 1 minute at 95°C, 1 minute at 50°C, and 2 minutes at 72°C, and 327 Mapping of Recoverin Gene the products were analyzed on standard sequencing gels (6%) as described by Weber and May.19 clone. Sequencing of the 2A/S110 cosmid revealed a 100% identity with the corresponding regions of the recoverin cDNA clone over the entire region analyzed (data not shown). The regions analyzed in this study were two 200 base pair segments of the coding region (nucleotides 362 to 571, and 631 to 4308). This confirmed that the 2A/S110 human cosmid contains the recoverin gene. Genetic Mapping Genotypic data for the recoverin dinucleotide repeat sequence was collected by genotyping the CEPH mapping families. Genotyping was carried out in the standard panel of 40 CEPH families. These data were combined with the data from the CEPH version 6 genetic database for chromosome 17 for genetic mapping of recoverin. Map construction was carried out as described elsewhere in detail2015 using the CRI-MAP linkage analysis program (version 2.4). Recoverin was mapped relative to the collection of index markers on chromosome 17 described by O'Connell et al.21 Location of the recoverin polymorphism was calculated using the ALL option of CRI-MAP. Two-point LOD scores of recoverin to other chromosome 17 markers were calculated using the TWOPOINT option of CRIMAP. Map distances were calculated using the Kosambi mapping function of this program. Physical Mapping of Recoverin Genomic DNAs from the NIGMS panel (#1) of rodent/human somatic cell hybrid cell lines were digested with Pst I restriction enzyme, and a Southern blot was prepared from the digests. The Southern blot was hybridized with the radiolabeled recoverin cosmid 2A/S110. As summarized in Table 1, evaluation of the concordances and discordances map the gene to chromosome 17. The recoverin cosmid probe hybridized only to the 15 cell line DNAs containing human chromosome 17. This assignment of the recoverin gene to human chromosome 17 was confirmed by fluorescence in situ hybridization (Fig. 1). The recoverin cosmid hybridized to the short arm of chromosome 17 as identified by the centromere-specific probe Dl 7Z1. Localization was to band 17pl2-pl3. RESULTS Isolation and Characterization of a Recoverin Cosmid Clone Identification of Polymorphisms and Genetic Mapping of Recoverin DNA fragments from restriction enzyme digestion of the cosmid 2A/S110 were used to screen for RFLPs The genomic cosmid clone, designated 2A/S110, was isolated from a human genomic library with the recoverin cDNA as a probe, and was sequenced to confirm the presence of the recoverin gene in the cosmid l. Mapping of Human Recoverin in NIGMS Human/Rodent Somatic Cell Hybrid Mapping Panel TABLE Human Chromosome* Hybrid Line GM/NA09925 GM/NA09926 GM/NA09927 GM/NA09928 GM/NA09929 GM/NA09930A GM/NA09931 GM/NA09932 GM/NA09933 GM/NA09934 GM/NA09935A GM/NA09936 GM/NA09937 GM/NA09938 GM/NA09940 GM/NA10324 GM/NA10567 GM/NA10611 Discordant hvbrids Recoverin + + + + + + + + + + + + + + + - / 2 3 4 7 5 ++- 10 11 12 13 H 15 16 17 18 19 20 21 22 X + - + + - + + + + < - - - - + - + + + - - + < - - + - + + - < + _ + _ _ _ _ 11 9 8 5 4 + + - + + + + + + + + + + + - + - + + + - _ _ _ 5 3 - + - < - - < + < + - + + - + + < - - < + + + + - + - + - + - + - < + + - + + - < + + + < + - + + - < - - - < - + + + + < + + - < + + + - < + - + + < - + + - + + + _ _ _ _ _ _ _ _ _ _ _ _ _ _ 3 2 16 6 8 + - + < + + - + - + - + + - + + - + - + < + + - + < + + _ + _ _ _ _ 14 0 + + + + + - + + + < + + + + - + + + < + + + - - < + + _ _ _ _ _ _ _ _ < + 6 + + + + - < + < - - + < + + - + _ _ + 6 + < + + < _ _ 13 10 * Cell lines with >10% of the cells containing the chromosome are designated +, <10% are designated <, and not containing the chromosome are designated —. Only chromosomes present in >10% of the cells were used to calculated discordances (e.g., Yu et al, 1993). Downloaded From: http://iovs.arvojournals.org/ on 06/17/2017 Investigative Ophthalmology & Visual Science, February 1994, Vol. 35, No. 2 FIGURE 1. Fluorescence in situ hybridization of the recoverin cosmid probe to human metaphase chromosomes. The fluorescent tag (small arrows) identifies the recoverin locus (one copy of the gene) to the short arm of an E Group chromosome (17 or 18). Inset: Hybridization with both the recoverin cosmid probe (small arrows) and the specific chromosome marker D17Z1 {large arrows) confirms the assignment of recoverin to chromosome 17. on panels of genomic DNAs of five unrelated persons digested with eight different enzymes. As summarized in Table 2, three different RFLPs were identified and characterized. PICs were determined from genotyping the RFLPs on CEPH parents. The recoverin cosmid was also evaluated for the presence of dinucleotide repeat sequences. A Southern blot prepared from EcoRl restriction enzyme digested cosmid clone was hybridized with the radiolabeled dinucleotide (CA)n. Two EcoKl fragments (4.8 TABLE 2. and 1.5 kb) from the cosmid hybridized to (CA)n, suggesting that there are at least two dinucleotide repeat sequences in the cosmid clone. One of these dinucleotide repeat sequences was recognized as being a dinucleotide repeat sequence located in the 3' untranslated region of the recoverin cDNA. Oligonucleotide primers derived from sequences flanking the dinucleotide repeat were prepared for PCR amplification of human genomic DNA. These experiments revealed a 3-allele dinucleotide repeat polymorphism with the characteristics outlined in Table 2. The dinucleotide repeat was used to collect genotypic data in the CEPH families. Parents in 26 of 40 CEPH families were at least partially informative and these families were analyzed with the dinucleotide repeat polymorphism. The recoverin mapping data were merged with the CEPH Version 6 database for chromosome 17, and both two-point and multipoint linkage analysis were carried out using the CRI-MAP linkage analysis programs. Three markers from 17p, loci D17S505, D17S510, and D17S66, had maximum twopoint LOD scores greater than 15 with recoverin as summarized in Table 3. In addition, Table 3 shows the two-point LOD scores for recoverin linkage to MYH2 (the myosin heavy chain gene) and D17S1. D17S1 and MYH2 flank the recoverin locus based on multipoint linkage analysis as summarized in Figure 2. The uniquely placed index markers on chromosome 17 described by O'Connell et al.21 were set as a fixed order of markers and recoverin was mapped relative to that fixed order using the ALL option of CRI-MAP. Recoverin was uniquely placed between the two 17p arm markers D17S1 and MYH2. This order is favored with odds of at least 1000:1 over any other placement Recoverin Polymorphisms RFLPs Probe Enzyme Number of Alleles Allele Size (kb) Allele Frequency Constant Fragments (kb) 2A/S110/2 BamHI * 0.37/0.50 TaqI % 0.52 0.48 0.73 0.24 0.03 0.39 0.61 72 2A/S110 12.3 5.8 9.5 7.5 6.3 1.6 1.3 2.7, 2.2 0.35/0.41 2A/S110/4 Mspl 2 PIC/ Heterozygosity 1,4 — 0.36/0.48 Dinucleotide Repeat Number of Alleles Allele Size (bp) Allele Frequency 640-657 TCACATGACACCCGTGAG S 830-819 AGTAGTGGAGGGAATGCTGAA Cumulative — 200 208 206 — 0.79 0.18 0.03 — Oligonucleotides Downloaded From: http://iovs.arvojournals.org/ on 06/17/2017 PIC/ Heterozygosity 0.30/0.34 0.71/0.73 Mapping of Recoverin Gene 329 TABLE 3. Two-Point Linkage Analysis With Recoverin Microsatellite and Polymorphic 17p Markers LOD Score at 0 Locus 0.001 0. 05 0.01 0.15 0.20 0.25 0.30 0.35 0.40 0.45 t'max e D17S505 D17S510 D17S66 D17S1 MYH2 -12.81 -25.40 5.45 9.93 5.95 14 .98 12 .25 15 .47 12 .02 7 .19 17.40 16.14 15.56 11.24 6.81 17.42 16.86 14.67 10.15 6.19 16.35 16.17 13.30 8.90 5.42 14.58 14.61 11.61 7.53 4.55 12.27 12.43 9.65 6.06 3.59 9.52 9.75 7.45 4.51 2.54 6.39 6.66 5.04 2.90 1.47 3.04 3.30 2.48 1.31 0.51 17.56 .16.85 15.71 12.12 8.67 0.12 0.15 0.08 0.03 0.05 and the local odds for the recoverin location are greater than 105:l for this location. DISCUSSION Recoverin is a 23 kD calcium-binding protein expressed in photoreceptoi s and some cone bipolar cells in the human retina. 8 " It has been reported to stimulate guanylate cyclase in response to the light-generated low calcium concentration in the rod photoreceptor outer segment,211 although new reports suggest that recoverin may not affect guanylate cyclase activity.45 The cGMP-gated calcium/sodium channels in the outer segment membrane open in response to the resulting higher cGMP levels, and the photoreceptor depolarizes. Recoverin therefore was believed to promote recovei-y of the photoreceptor from light stimulation. The cDNA encoding human retinal recoverin has been cloned and sequenced.6"8 It contains a 78 base pair base pair 5' untranslated region, a 600 base pairopen reading frame encoding 200 amino acids, and a 415 base pair 3' untranslated region.8 The nucleoiide sequence of the coding region of human recoverin shows 88% identity to the bovine910 and mouse sequences.22 Murakami and coworkers6 reported that the human recoverin gene is a 9 to 10 kb single-copy gene with three exons and two introns, and have mapped the gene to human chromosome 17 using a panel of human/rodent hybrid DNAs. Using a human recoverin cDNA probe, we have isolated a genomic clone for the recoverin gene. The cosmid clone has been used as a probe to physically map recoverin to the short arm of chromosome 1 7, and to search for polymorphic loci in or near the recoverin gene. Hybridization of the radiolabeled recoverin cosmid with a Southern blot of a panel of genomic DNAs from somatic cell hybrid cell lines indicates that the recoverin gene is located on human chromosome 17, consistent with the results of iMurakami and coworkers.6 Fluorescence in situ hybridization localized the recoverin cosmid to the short arm of chromo- Downloaded From: http://iovs.arvojournals.org/ on 06/17/2017 some 17, with sublocalization of the recoverin gene to 17pl2-pl3 on human metaphase chromosomes. The recoverin genomic clone contained a polymorphic dinucleotide repeat with a PIC = 0.30. This PIC value correlates well with the values reported by Weber,23 where it was found that the informativeness of (CA)n polymorphisms generally increases with an increasing number of repeats, and decreases as the number of interruptions of the repeat sequence increases. The (CA)n repeat sequence identified in this 13 D17S34 D17S450 D17S28 4.8 4.3 7.4 3.4 12 11.2 11.1 11.1 E RECOVERIN YH2 D17S124 — 7.3 18.0 11.2 12 3.1 1.7 5.3 2.0 D17S331 D17S82 NF1 0.6 3.4 10.0 D17S135 D17S83 8.3 FIGURE 2. Mapping of recoverin relative to index markers on chromosome I 7 by multipoint analysis. The figure shows the genetic map of index markers from O'Connell el alai present in the CEPH version 6 database. These are related to the cytogenelic map of the short arm and proximal long arm of chromosome 17. Through multipoint linkage analysis, recoverin maps between D17S1 and MYH2, 2 cM from the MYH2 locus. Genetic distances between markers are shown to the right expressed in cM as calculated using the FIXED option of CRI-MAP. 330 Investigative Ophthalmology 8c Visual Science, February 1994, Vol. 35, No. 2 study is located in the 3' untranslated region of the recoverin cDNA, and was used to genetically map the recoverin locus between D17S1 and MYH2. D17S1 and MYH2 have both been assigned to 17pl3, 24 " 27 suggesting that recoverin also lies in this region. Another (CA)n repeat was determined to be located within the cosmid clone, and may be useful for future linkage analysis. In addition to the dinucleotide repeat polymorphisms, three RFLPs revealed by the cosmid clone were identified, with PICs in the 0.3 to 0.4 range. Together with the (CA)n repeat we have characterized, these markers have a cumulative PIC = 0.71. These polymorphic markers associated with the recoverin gene will be useful in studies investigating the possible relationship of the recoverin gene to retinitis pigmentosa. Retinitis pigmentosa is a group of inherited retinal degenerations characterized by progressive loss of peripheral vision and night blindness as a result of rod photoreceptor cell death. 28 Recent advances in identification of genes involved in retinitis pigmentosa have suggested that mutations in retina-specific genes that have crucial functions in photoreceptor physiology might result in photoreceptor degeneration. 29 Because of its potential role in photoreceptor physiology, recoverin has been considered to be a candidate gene for retinitis pigmentosa. With multiple polymorphicmarkers at the recoverin locus, a large proportion of families will be informative in linkage analyses with recoverin. These markers, in conjunction with other closely linked polymorphisms such as at DJ7S506 should allow rapid evaluation of recovering relationship to retinitis pigmentosa. Key Words recoverin, retina, genetic mapping, retinitis pigmentosa Acknowledgments The authors thank Dr. Cynthia Rothschild for helpful advice, and Felicia Lamm and Rosa Hayworth for technical assistance. References 1. Stryer L. Molecular basis of visual excitation. Cold Spring Harb Syrup Quant Biol. 1988;53:283-294. 2. Dizhoor AM, Ray S, Kumar S, et al. Recoverin: A calcium sensitive activator of retinal rod guanylate cyclase. Science. 1991 ;251:915-918. 3. Lambrechi HG, Koch KW. A 2(5 kd calcium binding protein from bovine rod outer segments as modulator of photoreceptor guanylate cyclase. EMM). 1991 ;10: 793-798. 4. Hurley JB, Dizhoor AM, Ray S, Stryer L. Recovering role: Conclusion withdrawn. Science. 1993;260:740. Downloaded From: http://iovs.arvojournals.org/ on 06/17/2017 5. Gray-Keller MP, Polaris AS, Palczewski K, Detwiler PB. The effect of recoverin-likc calcium photoresponse of retinal rods. Neuron. .1993; 10: 523-531. 6. Murakami A, Yajinia T, Inana G. Isolation of human retinal genes: Recoverin cDNA and gene. Biochem Biophys Res Commun. 1992; 187:234-244. 7. Thirkill CK, Tait RC, Tyler NK, Roth AM, Keltner JL. The cancer-associated retinopathy antigen is a recoverin-like protein. Invest Ophthalmol Vis Sci. 1992:33:2768-2772. 8. Wicchmann AF, Hammarback JA. Molecular cloning and nucleotide sequence of a cDNA encoding recoverin from human retina. Exp Eye Res. 1993;56: 463-470. 9. Kutuzov MA, Shmukler BH, Suslov ON, Dergachev At, Zargarov AA, Abdulaev NG. P26-calcium binding protein from bovine retinal photoreceptor cells. EEBS Lett. 1991;293:21-24. 10. Ray S, Zozulya S, Neimi GA, et al. Cloning, expression, and crystallization of recoverin, a calcium sensor in vision. Proc Natl Acad Sci USA. 1992;89:5705-5709. 1 1. Milam AH, Dacey D, Dizhoor AM. Recoverin immunoreactivity in mammalian cone bipolar cells. Vis Neurosci. 1993:10:1-12. 12. Lolley RN, Farbcr DB, Rayborn ME, Hollyfield JG. Cyclic GMP accumulation causes degeneration of photoreceptor cells: Simulation of an inherited disease. Science. 1977;.196:064-666. 13. Bowden DW, Muller-Kahle H, Fulton TR, Gravius TC, Barker DF, Donis-Kcller H. Studies on locus expansion, library representation, and chromosome walking using an efficient method to screen cosmid libraries. Gene. 1988;71:391-400. 14. Rao PN, Hayworth R, Akots G, Petienati MJ, Bowden DW. Physical localization of chromosome 20 markers using somatic cell hybrid cell lines and fluorescence in situ hybridization. Genomics. .1992; 14:532-535. 15. Rothschild CB, Akots G, Hayworth R, el al. A genetic map of chromosome 2()ql2-ql3.1: Multiple highly polymorphic microsatellite and RFLP markers linked to the maturity onset diabetes of the young (MODY) locus. AmJ Human Genet. 1993;52:1.10-123. 16. Donis-Keller H, Green P, Helms C, el al. A genetic linkage map of the human genome. Cell. 1987;51: 319-337. 17. Schumm JW, Knowlton RG, Braman JC, et al. Identification of more than 500 RFLPs by screening random genomic clones. AmJ Human Genet. 1988;42: 143-159. 18. Ott J. Program Manual: Short Overvieiu of the LINKAGE Programs. Columbia University, New York, 1991. 19. Weber JL, May PL. Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. AmJ Human Genet. 1989;44:388396. 20. Bowden DW, Muller-Kahlc H, Watt D, ct al. Identification and characterization of restriction fragment length polymorphisms by screening random cosmid genomic clones. Am J Human Genet. 1989;44:671678. Mapping of Recoverin Gene 21. O'Connell I', Plaetke R, Maisunami N, et al. An extended genetic linkage map and an "index" map for human chromosome 17. Genomics. 1993; 15:38-47. 22. McGinnis JF, Stepanik PL, Baehr VV, Subbaraya 1, Lerious V. Cloning and sequencing of the 23 kOa mouse photoreceptor cell-specific protein. FFJiS Lett. 1992;302:172-176. 23. Weber JL. Informaiiveness of human (dC-dA)n • (dGd'l"),, polymorphisms. Genomics. 1990;7:524-530. 24. Barker D, Wright E, Nguyen K, et al. Gene for von Recklinghausen neurohbromatosis is in the pericentric region of chromosome 17. Science. 1987;236: 1100-1102. 25. Schwartz C. Psil RFLP at the MYH2 locus on chromosome 17. Nud Acids Res. I 990; 18:2837. Downloaded From: http://iovs.arvojournals.org/ on 06/17/2017 331 26. van Tuinen P, Rich D, Summers KM, Ledbetter DH. Regional mapping panel for human chromosome .1 7: application to neurohbromatosis type I. Genomics. 1987; 1:374-381. 27. Naylor SL, Sakaguchi AY, Barker D, White R, Shows TB. DNA polymorphic loci mapped to human chromosomes 3, 5,9, 11, 1 7, J 8, and 22. Proc Nntl Acad Sci. USA. 1984 ;81:2447-2451. 28. Bird, AC. Rei.inii.is pigmentosa: a review. Trans Ophthal Soc. NZ. 1977;29:51 - 5 8 . 29. Humphries P, Kcnna P, Farrar GJ. On the molecular genetics of retinitis pigmentosa. Science. 1992;256: 804-808.