Download The Expression of an Extensin-Like Protein

The Expression of an Extensin-Like Protein
Correlates with Cellular Tip Growth in Tomato1
Marcel Bucher*, Silvia Brunner, Philip Zimmermann, Gerardo I. Zardi, Nikolaus Amrhein,
Lothar Willmitzer, and Jörg W. Riesmeier
Federal Institute of Technology (Eidgenössische Technische Hochschule [ETH]) Zurich, Institute of Plant
Sciences, Experimental Station Eschikon 33, CH–8315 Lindau, Switzerland (M.B., S.B., P.Z., G.I.Z.); Federal
Institute of Technology (ETH) Zurich, Institute of Plant Sciences, Universitätsstrasse 2, CH–8092 Zurich,
Switzerland (N.A.); Max-Planck-Institute of Molecular Plant Physiology, D–14424 Potsdam, Germany (L.W.);
and PlantTec Biotechnology, Hermannswerder 14, D–14473 Potsdam, Germany (J.W.R.)
Extensins are abundant proteins presumed to determine physical characteristics of the plant cell wall.
We have cloned a cDNA encoding LeExt1 from a
tomato (Lycopersicon esculentum Mill.) root hair cDNA
library. The deduced sequence of the LeExt1
polypeptide defined a novel type of extensin-like
proteins in tomato. Patterns of mRNA distribution
indicated that expression of the LeExt1 gene was
initiated in the root hair differentiation zone of the
tomato rhizodermis. Cloning of the corresponding
promoter and fusion to the ␤-glucuronidase (GUS)
reporter gene allowed detailed examination of LeExt1
expression in transgenic tomato plants. Evidence is
presented for a direct correlation between LeExt1
expression and cellular tip growth. LeExt1/GUS expression was detectable in trichoblasts (⫽root hairbearing cells), but not in atrichoblasts of the tomato
rhizodermis. Both hair formation and LeExt1 expression was inducible by the plant hormone ethylene.
Comparative analysis of the LeExt1/GUS expression
was performed in transgenic tomato, potato (Solanum
tuberosum), tobacco (Nicotiana tabacum), and Arabidopsis plants. In the apical/basal dimension, GUS
staining was absent from the root cap and undifferentiated cells at the root tip in all species investigated. It was induced at the distal end of the differentiation zone and remained high proximally to the
root/hypocotyl boundary. In the radial dimension,
GUS expression was root hair specific in the solanaceous species. Whereas LeExt1 mRNA was exclusively detectable in the rhizodermis, root hairspecific expression correlated with GUS expression
in germinating pollen tubes. This is correlative evidence for a role of LeExt1 in root hair tip growth.
1
This work was partially supported by the Swiss National
Science Foundation, Biotechnology Priority Program (grant no.
5002–39814 to M.B.) and by ETH Zurich (to M.B.).
* Corresponding author; e-mail [email protected];
fax 41–52–3549219.
Article, publication date, and citation information can be found
at www.plantphysiol.org/cgi/doi/10.1104/pp.010998.
Rhizodermal cells differentiate in the root meristem after asymmetric division from initial cells
(Dolan et al., 1993). During rhizodermis development
in Arabidopsis, these cells specialize further into two
distinct cell types, rhizodermal cells without root
hairs (atrichoblasts) and root hair-bearing cells (trichoblasts). Once initiated, root hair growth is characterized by oriented tip growth, comparable with
that in a growing pollen tube. The zone of growth is
restricted to the tip of the growing cell (Sievers and
Schnepf, 1981). As a consequence of oriented cell
elongation, the hair extends into the yet-unexplored
rhizosphere, where it acquires water and nutrients
from the soil solution to sustain plant growth.
Root hair development is amenable to genetic dissection and has proved in the past to be a useful
model system to study the molecular mechanisms
regulating cell differentiation in Arabidopsis (Schiefelbein and Somerville, 1990). Several loci have been
reported to be involved in rhizodermal cell patterning (Galway et al., 1994; Wada et al., 1997) and root
hair initiation (Schiefelbein and Somerville, 1990;
Masucci and Schiefelbein, 1994; Schneider et al., 1997,
1998). A minimum of five genes, rhd2, rhd3, rhd4, tip1,
and cow1 are involved in hair elongation (Grierson et
al., 1997; Ryan et al., 1998). Mutations within these
genes lead to abnormalities in root hair shape and
elongation. It is interesting that Arabidopsis tip1 mutants exhibit disruption of both root hair and pollen
tube growth, suggesting that the TIP1 protein is important for tip growth (Schiefelbein et al., 1993).
During rapid root hair expansion, the synthesis of
the plasma membrane and cell wall material must
represent a major metabolic load. The site of deposition of this material is confined to the expanding tip,
thus leading to the tubular morphology. Several factors are involved in the regulation of root hair
growth. Oriented tip growth correlates well with a
steep [Ca2⫹]cyt gradient in the growing hair (Wymer
et al., 1997). Upon cessation of growth, the gradient
dissipates. Vice versa, disruption of the tip-focused
gradient of [Ca2⫹]cyt inhibits root hair growth. Another component involved in the regulation of tip
Plant Physiology, March 2002, Vol.Downloaded
128, pp. 911–923,
from on
www.plantphysiol.org
June 17, 2017 - Published
© 2002
by American
www.plantphysiol.org
Society of Plant Biologists
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
911
Bucher et al.
growth is the microtubule cytoskeleton. Microtubuledepolymerizing agents cause a waving growth habit
of the growing hairs and the formation of multiple
growing points (Bibikova et al., 1999). Other components contributing to the elongation or the morphology of tip-growing cells are likely to be located in the
cell wall (Gilroy and Jones, 2000).
The cell wall affects cell form and function. The
protein component of the cell wall contains both
enzymes and structural proteins. So far, the best
characterized structural cell wall protein is extensin
(Showalter, 1993; Cassab, 1998), a member of the
family of Hyp-rich glycoproteins (HRGPs) that are
among the most abundant proteins present in the cell
wall of higher plants. Gene expression of HRGPs is
developmentally regulated in a tissue-specific manner (Ye and Varner, 1991). For example, the tobacco
HRGPnt3 gene is specifically expressed in a subset of
the pericycle and endodermal cells from which a
lateral root initiates (Keller and Lamb, 1989). A soybean (Glycine max) extensin gene, SbHRGP3, is expressed in hypocotyl and roots of seedlings (Ahn et
al., 1996). This was shown by using an SbHRGP3
promoter-GUS chimeric gene that was expressed in
the rhizodermal cells of the zone from which the
lateral root was to be initiated. mRNAs of extensinlike proteins recently have been shown to be highly
abundant in root hairs of tomato and cowpea (Vigna
unguiculata; Arsenijevic-Maksimovic et al., 1997;
Bucher et al., 1997). HRGPs are subject to extensive
posttranslational modification. Pro residues are hydroxylated by prolyl hydroxylase. Carbohydrates
subsequently are attached to the Hyp residues and
probably serve to stabilize the protein into a rigid
rod-like structure (Showalter, 1993). The mature extensin protein is generally rich in Hyp and Ser and
some combination of the amino acids Tyr, Lys, Val,
and His. Extensins of dicot plants usually contain the
repeating pentapeptide Ser-Hyp4, often within the
context of other larger repeating motifs. Isodityrosine
linkages that are presumably formed by peroxidases
(Schnabelrauch et al., 1996) have been suggested to
cross-link extensins in the cell wall, thus leading to
insolubilization of the proteins and cell wall strengthening, e.g. as a response to pathogen attack (Epstein
and Lamport, 1984; Brisson et al., 1994) or to confer
mechanical resistance to load-bearing cells (Keller
and Lamb, 1989; Tiré et al., 1994).
In this study, we describe LeExt1 (accession no.
AJ417830), a novel gene encoding an extensin-like
protein in tomato. Its expression correlates with tip
growth, which suggests a role of the LeExt1 protein
in root hair expansion. Moreover, comparative studies of four different transgenic plant species expressing an LeExt1/GUS chimeric gene indicate the existence of common mechanisms involved in the
regulation of apical/basal polarity in root gene
expression.
912
RESULTS
LeExt1 Encodes a Putative Cell Wall Protein from Tomato
The LeExt1 cDNA was identified in the course of a
differential screening of a tomato root hair-specific
cDNA library, which was set up to identify root
hair-specific genes (Bucher et al., 1997). The cDNA is
1,419 bp long, including a putative initiator ATG at
its 5⬘ end and a poly(A⫹) tail. The deduced amino
acid sequence revealed the repetitive nature of the
Figure 1. Peptide structure of LeExt1 and genomic DNA gel-blot
analysis. A, Deduced LeExt1 amino acid sequence. Repetitive amino
acid units (indicated in bold) are arranged to emphasize various
amino acid repeat units and their periodicity. The signal peptide is
underlined and the putative cleavage site is marked with an arrow. B,
Hydropathy plot of LeExt1 polypeptide. Hydrophilicity and hydrophobicity values are indicated at left. C, Genomic DNA was digested
with the designated restriction enzymes. The LeExt1 cDNA was used
as a radioactive probe. The positions of DNA marker fragments and
their lengths in kb are indicated at left.
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
LeExt1 Expression in Root Hairs
polypeptide (Fig. 1A). Hydropathy analysis (Kyte
and Doolittle, 1982) indicated that the encoded protein is hydrophilic, carrying a hydrophobic Nterminal leader sequence (Fig. 1B). The hydrophobic
segment at the N terminus has the characteristics
typical of a signal peptide for translocation into the
endoplasmic reticulum, and based on the rules of von
Heijne (1986), the cleavage site is located carboxyterminal of an Ala (marked with an arrow in Fig. 1A).
The predicted mature protein consists of 385 amino
acids and has a predicted molecular mass of 42.2 kD
and a calculated pI of 9.2. Assuming that cleavage
does occur after the designated Ala, mature LeExt1
extending from amino acids 28 through 385 is rich in
Lys (19%), Ser (14%), Pro (14%), Tyr (12%), Glu
(10%), and Val (8%). Thus, these seven amino acids
together comprise 77 mol % of the protein. Similar
to other HRGPs the polypeptide is composed of
several repeating motifs rich in Lys, Tyr, Pro, and
Ser (Fig. 1A).
A sequence similarity search through the GenEMBL database revealed highest similarities of LeExt1 to the published Dif10 and Dif54 extensin-like
proteins from tomato root hairs (Bucher et al., 1997),
to an Arabidopsis periaxin-like protein (accession no.
CAB89377) exhibiting similarity to periaxin from rat
(Rattus norvegicus) (Gillespie et al., 1994), and to the
marine mussel (Mytilus edulis) polyphenolic adhesive
protein (Filpula et al., 1990). Expect (E) values according to the BLAST search results were 8e⫺20,
20e⫺15, 3e⫺14, and 9e⫺13, respectively (an E value of 1
meaning that in a database of the current size, one
might expect to see one match with a similar score
simply by chance). All these proteins are rich in at
least some of the amino acids Tyr, Pro, Lys, Ser, Val,
and Glu. Comparison with both Dif10 and Dif54
extensin-like proteins revealed that specifically
spaced repetitive elements contribute to the sequence
similarity rather than identity across a large region of
LeExt1 that is similar with the compared proteins
(Fig. 2). These elements are characterized by the following di-, tri-, and pentapeptides: YK, PS, YYK, and
YY/F/KKS/K/AP, where bold faced letters in the
latter designate conserved amino acids in the oneletter code.
To get an indication of the number of related genes
in the tomato genome, genomic DNA was digested
with four different restriction enzymes of which
EcoRI, EcoRV, and HindIII do not cut within the
cDNA sequence, and the restricted DNA was subjected to genomic DNA gel-blot analysis (Fig. 1C).
The radioactively labeled LeExt1 cDNA hybridized to
up to five DNA fragments under stringent conditions, thus suggesting the existence of a small multigene family of the corresponding gene in tomato.
This was substantiated by the cloning of two ␭-clones
with high similarity to the LeExt1 cDNA sequence
(see below). These results qualify LeExt1 as a novel
Plant Physiol. Vol. 128, 2002
Figure 2. Alignment of the deduced amino acid sequence of LeExt1
with that of Dif10 and Dif54. Identical amino acids are shaded in
black, similar amino acids are shaded in gray. The conserved pentapeptides YxKxP and SPPPP are underlined.
extensin-like protein that is most likely localized in
the cell wall.
LeExt1 Transcripts Accumulate in Rhizodermal Cells
The radioactively labeled LeExt1 cDNA was used
for the analysis of corresponding transcript levels. It
hybridized to a single band of 1.4 kb on the RNA gel
blot (Fig. 3, A and B). Transcript levels were severalfold higher in root hairs as compared with primary
roots with their hairs stripped off (designated
stripped roots; Fig. 3A). No signals were detected in
the hypocotyl, the cotyledons, and leaves. As a control, Rpl2 transcripts (encoding ribosomal protein L2)
were detectable in all organs. Rpl2 is a relatively
well-characterized housekeeping gene that should
reflect constitutive expression (Fleming et al., 1993).
Its expression fluctuated somewhat between samples, probably representing different translational activities in the respective tissues. Thus, the results
indicated high abundance of LeExt1 mRNA in root
hairs of the tomato seedling.
To investigate whether LeExt1 is expressed in shoot
organs of tomato at later stages in development, total
RNA from various organs of soil-grown plants from
the greenhouse was run on a gel (Fig. 3B). No transcripts of the gene were detected in these organs,
whereas Rpl2 mRNA was detectable in all lanes on
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
913
Bucher et al.
Figure 3. LeExt1 transcript abundance in seedlings and flowering
plants. A, RNA gel-blot analysis was performed with 5 ␮g of total
RNA from seedling root hairs, stripped roots, hypocotyls, cotyledons,
and mature leaves and hybridized with randomly labeled cDNA
probes, as indicated at left. A cDNA encoding 25S rDNA from
tomato served as a control for equal loading of total RNA on the gel
and equal transfer to the membrane. Transcript sizes are indicated at
right. B, RNA gel-blot analysis was performed with 5 ␮g of total RNA
from stripped seedling roots and root hairs, and with 10 ␮g of total
RNA from the organs indicated and hybridized with randomly labeled cDNA probes, as indicated at left. Transcript sizes are indicated at right.
the blot. No signal was detectable with RNA from
roots of soil-grown plants (lane 3). This can be explained by the microscopic observation that removal
by careful washing of soil particles bound to the roots
before RNA extraction also removed the root hairs.
Thus, RNA gel-blot analysis clearly indicated rootspecific expression of LeExt1 in tomato roots with
preferential expression in root hairs.
In situ hybridization studies further allowed cellspecific localization of LeExt1 mRNA in tomato primary roots (Fig. 4). LeExt1 transcripts were exclusively detected in rhizodermal cells in the
differentiation zone (Fig. 4, A and B). No signals were
observed in root cap, meristematic, and elongating
cells at the root tip. Sense RNA as a hybridizing
probe did not give rise to a signal (Fig. 4C), and Rpl2
transcripts were abundant in all cells (Fig. 4D). In
general, staining occurred in vacuolated rhizodermal
cells adjacent to the elongation zone of young seedling roots. Thus, high LeExt1 transcript abundance
correlates with differentiation of rhizodermal cells.
914
Figure 4. Localization of LeExt1 transcripts in tomato seedling roots.
A through D, Bright-field microscopy of root sections. Shown in A
and B are sections hybridized with the LeExt1 antisense probe. The
purple dye reflects LeExt1 mRNA. C, Section hybridized with the
LeExt1 sense probe as a negative control. D, Section hybridized with
an antisense Rpl2 probe as a positive control. Bar ⫽ 0.25 mm in A
through C; bar ⫽ 0.125 mm in D.
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
LeExt1 Expression in Root Hairs
Cloning of the LeExt1 Promoter
To allow a more thorough study of LeExt1 gene
expression, we isolated a ␭-clone of 3,417 bp from a
tomato genomic library. The sequence determined
had an identical overlap at its 3⬘ end with 204 bp of
the 5⬘ end of the LeExt1 cDNA (Fig. 5) and thus was
assumed to contain the LeExt1 promoter. Two additional clones were partially sequenced and exhibited
⬎80% sequence similarity to the LeExt1 cDNA (data
not shown). Sequence comparison of the putative
LeExt1 promoter-containing fragment with the respective cDNA revealed a stop codon upstream of
the putative initiator ATG. Approximately 80 bp
upstream of the putative start ATG, the sequence
TATATAAA resembling a TATA box is present. A
search for transcription factor-binding sites using
the TFSEARCH algorhithm with a threshold score
of greater than 85 revealed that the 3,181 bp upstream of the LeExt1 ORF contained the conserved
motifs of Athb-1-, MYB.Ph3-, P-, and SBF-1-binding
boxes (Fig. 5).
Tobacco and tomato plants transformed with the
full promoter sequence fused to the GUS gene did
not produce visible GUS staining (data not shown).
This led us to speculate that silencing protein factors
binding to any of the promoter regions might lead to
GUS supression. Next, exact translational fusions at
the initiator ATG were constructed between the GUS
reporter gene and serial deletions of the LeExt1 pro-
Figure 5. Upstream sequence of the LeExt1 gene. Bold letters underlined with dashed arrows indicate putative binding sites of transcription factors P, MYB.Ph3, SBF-1, and Athb-1 as determined using
TFSEARCH. Bold arrows on top of a base indicate the start of the
different promoter fragments as indicated to the right. The TATA box
is underlined and indicated in bold. An asterisk indicates a stop
codon upstream of the open reading frame (ORF) in the genomic
sequence. Amino acids encoded by the ORF are given in the one
letter code. Bold letters designate the N terminus of the LeExt1
protein.
Plant Physiol. Vol. 128, 2002
Figure 6. Qualitative GUS assay in ⌬gen/GUS tobacco plants. A,
Schematic drawing of the constructs used. The drawing is to scale.
Negative numbers indicate the length of the promoter fragments.
NcoI designates the fusion site at the ATG of the GUS gene. NOS is
the nopaline synthase transcriptional terminator. Bold lines indicate
vector sequence. B, Visual evaluation of GUS staining in roots of T0
lines, containing the promoter constructs as indicated in A. The
number of independently transformed lines exhibiting strong GUS
staining is listed. The total number of lines analyzed is given in
parentheses.
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
915
Bucher et al.
Figure 7. Histochemical localization of GUS
activity in germinating tomato seeds and pollen.
Tomato plants were transformed with the
⌬gen1.1/GUS construct. A through C, F1 seeds
at various stages of germination assayed for GUS
activity. D and E, Pollen harvested from dehisced anthers and germinated in vitro. Bar in A
through C ⫽ 1 mm; bar in D ⫽ 0.1 mm; bar in
E ⫽ 0.01 mm.
moter sequence (Fig. 6A). Transgenic tobacco plants
were raised and the level of GUS activity in roots of
at least 15 independent lines that had been transformed with each of the constructs shown in Figure 6
was microscopically estimated. This analysis revealed strong GUS staining in 75% of the lines transformed with the ⌬gen1.1/GUS gene (Fig. 6B). Roots
carrying the longer ⌬gen1.7 and ⌬gen2.2 fragments,
respectively, hardly stained blue and roots carrying
the two shorter fragments ⌬gen0.9 and ⌬gen0.6 exhibited weaker staining. In F1 tobacco seedlings,
strong GUS expression was detectable in young regions of the root including the root hairs and to lower
degrees in the hypocotyl, petioles, and the margin of
leaf blades. GUS was normally absent from the root
tip. Plants showing GUS staining in root hairs also
gave rise to GUS activity in dry pollen and germinating pollen tubes (data not shown). No changes in
developmental regulation of the GUS expression
driven by the different promoters were observed, i.e.
the spatial pattern of expression was the same.
Tissue Specificity of LeExt1 Expression
The generation of deletions of the ␭-clone proved
to be essential to assay histochemical GUS expression
in more details and the ⌬gen1.1 fragment was selected as the strongest promoter for further studies.
The ⌬gen1.1/GUS chimeric gene was then intro916
duced into tomato, potato, and Arabidopsis. Similar
to the situation in tobacco, GUS staining was absent
from the emerging radicle in germinating tomato
seedlings (Fig. 7A). Whereas expression of the GUS
gene was readily detectable in the region where root
hairs were being formed (Fig. 7B), there was no expression in the root tip and the hypocotyl (Fig. 7C).
The pattern of gene expression of the chimeric gene
thus corresponded to the pattern of mRNA distribution (Fig. 4). Similar to tobacco, GUS expression was
observed in dry pollen and the germinating pollen
tube of tomato (Fig. 7, D and E) and potato, but not
in Arabidopsis pollen (data not shown). In contrast to
⌬gen1.1 promoter activity in pollen, RNA gel-blot
analysis using 30 ␮g of total RNA from tomato anthers and the LeExt1 cDNA as a probe did not result
in detectable signals. Reverse transcription (RT)-PCR
failed to detect significant LeExt1 transcript concentrations in anthers and leaves, whereas a strong signal was obtained with RNA extracted from either
wild-type roots or leaves from transgenic tomato
plants constitutively expressing LeExt1 (Fig. 8). Used
as a positive control, Rpl2 transcripts were abundant
in all organs investigated. Non-reverse transcribed
template RNA did not give rise to detectable signals
on the blot. This demonstrated negligible relative
abundance of LeExt1 mRNA in pollen and leaf as
compared with the root, indicating that the endogenous LeExt1 gene is not or only very weakly ex-
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
LeExt1 Expression in Root Hairs
are similar in different plant species. The regulation
of rhizodermis-specific expression is conserved
within the solanaceous species (and M. truncatula),
whereas absence of rhizodermis-specific expression
correlates with absence of expression in tip-growing
pollen in Arabidopsis.
Trichoblast-Specific Expression of
LeExt1 in the Rhizodermis
Figure 8. Comparison of LeExt1 and Rpl2 transcript levels in tomato
tissues by RT-PCR. RT-PCR was performed with total RNA from roots,
leaves, and anthers and hybridized with randomly labeled cDNA
probes, as indicated at left. RNA from leaves of transgenic plants
constitutively expressing LeExt1 served as a control for primer specificity (control). RNA samples that were not subjected to reverse
transcription (⫺rt) served as a control to determine residual amounts
of genomic DNA in the samples (absent in ⫺rt treatments). Black
columns indicate relative abundance of transcripts as determined by
phosphorimager analysis. The signal for root RNA was arbitrarily set
to 100%.
pressed in pollen. Root specificity of the promoter in
vegetative organs was conserved between tomato,
potato, and Arabidopsis (Fig. 9, A–C). In all three
species, GUS staining was absent from developing
cells at the primary root tip and was initiated at the
distal end of the differentiation zone where hairs
were being formed (Fig. 9, D–F). The same staining
pattern was observed in lateral roots. The indigo dye
never accumulated in cells above the root/hypocotyl
junction. Cross sections of GUS-stained roots revealed rhizodermis-specific expression in the two
solanaceous species, whereas in Arabidopsis, GUS
activity was detectable in rhizodermal cells, in the
cortex including the endodermis, and in the stele
(Fig. 9, G–I). Rhizodermis specificity was also observed in hairy roots of Medicago truncatula after inoculation with Agrobacterium rhizogenes that were
transformed with a binary vector carrying the
⌬gen1.1/GUS chimeric gene (R. Geurts, personal
communication; data not shown). Therefore, we conclude that the regulatory mechanisms that control the
apical/basal polarity of ⌬gen1.1 promoter activity
Plant Physiol. Vol. 128, 2002
The plant hormones ethylene and auxin have been
reported to affect the production of root hair and
hairless cells in the Arabidopsis root (Masucci and
Schiefelbein, 1996). We examined the influence of
auxin and ethylene on tomato root development and
⌬gen1.1/GUS expression. Root exposure to auxin
and auxin transport inhibitors gave rise to shorter
roots, but no clear difference in root hair length or
intensity of GUS staining was observed when compared with controls (data not shown). Exposure to
l-␣-(2-aminoethoxyvinyl)Gly (AVG), an inhibitor of
ethylene synthesis, reduced root elongation (data not
shown) and inhibited root hair development in tomato primary roots, thus giving rise to the formation
of atrichoblasts as was determined by microscopical
analysis (Fig. 10B). GUS staining in these roots was
absent from atrichoblasts and was only observed in
trichoblasts with hairs being formed before or shortly
after the transfer to AVG-containing medium,
whereas untreated roots expressed the GUS gene in
all rhizodermal cells (Fig. 10A). Upon exposure to the
ethylene-releasing agent ethephon in the medium,
root hairs were ectopically induced near the root tip
of controls and in the hair-free zone of AVG-treated
roots. These ectopic hairs uniformly expressed GUS
(Fig. 10C). LeExt1 promoter-driven GUS expression
remained unchanged after infection of transgenic
potato roots with either Phytophtora spp. or arbuscular-mycorrhizal fungi (V. Karandashov, personal
communication; data not shown). Tomato var. Moneymaker lines expressing the LeExt1 cDNA under
the control of the 35S CaMV constitutive promoter
were raised. Plants constitutively expressing the
transgene as shown by RNA gel-blot analysis (data
not shown, see also Fig. 8) were further investigated
for visible phenotypes. All phenotypic parameters
analyzed, including root and root cell expansion,
shoot growth, leaf epidermal cell expansion, and pollen tube growth, remained unchanged in comparison
with wild type (data not shown). Moreover, constitutive expression of LeExt1 in the roots did not mediate an increased resistance to root nematodes (D.
Trudgill, personal communication; data not shown).
Thus, overall we can conclude that LeExt1 expression
correlated with root hair formation and hair expansion and is most likely not involved in pathogen
defense.
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
917
Bucher et al.
Figure 9. Histochemical localization of GUS activity in transgenic tomato, potato, and Arabidopsis. A, D, and G, Expression
of the ⌬gen1.1/GUS chimeric gene in seedlings of tomato; B, E, and H, potato; C, F, and I, Arabidopsis. D through F,
Stereomicroscopy images of GUS-stained root tips. G through I, Bright-field microscopy images of resin-imbedded cross
sections of stained roots using Nomarski optics. Bar in A and B ⫽ 2 mm; bar in C ⫽ 1 mm; bar in D and E ⫽ 0.5 mm; bar
in F ⫽ 0.2 mm; bar in G through I ⫽ 0.05 mm.
DISCUSSION
In this study, the tomato LeExt1 cDNA was cloned
via differential screening of a root hair-specific cDNA
library. The corresponding upstream genomic sequence was subsequently obtained from a genomic
tomato library screen. RNA localization and
promoter-GUS fusion studies in tomato primary
roots revealed that LeExt1 expression is associated
with root hair formation and elongation and is controlled by ethylene. The tissue specificity of the promoter in roots was conserved in three solanaceous
species, whereas in Arabidopsis, GUS expression was
detectable in all differentiated root cells. Ectopic expression of LeExt1 in cells other than root hairs is not
918
sufficient to phenotypically change cell shape or
elongation.
In our efforts to clone the LeExt1 promoter, we
have encountered the problem that the longer
genomic fragments did not give rise to strong GUS
expression in the roots, which might be because of
silencer elements within these sequences (Figs. 5
and 6). Transformation of tobacco with truncated
versions of the ␭-clone fused to GUS has allowed us
to perform GUS assays with roots from primary
transformants (Fig. 6) and subsequent selection of
the ⌬gen1.1 fragment as the qualitatively strongest
promoter for transformation of tomato, potato, and
Arabidopsis.
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
LeExt1 Expression in Root Hairs
All rhizodermal cells in tomato may form a hair.
These cells are long and because many are hairless,
the hairs appear to be sparsely distributed over the
whole surface. Hairs are more densely developed for
a short distance close to the tip. In this region, the
cells are much shorter than those developed later and
almost every cell forms a long hair (Cormack, 1945).
Both in situ hybridization (Fig. 4) and promoter-GUS
analysis with tomato seedling roots (Fig. 7) indicated
that LeExt1 expression is absent from the root tip,
strongly induced in the root hair zone, and remained
high proximally to the root-hypocotyl junction. This
tip-to-base polarity of ⌬gen1.1/GUS expression in
the root is maintained between the different plant
species (Fig. 9), which indicates the existence of common regulatory mechanisms determining apical/
basal polarity of gene expression in vascular plants.
The tight correlation between LeExt1 expression and
root hair development (Figs. 7, 9, and 10) indicates
that expression of LeExt1 is regulated by developmental pathways involved in root hair formation. A
key player in this regulatory network is the plant
hormone ethylene, which strongly promotes root
hair development in tomato (Fig. 10) and other
plants. Therefore, it is likely that regulatory proteins
that are involved in epidermal cell patterning direct
root hair-specific gene expression of structural cell
wall proteins such as LeExt1 at later stages of tomato
epidermis development during hair expansion. Consistent with our results from Figure 10, the hormone
ethylene would then act downstream of such regulators to promote LeExt1 expression and root hair outgrowth in tomato. A similar regulatory pathway recently has been suggested for the expression of the
Arabidopsis Pro-rich protein AtPRP3 (Bernhardt and
Tierney, 2000).
In a search for transcription factor-binding sites in
the LeExt1 promoter, putative binding sites for four
regulatory proteins were displayed (Fig. 5). Three of
them, P, MYB.Ph3, and SBF-1, are involved in flavonoid biosynthesis (Lawton et al., 1991; Grotewold
et al., 1994; Solano et al., 1995). Some regulatory
genes are known to affect several independent phenotypes in Arabidopsis. For example, the TTG protein not only regulates the accumulation of purple
anthocyanins in leaves and stems but also trichome
and root hair development (Walker et al., 1999). The
fourth protein putatively binding to the LeExt1 promoter is Athb1, which, like the transcription factor
GL2, is a member of the large homeodomain-Leu
zipper protein family of Arabidopsis (Sessa et al.,
1993). GL2 and several MYB transcription factors are
required for regulation of root hair development (DiCristina et al., 1996; Lee and Schiefelbein, 1999).
Thus, it is tempting to speculate that regulatory proteins may coordinately regulate root hair development and LeExt1 expression in tomato.
All plant species displaying root hair-specific GUS
activity also exhibited GUS staining in pollen and
Plant Physiol. Vol. 128, 2002
Figure 10. Modulation of ethylene biosynthesis and root hair development. A, ⌬gen1.1/GUS tomato seeds were germinated on control
medium. At a primary root length of 3 to 5 mm, control seedlings
were transferred to fresh medium for 2 d before GUS activity was
assayed. B, Seedling root grown in presence of 20 ␮M AVG and
stained for GUS activity after pretreatment as described in A.
C, Ectopic root hairs 2 d after transfer to medium containing AVG
and 1 mM ethephon. Bar in A ⫽ 1 mm; bar in B ⫽ 0.5 mm; bar in
C ⫽ 0.2 mm.
germinating pollen tubes (Fig. 7). A similar staining
pattern was observed with the shorter fragments
⌬gen0.9 and ⌬gen0.6, although at lower intensities
(data not shown). These results show that the
⌬gen1.1 promoter activity is correlated with cellular
tip growth rather than specifically with root hair
expansion. In contrast to the GUS expression data,
we were unable to detect LeExt1 mRNA in pollen
(Fig. 8), probably because of rapid degradation of
LeExt1 mRNA or suppression of the endogenous
gene in pollen. The LeExt1 promoter analysis suggests that transcriptional regulators exist in plants
that direct the expression of specific genes in tipgrowing cells. The absence of a similar regulation of
GUS expression in Arabidopsis (Fig. 9) may be because of the fact that the corresponding regulatory
proteins in Arabidopsis do not interact with the tomato ⌬gen1.1 promoter fragment. In the future, the
LeExt1 promoter will serve as an essential tool in
attempts to modify root hair gene expression in solanaceous species.
LeExt1 encodes a novel extensin-like protein that
belongs to a small multigene family (Fig. 1). The
protein shares high similarity with the two recently
identified two-domain extensin-like proteins Dif10
and Dif54 from tomato because of the presence of
repetitive elements contributing to the sequence similarity (Fig. 2). The Ser-Pro4 motif is usually abundant
in extensins and seems to be significant for the structure (Cassab, 1998). In contrast to Dif10 and Dif54,
which contain eight and five Ser-Pro3-6 domains in
their C-terminal part, respectively (Bucher et al.,
1997), LeExt1 contains a single Ser-Pro5 domain at the
C terminus (Figs. 1A and 2). A putative N-terminal
signal peptide for translocation into the endoplasmic
reticulum indicates that LeExt1 is secreted into the
apoplast and thus may play a role in determining
physicochemical characteristics of the root hair cell
wall. Cell wall strength, rigidity, and extensibility are
critical factors determining tip growth of a root hair.
Memelink et al. (1993) reported on the overexpression and antisense repression of a tobacco extensin
that did not result in an altered phenotype in trans-
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
919
Bucher et al.
genic plants, although the encoded protein constituted the majority of HRGPs in roots, stems, and
leaves. Thus, despite the large number of cloned
extensins, the function(s) of single extensin genes are
still elusive. Constitutive overexpression of LeExt1 in
transgenic tomato failed to give conclusive results on
the function of the protein. Thus, the biological role
of LeExt1 remains to be determined. Downregulation strategies for LeExt1 gene expression may
shed more light on LeExt1 function in the future.
MATERIALS AND METHODS
Plant Growth Conditions
Various organs were collected from flowering tomato (Lycopersicon esculentum var. Moneymaker) plants grown in soil in the
greenhouse and were used for RNA extraction. Tomato seedlings
used for root hair isolation were grown as described (Bucher et al.,
1997). Seeds were rinsed in 70% (v/v) ethanol, washed in 1.4%
(v/v) bleach with Triton X-100, and finally thoroughly washed
with sterile water. Tomato seedling roots were used for in situ
hybridization or GUS staining, and were grown on filter paper that
had been soaked in one-half-strength Hoagland solution under
sterile conditions in petri dishes. Potato plantlets and tomato
seedlings were grown in vertically oriented petri dishes on
Murashige and Skoog medium (Murashige and Skoog, 1962) with
2% (w/v) Suc and 1% (w/v) agarose. Arabidopsis seedlings were
grown on Murashige and Skoog medium, pH 5.8, 1% (w/v) Suc,
and 1.2% (w/v) agarose. After incubation of the seeds in the dark
at 4°C for 2 to 4 d, the seedlings were grown in a vertical orientation in a plant tissue culture incubator (Forma Scientific, Inc.,
Brouwer AG, Luzern, Switzerland). For the in vitro pollen tube
assay, pollen was collected from LeExt1 promoter/GUS transgenic
lines and allowed to germinate in germination medium {292 mm
Suc, 1 g L⫺1 [w/v] casein hydrolysate [Difco, Chemie Brunschwig
AG, Basel], 213.25 mm MES [2-(N-morpholino)-ethanesulfonic
acid]-KOH, pH 5.9, 1 mm CaCl2, 1 mm KCl, 0.8 mm MgSO4, 30 ␮m
CuSO4, and 1.6 mm H3BO4}.
To investigate the influence of AVG and ethylene on LeExt1
expression, tomato seedlings containing the ⌬gen1.1/GUS construct were first grown on 2⫻ Murashige and Skoog medium (2%
[w/v] Suc). At a primary root length of 3 to 5 mm, seedlings were
transferred to medium containing 20 ␮m AVG (Sigma, Buchs,
Switzerland) for an additional 2 d before GUS activity was assayed. Alternatively, the seeds were germinated on plates containing 2⫻ Murashige and Skoog medium supplemented with 50 ␮m
AVG for 2 d before they were transferred to medium containing
AVG and 1 mm 2-chloroethyl-phosphonic acid (ethephon, Sigma).
GUS activity was assayed between 1 and 2 d later after an additional growth of about 1 cm.
For the analysis of LeExt1 overexpression in tomato, the expansion of root, root hair, and leaf epidermal cell was microscopically
investigated using seedling roots and epidermal strips from the
abaxial side of tomato cotyledons and leaves from greenhousegrown transgenic plants that were shown to constitutively express
LeExt1 via RNA gel-blot analysis (data not shown). Pollen tube
growth was evaluated microscopically with pollen from homozygous transgenic plants germinated for 4 h in germination medium
(see above).
Plasmids, Gene Constructs, and Plant Transformation
A differential screen of a root hair-specific cDNA library led to
the isolation of LeExt1 cDNA in the plasmid pBluescript SK⫺
920
(Stratagene, Amsterdam; Bucher et al., 1997). This cDNA then was
used to screen a tomato genomic DNA library (CLONTECH Laboratories, Heidelberg) according to standard protocols (Sambrook
et al., 1989). ␭-DNA was prepared according to Locket (1990). A
genomic DNA fragment of about 3.4 kb in length was isolated and
cloned into pBluescript SK⫺. Sequencing was performed using T7
DNA polymerase and revealed a 204-bp overlap of the genomic
fragment with the 5⬘ end of the LeExt1 cDNA sequence and extension into the 5⬘-upstream non-coding region of the LeExt1 gene.
PCR-directed amplification using Pyrococcus furiosus DNA polymerase (Stratagene) yielded a 3.3-kb genomic fragment that was
finally cloned into pBluescript SK⫺. Serial deletions with exonuclease III and S1 nuclease according to the manufacturer’s protocol
(Fermentas, Vilnius. Lithuania) finally yielded five fragments of
approximately 2.2, 1.7, 1.1, 0.9, and 0.6 kb, respectively. These
fragments were subsequently named ⌬genx, where x represents
the approximate length of the fragments as listed above. Each of
these five fragments was then cloned with an exact fusion at the
putative initiator ATG of the LeExt1 gene to the GUS marker gene
(Jefferson et al., 1987), flanked by the nos 3⬘ terminator (Depicker
et al., 1982) into the binary vector Bin19 (Bevan, 1984). To construct
the chimeric LeExt1 gene for overexpression in tomato under the
contol of the 35S cauliflower mosaic virus constitutive promoter,
the SmaI-BamHI LeExt1 cDNA insert was inserted in its forward
orientation into the EcoRV-BamHI sites of a plant expression cassette containing the 35S cauliflower mosaic virus promoter and the
T-DNA octopine synthase gene terminator in the binary vector
Bin19 (Franck et al., 1980; Bevan, 1984; Gielen et al., 1984). These
constructs were then introduced in Agrobacterium tumefaciens strain
C58C1 containing the pGV2260 plasmid (Deblaere et al., 1985) via
electroporation. Transformation of tobacco var. Samsun, the miniature tomato cv Micro-Tom (Meissner et al., 1997) and tomato cv
Moneymaker, and potato var. Désirée was performed using A.
tumefaciens-directed gene transfer essentially as described by
Rosahl et al. (1987) for tobacco, by Fillatti et al. (1987) for tomato,
and by Rocha-Sosa et al. (1989) for potato. Arabidopsis ecotype
C24 was transformed using the in planta transformation method
(Bechtold and Pelletier, 1993; Katavic et al., 1994).
Computational Analysis
Sequence analysis was performed by using the Genetics Computer Group software package (Madison, WI; Devreux et al., 1984).
The hydropathy analysis was performed according to Kyte and
Doolittle (1982) with a window of nine amino acids. TFSEARCH
(vers. 1.3) was used to search for putative transcription factorbinding sites (Heinemeyer et al., 1998). The program is available at
http://pdap1.trc.rwcp.or.jp/research/db/TFSEARCH.html. Multiple sequence alignment was done using ClustalW, accessible at
http://circinus.ebi.ac.uk:6543/cgi-bin/clustalw.cgi. Pretty printing
and shading of multiple alignment files was done using Boxshade
3.21 at http://www.ch.embnet.org/software/BOX_form.html.
Gel-Blot Analysis
Genomic DNA and RNA gel-blot analysis were performed as
described (Bucher et al., 1997).
RT-PCR
RT-PCR was done according to Borner et al. (2000). Reverse
transcription using Superscript II RT (Gibco, Bascel) was performed with 1 ␮g of total RNA, which was extracted as described
previously (Bucher et al., 1997). A 335-bp LeExt1 fragment was
then amplified by PCR from the cDNA library using the oligonu-
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
LeExt1 Expression in Root Hairs
cleotides AATCCAATTCTTCTCAATGGGAAGC and GCTTCTTGTAGTAGTCATTCTTTGG. As a control, a 432-bp Rpl2 fragment
was amplified using the oligonucleotides GAGAGGTGCACCACTTGCGC and GGCCAGCAGTTCCTCTTCAC. All PCR reactions were performed with 40 cycles. As a negative control, PCR
reactions were performed with non-reverse transcribed total RNA
to exclude fragment amplification because of the presence of
genomic DNA in the samples. Fragments were separated on an
agarose gel, blotted to a membrane, and hybridized with either
radiolabeled LeExt1 or Rpl2 cDNA, respectively.
In Situ Hybridization
In situ hybridization of RNA was performed with paraffinembedded roots of tomato var. Moneymaker as described earlier
(Daram et al., 1998).
GUS Assay and Histochemical Analysis
Plant material was incubated in 0.1% (w/v) X-Gluc (Biosynth,
Staad, Switzerland) and 0.1% (v/v) Triton X-100 (Fluka Chemie
AG, Buchs, Switzerland) in 0.05 m sodium phosphate buffer, pH
7.2, at 37°C. Methanol was included in the pollen assay at 20%
(v/v), because it was shown to almost completely suppress an
endogenous GUS activity and thus to abolish background staining
in pollen (Kosugi et al., 1990). The stained material was directly
assayed for GUS activity or was fixed in ethanol:acetic acid (3:1,
v/v) overnight at 4°C. Complete removal of chlorophyll from the
tissue was performed in 100% ethanol. Samples were then embedded in Technovit 7100 (Kulzer, Wehrheim, Germany) and 5-␮mthick sections were mounted on glass slides. The indigo precipitate
was visualized using a stereomicroscope (Olympus SZX12, Olympus Optical Schweiz AG, Volketswil, Switzerland) or by light
microscopy (Olympus AZ70) in combination with Nomarski optics
(GUS activity appears indigo blue).
ACKNOWLEDGMENTS
We thank Dr. Claus Frohberg (PlantTec Biotechnology,
Potsdam, Germany) for primary analysis of ⌬gen1.1/GUS
potato plants and valuable discussions; Romy Ackermann
and Dr. Babette Regierer (Max-Planck-Institute of Molecular Plant Physiology, Potsdam) for Arabidopsis transformation and initial analysis; Drs. Vladimir Karandashov
(Institute of Plant Physiology, Russian Academy of Sciences, Moscow) and David Trudgill (Scottish Crop Research Institute, Dundee, Scotland) for Phytophtora spp.,
mycorrhiza, and nematode infection studies; Drs. Rene
Geurts and Ton Bisseling (Wageningen University, The
Netherlands) for promoter/GUS analysis in M. truncatula;
Birgit Schroeer (Max-Planck-Institute of Molecular Plant
Physiology) for her technical support in the root hair promoter project at the Institut für Genbiologische Forschung
(Berlin); and Sabine Klarer and Katalyn Konya for taking
care of the greenhouse plants at ETH (Zurich).
Received November 5, 2001; accepted November 20, 2001.
LITERATURE CITED
Ahn J, Choi Y, Kwon Y, Kim S, Choi Y, Lee J (1996) A
novel extensin gene encoding a hydroxyproline-rich glyPlant Physiol. Vol. 128, 2002
coprotein requires sucrose for its wound-inducible expression in transgenic plants. Plant Cell 8: 1477–1490
Arsenijevic-Maksimovic I, Broughton W, Krause A (1997)
Rhizobia modulate root-hair-specific expression of extensin genes. Mol Plant-Microbe Interact 10: 95–101
Bechtold N, Pelletier G (1993) In planta Agrobacteriummediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CR Acad Sci Ser III Sci Vie 316:
1194–1199
Bernhardt C, Tierney ML (2000) Expression of AtPRP3, a
proline-rich structural cell wall protein from Arabidopsis,
is regulated by cell-type-specific developmental pathways involved in root hair formation. Plant Physiol 122:
705–714
Bevan M (1984) Binary Agrobacterium vectors for plant
transformation. Nucleic Acids Res 12: 8711
Bibikova TN, Blancaflor EB, Gilroy S (1999) Microtubules
regulate tip growth and orientation in root hairs of Arabidopsis thaliana. Plant J 17: 657–665
Borner R, Kampmann G, Chandler J, Gleissner R, Wisman E, Apel K, Melzer S (2000) A MADS domain gene
involved in the transition to flowering in Arabidopsis.
Plant J 24: 591–599
Brisson L, Tenhaken R, Lamb C (1994) Function of oxidative cross-linking of cell wall structural proteins in plant
disease resistance. Plant Cell 6: 1703–1712
Bucher M, Schroeer B, Willmitzer L, Riesmeier JW (1997)
Two genes encoding extensin-like proteins are predominantly expressed in tomato root hair cells. Plant Mol Biol
35: 497–508
Cassab G (1998) Plant cell wall proteins. Annu Rev Plant
Physiol Plant Mol Biol 49: 281–309
Cormack RGH (1945) Cell elongation and the development
of root hairs in tomato roots. Am J Bot 32: 190–196
Daram P, Brunner S, Persson BL, Amrhein N, Bucher M
(1998) Functional analysis and cell-specific expression of
a phosphate transporter from tomato. Planta 206:
225–233
Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J,
Van Montagu M, Leemans J (1985) Efficient octopine Ti
plasmid-derived vectors for Agrobacterium-mediated
gene transfer to plants. Nucleic Acids Res 13: 4777–4788
Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman
HM (1982) Nopaline synthase: transcript mapping and
DNA sequence. J Mol Appl Genet 1: 561–573
Devreux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res 12: 387–395
DiCristina M, Sessa G, Dolan L, Linstead P, Baima S,
Ruberti I, Morelli G (1996) The Arabidopsis Athb-10
(GLABRA2) is an HD-Zip protein required for regulation
of root hair development. Plant J 10: 393–402
Dolan L, Janmaat K, Willemsen V, Linstead P, Poethig S,
Roberts K, Scheres B (1993) Cellular organisation of the
Arabidopsis thaliana root. Development 119: 71–84
Epstein J, Lamport D (1984) An intramolecular linkage
involving isodityrosine in extensin. Phytochemistry 23:
1241–1246
Fillatti J, Kiser J, Rose R, Comai L (1987) Efficient transfer
of a glyphosate tolerance gene into tomato using a binary
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
921
Bucher et al.
Agrobacterium tumefaciens vector. Bio/Technology 5:
726–730
Filpula DR, Lee SM, Link RP, Strausberg SL, Strausberg
RL (1990) Structural and functional repetition in a marine mussel adhesive protein. Biotechnol Prog 6: 171–177
Fleming AJ, Mandel T, Roth I, Kuhlemeier C (1993) The
patterns of gene expression in the tomato shoot apical
meristem. Plant Cell 5: 297–309
Franck A, Guilley H, Jonard G, Richards K, Hirth L (1980)
Nucleotide sequence of Cauliflower Mosaic virus DNA.
Cell 21: 285–294
Galway ME, Masucci JD, Lloyd AM, Walbot V, Davis
RW, Schiefelbein JW (1994) The TTG gene is required to
specify epidermal cell fate and cell patterning in the
Arabidopsis root. Dev Biol 166: 740–754
Gielen J, De Beuckeleer M, Seurinck J, Deboeck F, De
Greve H, Lemmers M, Van Montagu M, Schell J (1984)
The complete nucleotide sequence of the TL-DNA of the
Agrobacterium tumefaciens plasmid pTiAch5. EMBO J 3:
835–846
Gillespie CS, Sherman DL, Blair GE, Brophy PJ (1994)
Periaxin, a novel protein of myelinating Schwann cells
with a possible role in axonal ensheathment. Neuron 12:
497–508
Gilroy I, Jones DL (2000) Through form to function: root
hair development and nutrient uptake. Trends Plant Sci
5: 56–60
Grierson C, Roberts K, Feldmann K, Dolan L (1997) The
COW1 locus of Arabidopsis acts after RHD2, and in parallel with RHD3 and TIP1, to determine the shape, rate of
elongation, and number of root hairs produced from
each site of hair formation. Plant Physiol 115: 981–990
Grotewold E, Drummond BJ, Bowen B, Peterson T (1994)
The myb-homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a
flavonoid biosynthetic gene subset. Cell 76: 543–553
Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel
AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya
OA, Kolpakov FA et al. (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26: 362–367
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS
fusions:␤-glucuronidase as a sensitive and versatile gene
fusion marker in higher plants. EMBO J 3901–3907
Katavic V, Haughn G, Reed D, Martin M, Kunst L (1994)
In planta transformation of Arabidopsis thaliana. Mol Gen
Genet 245: 363–370
Keller B, Lamb CJ (1989) Specific expression of novel cell
wall hydroxyproline-rich glycoprotein genes in lateral
root initiation. Genes Dev 3: 1639–1646
Kosugi S, Ohashi Y, Nakajima K, Arai Y (1990) An improved assay for beta-glucuronidase in transformed
cells: Methanol almost completely suppresses a putative
endogenous beta-glucuronidase activity. Plant Sci 70:
133–140
Kyte J, Doolittle R (1982) A simple method for displaying
the hydropathic character of a protein. J Mol Biol 157:
105–132
Lawton MA, Dean SM, Dron M, Kooter JM, Kragh KM,
Harrison MJ, Yu L, Tanguay L, Dixon RA, Lamb CJ
922
(1991) Silencer region of a chalcone synthase promoter
contains multiple binding sites for a factor, SBF-1, closely
related to GT-1. Plant Mol Biol 16: 235–249
Lee MM, Schiefelbein J (1999) WEREWOLF, a MYBrelated protein in Arabidopsis, is a position-dependent
regulator of epidermal cell patterning. Cell 99: 473–483
Locket TJ (1990) A bacteriophage lambda DNA purification procedure suitable for the analysis of DNA from
either large or multiple small lysates. Anal Biochem 185:
230–234
Masucci J, Schiefelbein J (1994) The rhd6 mutation of
Arabidopsis thaliana alters root-hair initiation through an
auxin- and ethylene-associated process. Plant Physiol
106: 1335–1346
Masucci JD, Schiefelbein JW (1996) Hormones act downstream of TTG and GL2 to promote root hair outgrowth
during epidermis development in the Arabidopsis root.
Plant Cell 8: 1505–1517
Meissner R, Jacobson Y, Melamed S, Levyatuv S, Shalev
G, Ashri A, Elkind Y, Levy A (1997) A new model
system for tomato genetics. Plant J 12: 1465–1472
Memelink J, Swords KM, de Kam RJ, Schilperoort RA,
Hoge JH, Staehelin LA (1993) Structure and regulation
of tobacco extensin. Plant J 4: 1011–1022
Murashige T, Skoog F (1962) A revised medium for rapid
growth and bioassays with tobacco tissue cultures.
Physiol Plant 15: 473–497
Rocha-Sosa M, Sonnewald U, Frommer W, Stratmann M,
Schell J, Willmitzer L (1989) Both developmental and
metabolic signals activate the promoter of a class I patatin gene. EMBO J 8: 23–29
Rosahl S, Schell J, Willmitzer L (1987) Expression of a
tuber-specific storage protein in transgenic tobacco
plants: demonstration of an esterase activity. EMBO J 6:
1155–1159
Ryan E, Grierson C, Cavell A, Steer M, Dolan L (1998)
TIP1 is required for both tip growth and non-tip growth
in Arabidopsis. New Phytol 138: 49–58
Sambrook J, Frisch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor
Press, Cold Spring Harbor, NY
Schiefelbein J, Galway M, Masucci J, Ford S (1993) Pollen
tube and root-hair tip growth is disrupted in a mutant of
Arabidopsis thaliana. Plant Physiol 103: 979–985
Schiefelbein JW, Somerville CR (1990) Genetic control of
root hair development in Arabidopsis thaliana. Plant Cell
2: 235–243
Schnabelrauch LS, Kieliszewski M, Upham BL, Alizedeh
H, Lamport DT (1996) Isolation of pl 4.6 extensin peroxidase from tomato cell suspension cultures and identification of Val-Tyr-Lys as putative intermolecular crosslink site. Plant J 9: 477–489
Schneider K, Mathur J, Boudonck K, Wells B, Dolan L,
Roberts K (1998) The ROOT HAIRLESS 1 gene encodes
a nuclear protein required for root hair initiation in
Arabidopsis. Genes Dev 12: 2013–2021
Schneider K, Wells B, Dolan L, Roberts K (1997) Structural and genetic analysis of epidermal cell differentiation in Arabidopsis primary roots. Development 124:
1789–1798
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
LeExt1 Expression in Root Hairs
Sessa G, Morelli G, Ruberti I (1993) The Athb-1 and -2
HD-Zip domains homodimerize forming complexes
of different DNA binding specificities. EMBO J 12: 3507–
3517
Showalter AM (1993) Structure and function of plant cell
wall proteins. Plant Cell 5: 9–23
Sievers A, Schnepf E (1981) Morphogenesis and polarity of
tubular cells with tip growth. In O Kiermayer, ed, Cell
Biology Monographs, Vol 8. Springer-Verlag, New York,
pp 265–299
Solano R, Nieto C, Avila J, Canas L, Diaz I, Paz-Ares J
(1995) Dual DNA binding specificity of a petal
epidermis-specific MYB transcription factor (MYB.Ph3)
from Petunia hybrida. EMBO J 14: 1773–1784
Tiré C, De Rycke R, De Loose M, Inzé D, Van Montagu
M, Engler G (1994) Extensin gene expression is induced
by mechanical stimuli leading to local cell wall strengthening in Nicotiana plumbaginifolia. Planta 195: 175–181
Plant Physiol. Vol. 128, 2002
von Heijne G (1986) A new method for predicting signal sequence cleavage sites. Nucleic Acids Res 14:
4683–4690
Wada T, Tachibana T, Shimura Y, Okada K (1997) Epidermal cell differentiation in Arabidopsis determined by a
Myb homolog, CPC. Science 277: 1113–1116
Walker AR, Davison PA, Bolognesi-Winfield AC, James
CM, Srinivasan N, Blundell TL, Esch JJ, Marks MD,
Gray JC (1999) The TRANSPARENT TESTA GLABRA1
locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40
repeat protein. Plant Cell 11: 1337–1350
Wymer CL, Bibikova TN, Gilroy S (1997) Cytoplasmic free
calcium distributions during the development of root
hairs of Arabidopsis thaliana. Plant J 12: 427–439
Ye Z-H, Varner J (1991) Tissue-specific expression of cell
wall proteins in developing soybean tissues. Plant Cell 3:
23–37
Downloaded from on June 17, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
923
CORRECTION
Vol. 128: 911–923, 2002
Bucher M., Brunner S., Zimmermann P., Zardi G.I., Amrhein N., Willmitzer L., and
Riesmeier J.W. The Expression of an Extensin-Like Protein Correlates with Cellular Tip
Growth in Tomato.
The first paragraph of the above article should serve as the abstract for this paper.
Plant Physiology, July 2002, Vol. 129, p. 1417, www.plantphysiol.org © 2002 American Society of Plant Biologists
1417