Download Four potato (Solanum tuberosum) ABCG transporters and their

G Model
JPLPH-51322; No. of Pages 9
ARTICLE IN PRESS
Journal of Plant Physiology xxx (2011) xxx–xxx
Contents lists available at SciVerse ScienceDirect
Journal of Plant Physiology
journal homepage: www.elsevier.de/jplph
Four potato (Solanum tuberosum) ABCG transporters and their expression in
response to abiotic factors and Phytophthora infestans infection
Michelina Ruocco a,∗ , Patrizia Ambrosino b , Stefania Lanzuise b , Sheridan Lois Woo b ,
Matteo Lorito b , Felice Scala b
a
b
Istituto per la Protezione delle Piante CNR, Via Università 133, 80055 Portici (NA), Italy
Dipartimento di Arboricoltura Botanica e Patologia vegetale, Via Università 100, 80055 Portici (NA), Italy
a r t i c l e
i n f o
Article history:
Received 3 May 2011
Received in revised form 12 July 2011
Accepted 21 July 2011
Keywords:
Stress response
ABC transporters
Plant–microbe interactions
Potato
Phytophthora infestans
a b s t r a c t
Pleiotropic drug resistant (PDR/ABCG) genes are involved in plant response to biotic and abiotic stresses. In
this work, we cloned, from Solanum tuberosum, four PDR/ABCG transporter genes named StPDR1, StPDR2,
StPDR3 and StPDR4, which were differentially expressed in plant tissues and cell cultures. A number of
different chemically unrelated compounds were found to regulate the transcript levels of the four genes in
cultured cells. In particular, StPDR2 was highly up-regulated in the presence of Botrytis cinerea cell walls,
NaCl, 2,4-dichlorophenol, sclareol and ␣-solanin and biological compounds. The expression of the genes
was also investigated by real time RT-PCR during infection by Phytophthora infestans. StPDR1 and StPDR2
were up-regulated about 13- and 37-fold at 48 h post-infection (hpi), StPDR3 was expressed (4–5-fold) at
24 and 48 hpi and then rapidly decreased, while StPDR4 RNA accumulation was stimulated (about 4-fold)
at 12 and 24 hpi, decreased at 48 hpi and increased again at 96 hpi. We discuss the role of StPDR1–4 genes
in response to pathogens and abiotic stresses.
© 2011 Elsevier GmbH. All rights reserved.
Introduction
The ATP-binding cassette (ABC) transporter superfamily consists of a large group of related proteins whose members have been
implicated in the active movement of a variety of substances across
cellular membranes in organisms ranging from bacteria to man
(Higgins, 2001). These proteins typically contain two core structural
elements: a hydrophobic transmembrane domain (TMD) consisting of multiple membrane spanning segments (usually six), and a
hydrophilic nucleotide binding fold (NBF) containing the Walker A,
Walker B and ABC signature (Rea, 2007; Walker et al., 1982). ABC
transporters have been reported to occur both as “half size,” which
contain of one hydrophobic and one hydrophilic domain, and as
“full size”, with two domains each (Verrier et al., 2008).
Plants have a large number of ABC proteins that may be associated with the movement of a variety of secondary metabolites. In
the absence of a specialized secretor structure, plants need to establish steep concentration gradients to allow the movement of solutes
across cellular membranes (Verrier et al., 2008; Yazaki et al., 2006).
The sequencing of Arabidopsis thaliana and Oryza sativa genomes
led to the identification of more than 120 genes encoding ABC transporters (Garcia et al., 2004; Lee et al., 2005; Sanchez-Fernandez
∗ Corresponding author. Tel.: +39 081 2539337; fax: +39 081 2539339.
E-mail address: [email protected] (M. Ruocco).
et al., 2001), while only 50–70 ABC-proteins have been found in
the genome of humans, fly (Drosophila melanogaster) and worm
(Caenorhabditis elegans) (Rea, 2007).
Because ABC transporters are involved in cellular detoxification,
chlorophyll biosynthesis, stomata opening and closing, they can
play a direct or indirect role in plant growth and developmental
processes (Klein et al., 2004; Luo et al., 2007; Martinoia et al., 2002;
Ticconi et al., 2009; Titapiwatanakun and Murphy, 2009; Zientara
et al., 2009).
Plant ABC proteins are divided into 13 subfamilies on the basis
of protein size (full, half, or quarter molecules), orientation of
TMD and NBF domains, presence or absence of idiotypic transmembrane and/or linker domains, and overall sequence similarity.
Some of the best characterized subfamilies are multidrug resistance
proteins (MDR/ABCB), multidrug resistance-associated proteins
(MRP/ABCC), pleiotropic drug resistance proteins (PDR/ABCG) and
peroxisomal membrane proteins (PMP/ABCD) (for reviews see: Rea,
2007; Sanchez-Fernandez et al., 2001; Verrier et al., 2008).
The PDR/ABCG subfamily is encoded by more than 15 ORFs in
Arabidopsis (Jasinski et al., 2003; Sanchez-Fernandez et al., 2001;
van den Brule and Smart, 2002) and 23 in rice (Crouzet et al.,
2006). Genes encoding for PDR/ABCG homologues have not been
identified in animal and prokaryotes, but only in yeasts, fungi and
plants. Interest in PDR/ABCG transporters has been particularly
stimulated by their involvement in the extrusion of cytotoxic compounds. In fungi, PDR/ABCG transporters have been associated with
0176-1617/$ – see front matter © 2011 Elsevier GmbH. All rights reserved.
doi:10.1016/j.jplph.2011.07.008
Please cite this article in press as: Ruocco M, et al. Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic
factors and Phytophthora infestans infection. J Plant Physiol (2011), doi:10.1016/j.jplph.2011.07.008
G Model
JPLPH-51322; No. of Pages 9
ARTICLE IN PRESS
M. Ruocco et al. / Journal of Plant Physiology xxx (2011) xxx–xxx
2
the acquisition of multiple drug resistance (Del Sorbo et al., 2000;
Schoonbeek et al., 2001), pathogenicity (Fleissner et al., 2002), selfdetoxification and microbial interactions (Ruocco et al., 2009). The
capability of some PDR/ABCG transporters to excrete xenobiotics
(Bauer et al., 1999) has led to the hypothesis that, in plants, they
support detoxification from herbicides, fungicides, as well as the
secretion of defense compounds (Davies and Coleman, 2000; Luo
et al., 2007). However plant PDR/ABCGs have been poorly investigated. Smart and Fleming (1996) cloned and characterized SpTUR2
from the aquatic plant Spirodela polyrrhiza, the first gene encoding a homologue of the yeast PDR5. Its expression was induced by
environmental stresses caused by low temperature, high salinity
and abscissic acid (ABA). Over-expression of SpTUR2 in Arabidopsis confers resistance to the antifungal diterpene sclareol (van den
Brule et al., 2002). Similarly, NpPDR1 (formerly known as NpABC1)
from Nicotiana plumbaginifolia and AtPDR12 from A. thaliana were
involved in the secretion of sclareol (Jasinski et al., 2001; van den
Brule et al., 2002). In general, the expression of plant PDR/ABCGs is
promoted by: cycloheximide, brassinolides, herbicides, high salinity, heavy metals (cadmium and zinc), hypoxic stress, jasmonates,
auxins, cytokinins, iron starvation and a wide range of microbial
elicitors (Ruzicka et al., 2010; Sasabe et al., 2002). Stein et al. (2006)
demonstrated that the A. thaliana PEN3/PDR8 gene contributes to
non-host resistance against pathogens attempting direct penetration.
In the present paper, we describe the cloning and functional
characterization of four PDR/ABCG transporter genes from Solanum
tuberosum, named StPDR1, StPDR2, StPDR3 and StPDR4. These are
the first ABCG genes reported in potato. We provide evidence indicating that they are involved in the response to treatments with a
variety of compounds, including chemicals, hormones, phytotoxins
and pathogen cell walls. We also analyzed the expression pattern
of the four genes following potato leaf infection by Phytophthora
infestans.
Materials and methods
Chemicals
Chemicals (obtained from Sigma–Aldrich, Fluka) were dissolved
either in water (cycloheximide, H2 O2, cadmium sulphate, NaCl,
fusaric acid, abscisic acid, ␣-solanine, Botrytis cinerea cell walls),
acetone (4,15-diacetoxyscirpenol), or dimethyl sulphoxide (2,4dichlorophenol, arachidonic acid, sulfometuron methyl, sclareol)
and filter sterilized. B. cinerea cell walls were extracted according
to Schirmbock et al., 1994. They were added to the growth medium
at 1:1000 ratio v/v of concentrated filter-sterilized stock solutions
in 30 mL total growth medium. Control medium was treated with
an equal volume of fresh solvent.
Potato plant growth
Potato tubers (Solanum tuberosum cv Desirée L. Heynh) were
sterilized in 1% sodium hypochlorite (30 min), washed three times
with sterile water, planted in pots containing sterile soil and maintained at constant temperature at 20 ◦ C and 16 h day photoperiod in
a climatic chamber (Angelantoni, Massa Martana, Pg, Italy). Plants
were regularly irrigated at 5 day intervals. Six- to seven-week-old
plants were used to collect roots, stems and leaves for DNA and RNA
extraction. Tubers were obtained from greenhouse-grown plants of
about three month old and used for RNA extraction. The hypothetical involvement of the oxidation processes on the expression of the
four genes was analyzed in tubers by cutting and leaving them at
room temperature in a Petri dish for 24 h (Hayashi et al., 2002).
Potato cell cultures and treatments
Potato cell suspensions (S. tuberosum L., dihaploid clone SVP11)
were started and maintained as liquid cultures, under darkness
at 28 ◦ C, and 100 rpm conditions in 250-mL flasks (Leone et al.,
1994), on Murashige-Skoog (MS) basal medium added with 29 ␮M
thiamine, 48 ␮M nicotinic acid, 37 ␮M pyridoxine, 2 g/L−1 casein,
30 g/L−1 sucrose, 23 ␮M 2,4-D and 1 ␮M kinetin, and adjusted to
pH 5,8. Potato cell suspensions were transferred weekly to fresh
suspension medium (P31) (Tavazza and Ordas, 1998). All the substrates used for gene induction were added to a 5-day-old cell
culture. The final concentrations for each compound were: 50 ␮M
2,4-dichlorophenol, 1 ␮M abscisic acid, 0.33 ␮M arachidonic acid,
100 ␮M cadmium sulphate, 1000 ␮M hydrogen peroxide, 100 mM
NaCl, 500 ␮M sclareol; 10 ␮M 4,15-diacetoxyscirpenol, 100 ␮M
cycloheximide, 1000 ppm fusaric acid, 200 ppm ␣-solanine, 2 ppm
sulfometuron methyl and 100 mg B. cinerea cell wall, previously
freeze-dried and suspended in 500 ␮L of sterile water. The concentration of each compound was established on the basis of previous
studies. Abscissic acid is an inducer of the SpTUR2 gene of Spirodela
polyrrhiza (Smart and Fleming, 1996) at concentrations between
10 ␮M and 50 nM. Sclareol is an antifungal diterpene secreted
by NpPDR1 gene, which strongly induces NpPDR1 transcription
(Jasinski et al., 2001) at concentrations between 20 and 500 ␮M.
Solanin is a toxic glycoalkaloid produced by potato which is potentially involved in transcription of potato ABC transporters. The total
concentration of steroid glycoalkaloids in potato is influenced by
several factors and ranges between 0.3 and 0.7 mg/g dry weight,
with a ratio between ␣-solanine and ␣-chaconine of about 50:50
(Nitithamyong et al., 1999). If we assume that live potato cells
contain about 80% water, a concentration of 0.1 mg/mL could be
“physiological”. In order to have in cells an external extra supply of
␣-solanine, we increased its concentration up to 0.2 mg/mL. Fusarium sambucinum, one of the casual agents of potato dry rot, was
found to produce a trichotecenes, 4,15-diacetoxyscirpenol (DAS)
up to 700 mg/g dry mycelium (Altomare et al., 1995). We tested
whether StPDR1–4 are involved in defense of potato against trichotecenes. We used a concentration 10 ppm of DAS, since the Ec50
for Artemia salina is 1 ppm or 10 ␮M, which can inhibit or strongly
disturb growth of tobacco plants (Muhitch et al., 2000). Arachidonic acid is a strong elicitor of hypersensitive reaction (HR) in
potato (Knight et al., 2001). In previous studies with potato tuber
discs, a concentration of 0.33 ␮M was sufficient to enhance transcription of genes involved in phytoalexin biosynthesis, such as
rishitin and lubimin, which could be potentially secreted by ABC
transporters. Hydrogen peroxide is generated and accumulated in
cells during hypersensitive response (HR) in concentration around
30 ␮M (Delledonne et al., 2001). The elicitor-induced resistance is
based on the expression of multiple resistance genes. Fungal cell
walls contain and release a number of substances which could
enhance expression of resistance genes and ABC transporters genes.
In fact, water-soluble low-molecular-weight (3–10 kDa) chitosan,
obtained by enzymatic degradation of high-molecular-weight chitosan, as well as its deaminated derivatives, can be used as elicitors
of late blight resistance in potato (Vasiukova et al., 2000). Cadmium,
which can be administered as sulphate, is a toxic heavy metal and
we used 100 ␮M cadmium sulphate, as reported by Yazaki et al.
(2006). The 2,4-dichlorophenol (2,4-D) is the degradation product
of a number of agricultural compounds (i.e. the herbicide 2,4-D
as well as some fungicides) and is quite recalcitrant to further
degradation. It is also similar to dioxin, an environmental pollutant
deriving from anthropic activities. The concentration tested was
derived from the work of Smart and Fleming (1996), who observed
a weak inducing effect of 2,4-D at 10 ␮M on the SpTUR2 transcription. Sulfometuron methyl is a sulfonylurea herbicide, which
was the first tested substrate for Pdr5p. Primisulfuron, another
Please cite this article in press as: Ruocco M, et al. Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic
factors and Phytophthora infestans infection. J Plant Physiol (2011), doi:10.1016/j.jplph.2011.07.008
ARTICLE IN PRESS
G Model
JPLPH-51322; No. of Pages 9
M. Ruocco et al. / Journal of Plant Physiology xxx (2011) xxx–xxx
sulfonylurea herbicide, at 20 nM, strongly induces the expression of
the EST2 of Arabidopsis thaliana (Tommasini et al., 1997). We tested
2 ppm of sulfometuron methyl, since it was found that 0.2 ppm and
5 ppm inhibit the growth of a yeast strain by 50% and 98%, respectively. Osmotic stress with NaCl at 100 mM was found to strongly
induce the SpTUR2 gene of S. polyrrhiza (Smart and Fleming, 1996).
Controls included cell cultures untreated or treated with DMSO at
a 1:1000 ratio, since DMSO was used to dissolve some of the tested
compounds.
Samples were harvested 3 h after the induction treatment,
frozen in liquid nitrogen, freeze-dried, ground to a fine powder and
stored a −70 ◦ C until further use.
Phytophthora infestans infection of potato plants
P. infestans strains 772 (mating type A1), and 779 (mating type
A2) were kindly provided by Prof. Gennaro Cristinzio (University of Naples “Federico II”, Italy). They were grown on V8p agar
(tomato juice 50 mL L−1 , peas 75 g L−1 , CaCO3 0.5 g L−1 and agar
20 g L−1 ) at 20 ◦ C. Virulence was maintained by infecting potato
leaves and re-isolating the pathogen every 3–4 months on V8p
agar added with vancomicina 150 mg L−1 , neomicina 10 mg L−1 ,
pimaricina 10 mg L−1 , benomyl 10 mg L−1 and nistatina 10 mg L−1
at 20 ◦ C. Zoospores were released by flooding 10- to 14-day-old
cultures with 10 mL cold distilled water and incubating at 4 ◦ C for
2–3 h.
Six- to seven-week-old plants grown as above described were
inoculated with the strains of P. infestans by spraying with freshly
prepared spores at 1 × 106 spore/mL. Leaflets from second to fourth
apical leaves were used for all experiments. After inoculation,
plants were maintained at 20 ◦ C and a 16 h day photoperiod under
saturating humidity. To maintain the high humidity required for
infection, plants were covered with Plexiglas boxes having the
inner surfaces sprayed with water. Control plants were sprayed
with water and covered in the same way. Leaves (infected and control) were collected immediately before inoculation and after 6,
12, 24, 48, 72, 96 h, frozen in liquid nitrogen and stored at −70 ◦ C
prior to RNA extraction. For each experiment, infected leaves were
3
maintained on the plant for four more days, to control the infection
process.
DNA sequencing and sequence analysis
Degenerated primers were the same Pdasp1, Pdasp2, Pdsp1, and
Pdsp2 used by Ruocco et al. (2009) (Table 1). PCR amplification
was performed, unless indicated otherwise, by using 100 ng of S.
tuberosum DNA as template. Amplicons of approximately 500 bp
were excised from the gel and cloned in the pGEMT Easy vector
(Promega Corp., Madison, WI, USA). Plasmid DNA was purified from
Escherichia coli cultures using an alkaline lysis method (Sambrook
et al., 1989) or a Qiaprep spin miniprep kit (Qiagen, Hilden,
Germany) following the manufacturer’s directions. The resulting plasmids were sequenced by MWG Biotech AG (Ebersberg,
Germany) and subjected to BLASTX analysis. Sequences were analyzed using the DNAstar package (DNASTAR). Similarity searches
were conducted with BLAST programs at the National Centre for
Biotechnology Information (http://www.ncbi.nlm.nih.gov).
For the cloning of the StPDR1–4 complete cDNA sequence, in
addition to the primers reported in Table 1, two more primers
(Table 2) were designed against the genomic sequences at 5 and
3 as found at the Potato Genome Sequencing Consortium website
(PGSC http://www.potatogenome.net/index.php/Main Page). PCR
amplicons obtained by using cDNA as a template and primer pairs
described in Table 2, were cloned in the pGEMT Easy vector and the
resulting plasmids were sequenced by GENOPOM DNA sequence
service (Portici, Italy).
DNA isolation and gel blot analysis
Genomic S. tuberosum DNA (gDNA) extraction was performed
from leaf tissues according to Reader and Broda (1985). Briefly,
1 g of freeze-dried leaves was ground with a mechanical bead
grinder. Ten milliliters of extraction buffer (0.5 M NaCl, Tris–HCl
10 mM pH 7.5, EDTA 10 mM, SDS 1%), 10 mL phenol and 10 mL
chloroform:iso-amyl alcohol, were added. Samples were incubated
at room temperature for 1 h. After centrifugation for 10 min at
Table 1
Sequences of the primers used in this study.
Target sequence
Target sequence accession number
Primer name
Primer sequence (5 –3 )
Pdasp1
Pdasp2
Pdsp1
Pdsp2
ATGGGKGYGAGCGGKGCWGGKAA
ATGGGKGYGTCCGGKCGWGGKAA
GCAGARGGYTGRTGGATSGT
GATGCTGGGCTGRTGGATGGT
Amplicone size
StPDR1
AY 165018
StABC1for
StABC1rev
RT ST1 for
RT ST1 rev
ACTATCCATGAGTCACTACTG
CAGACCGGGCATCTAGT
ATCCGGATATTGTGAACAGAATGAT
GCAGAAAACAGTAGTGACTCATGGA
258 bp
StPDR2
AY 165019
StABC2for
StABC2rev
RT ST2 for
RT ST2 rev
ACAGTCTACGAGTCTTTGGTT
TGTTCCTAACAGCTCTCATC
TCGGGTTGCCTGGAGTCA
TGCAATCGTCAACCTTTTACGTT
281 bp
StPDR3
AY 165020
StABC3for
StABC3rev
RT ST3 for
RT ST3 rev
AGATAACTGTAGAAGAATCAGTT
CACAGCCCGCATGACAATT
GGTTGGTATGCCGGGTGTTA
GCAATTGTCAGCCGTTTACGT
290 bp
StPDR4
AY 165021
StABC4for
StABC4rev
RT ST4 for
RT ST4 rev
TCGACTGCCTCGTGAAGTTGA
TTCTCATCACTATTGCAGCTG
AAAACGACTTACAGTTGCAGTTGAA
GAGGTTGGCTCATCCATGAATATTA
242 bp
18S
X67238
18Sfor
18Srev
RT 18S for
RT 18S rev
TAGATAAAAGGTCGACGCGG
CCCAAAGTCCAACTACGAGC
TAGGCCGCGGAAGTTTGA
TGCGGCCCAGAACATCTAA
Please cite this article in press as: Ruocco M, et al. Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic
factors and Phytophthora infestans infection. J Plant Physiol (2011), doi:10.1016/j.jplph.2011.07.008
G Model
JPLPH-51322; No. of Pages 9
ARTICLE IN PRESS
M. Ruocco et al. / Journal of Plant Physiology xxx (2011) xxx–xxx
4
Table 2
Sequences of the primers used to clone cDNA sequences of the 4 potato ABCG genes.
Target sequence
Target sequence
PGSC0003D MS
accession number
Primer name
Primer sequence (5 –3 )
Amplicone size
StPDR1
000001829
StPDR1for1
StABC1rev
StPDR1for2
StPDR1rev2
ATGTCAACAAGAGGTGAAAATGG
CAGACCGGGCATCTAGT
GAAGAAGCGACTCACTACTG
TCAAGAAAGAAACCTCTTAGAACC
2596 bp
StPDR2
000001347
StPDR2for1
StABC2rev
StABC2for
StPDR2rev2
ATGGAGCCATCAGATTTAAGTA
TGTTCCTAACAGCTCTCATC
ACAGTCTACGAGTCTTTGGTT
CTAAAGCAAATGTGAAGGC
3046 bp
StPDR3for1
StABC3rev
StABC3for
StPDR3rev2
ATGGCTCAGCTTGTTAGTTCG
CACAGCCCGCATGACAATT
AGATAACTGTAGAAGAATCAGTT
TCAACATCTCCATATTGTGA
2871 bp
StPDR4for1
StABC4rev
StABC4for
StPDR4rev2
ATGGAGGGTGGTGAAAATATT
TTCTCATCACTATTGCAGCTG
TCGACTGCCTCGTGAAGTTGA
TTATGTTGGTCTAGCAAGTTT
3520 bp
StPDR3
StPDR4
000001349
000001855
13,000 × g, 3 mL of supernatant were mixed with an equal volume of isopropanol and centrifuged at 13,000 × g for 10 min. The
pellet was washed twice with 500 ␮l ethanol 70% and resuspended in 500 ␮l of water. Ten micrograms of S. tuberosum gDNA
were digested overnight with SalI and NotI restriction enzymes
(Promega) and subjected to DNA gel blot analysis as previously
described by Ruocco et al. (2009).
RT-PCR
Semi-quantitative reverse-transcription polymerase chain (RTPCR) reactions were performed in a one-step procedure using
the SuperScriptTM One-Step RT-PCR (Invitrogen) with total RNA
obtained from potato cell suspension or potato tissues (roots,
leaves, stems and tuber). RT-PCR reactions were performed with
primers described above (Table 1). The amplicons generated were
sequenced to confirm their identity. Transcript levels of all samples
were normalized to the 18S rRNA level, and fold induction was calculated by dividing the signal strength of the experimental sample
by the signal strength of the control (cell suspension not induced).
All experiments were performed in duplicate.
Real-time RT-PCR quantification of transcript levels during
plant–pathogen interaction
Fifty microliter samples were prepared by mixing 2 ␮l cDNA
solution with 25 ␮l SybrTM Green Mastermix (Applied Biosystems,
Foster City, USA) and the appropriate primers (final concentration 300 nM). Real-time PCR reactions were run in three replicates
per sample on a 7500 Real Time PCR System (Applied Biosystems,
Foster City, CA USA). After 2 min at 50 ◦ C followed by a 10 min
denaturation step at 95 ◦ C, samples were run for 40 cycles of 15 s
at 95 ◦ C and 1 min at 54 ◦ C. After each run, a dissociation curve was
acquired to check for amplification specificity by heating the samples from 60 to 95 ◦ C. The sequences of the primers were designed
using the Primer Express® Software version 3.0 (Applied Biosystems, Foster City, CA USA) for each target sequence, detailed in
Table 1. SYBR® Green I dye chemistry was used for a two-step
real-time PCR. All reaction mixtures were analyzed by agarose gel
electrophoresis to confirm that only one PCR product was synthesized. In all experiments, appropriate negative controls containing
no template DNA or RNA were subjected to the same procedure
to exclude or detect any possible contamination or carryover. The
2311 bp
1375 bp
935 bp
994 bp
results were normalized using the Cts obtained for the 18S RNA
amplifications run on the same plate.
Serial dilutions of pure cDNA from a sample of known quantity were used to trace standard curves for each gene, which were
used to quantify the transcript levels of the four ABC transporters
during the plant–pathogen time courses. A linear relationship was
obtained by plotting the threshold cycle against the logarithm of
known amount of initial template. The equation of the line that best
fits the data was determined by regression analysis. The R2 value
was calculated for each data set to estimate the accuracy of the
real-time PCR with SYBR® Green I dye as a quantification method.
For quantification normalized to an endogenous control, standard
curves were prepared for both the target and the endogenous control. For each sample, the amounts of target and endogenous control
were determined by extrapolation from the linear regression of
the standard curve. Then, the target amount was divided by the
endogenous control amount to obtain a normalized target value.
Real-time quantitative PCR controls were performed to check
for the linearity of amplification over the dynamic range. A linear
regression analysis showed an almost perfect correlation between
the recorded fluorescence signal and the initial cDNA amount both
after amplification of serial dilutions from 60 to 480 ng of S. tuberosum cDNA with StPDR1–4 specific primer pair, and with primers
RT 18Sfor/RT 18Srev, which are specific for the S. tuberosum 18S
ribosomal subunit, used as endogenous gene control.
All experiments were performed in triplicate.
Phylogenetic analysis
The phylogenetic relationships of the four genes were inferred
by using the Maximum Likelihood method based on the Whelan and Goldman + Freq. model (Whelan and Goldman, 2001). The
bootstrap consensus tree obtained from 100 replicates is taken to
represent the relationships of the taxa analyzed (Felsenstein, 1985).
Branches corresponding to partitions reproduced in less than 50%
bootstrap replicates collapsed. The percentage of replicate trees in
which the associated taxa clustered together in the bootstrap test
(100 replicates) is shown next to the branches (Felsenstein, 1985).
Initial tree(s) for the heuristic search were obtained automatically
as follows. When the number of common sites was 100 or less
than one fourth of the total number of sites, the maximum parsimony method was used; otherwise, the BIONJ method with an
MCL distance matrix was employed. A discrete Gamma distribution was used to model evolutionary rate differences among sites
Please cite this article in press as: Ruocco M, et al. Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic
factors and Phytophthora infestans infection. J Plant Physiol (2011), doi:10.1016/j.jplph.2011.07.008
G Model
JPLPH-51322; No. of Pages 9
ARTICLE IN PRESS
M. Ruocco et al. / Journal of Plant Physiology xxx (2011) xxx–xxx
5
Table 3
List of the amino acid sequences used for the phylogenetic analysis.
Protein Name
Accession number
Related Articles
PDR1/AtPDR1
PDR2/AtPDR2
PDR3/AtPDR3
PDR4/AtPDR4
PDR9/AtPDR9
PDR10/AtPDR10
PDR12/AtPDR12
AtWBC16
AtWBC20
AtWBC25
AtWBC28
AtWBC29
ATNRT1
NpPDR1
NtPDR1
NtPDR3
PDR5
StPDR1
StPDR2
StPDR3
StPDR4
NP 566543
NP 193258
NP 180555
NP 180259
NP 190916
NP 683617
NP 173005
NP 191069
NP 190919
AAF69540
NP 190799
NP 200882
NP 564978
Q949G3
Q76CU2
Q5W274
CAA99359
JF720054
JF440348
JF720055
JF720056
Benschop et al. (2007), Crouzet et al. (2006)
Badri et al. (2009), Crouzet et al. (2006), Ticconi et al. (2009)
Crouzet et al. (2006)
Crouzet et al. (2006)
Crouzet et al. (2006), Ito and Gray (2006), Ruzicka et al. (2010)
Crouzet et al. (2006)
Kang et al. (2010), Lee et al. (2005)
Sanchez-Fernandez et al. (2001)
Sanchez-Fernandez et al. (2001)
Sanchez-Fernandez et al. (2001)
Benschop et al. (2007), Sanchez-Fernandez et al. (2001)
Benschop et al. (2007), Sanchez-Fernandez et al. (2001)
Benschop et al. (2007), Hammes et al. (2005)
Jasinski et al. (2001), Stukkens et al. (2005)
Sasabe et al. (2002), Schenke et al. (2003)
Crouzet et al. (2006), Ducos et al. (2005)
Bissinger and Kuchler (1994)
(5 categories (+G, parameter = 1.5180). The rate variation model
allowed for some sites to be evolutionarily invariable ([+I], 0.0000%
sites). The tree is drawn to scale, with branch lengths measured
in the number of substitutions per site. The analysis involved 20
amino acid sequences (Table 3). All positions with less than 0% site
coverage were eliminated. That is, fewer than 100% alignment gaps,
missing data, and ambiguous bases were allowed at any position.
There were a total of 902 positions in the final dataset. Evolutionary
analyses were conducted in MUSCLE3.6 (Edgar, 2004).
a complete DNA sequence of 7068 bp and 24 putative introns. The
obtained cDNA sequence of 4272 bp encodes a putative protein
of 1423 aa with a (NBF-TMD6 )2 topology. StPDR4 showed high
similarity to NpPDR1 (Jasinski et al., 2001) and O. sativa and A.
thaliana genes coding for putative ABC transporters belonging to
(NBF-TMD6 )2 superfamily.
All the domains characteristic of the PDR/ABCG subfamily are
present and well conserved in the four genes: the ATP binding
site domain, the ABC signature, the Walker A and Walker B, the
Q-loop and H-loop, and the PDR domain (data not shown). Molecular phylogenetic analysis (Fig. 1) with sequences of the PDR/ABCG
Results
Cloning and sequence analysis of potato genes encoding ABCG
transporters
Degenerated primers (Table 1) used to amplify S. tuberosum
genomic DNA produced four fragments with strong similarity
to genes encoding ABC transporters of the PDR/ABCG subfamily, which were named StPDR1 (S. tuberosum PDR transporter 1),
StPDR2, StPDR3 and StPDR4 (Table 4). The partial sequence of StPDR1
was 547 bp. The relative genomic sequence resulted 7394 bp long
with 17 putative introns. The obtained cDNA sequence of 3099 bp
encodes a putative protein of 1032 aa with a (NBF-TMD6 )2 topology. StPDR1 showed high similarity with ABC transporter genes
of the plant PDR/ABCG subfamily (Verrier et al., 2008), especially
with the A. thaliana AtPDR4/PDR4 gene (75% similarity) of unknown
function. The partial sequence of StPDR2 was 550 bp long, while
the complete DNA sequence of 9241 bp contained 17 putative
introns. The obtained cDNA sequence was 4132 bp and encodes a
putative protein of 1378 aa with a (NBF-TMD6 )2 topology. StPDR2
was highly similar to plant PDR/ABCG transporters and, in particular, to NpPDR1 from N. plumbaginifolia (91% similarity). NpPDR1
encodes an ABC transporter (NBF-TMD6 )2 that is involved in the
secretion of the antifungal terpenoid sclareol (Jasinski et al., 2001).
The partial sequence of StPDR3 was 565 bp long, with a complete
DNA sequence of 9687 bp, interrupted by 20 putative introns. The
obtained cDNA sequence of 3519 bp encodes a putative protein of
1172 aa with a (NBF-TMD6 )2 topology. It showed high similarity
(86%) to N. tabacum NtPDR3, an ABCG transporter gene inducible by
iron-deficiency (Ducos et al., 2005), and to A. thaliana AtPDR9/PDR9
gene (75%) encoding a putative ABC transporter of the (NBF-TMD6 )2
superfamily. The partial sequence of StPDR4 was 546 bp long, with
Fig. 1. Molecular phylogenetic analysis of Solanum tuberosum, Arabidopsis thaliana,
Nicotiana tabacum and Nicotiana plumbaginifolia PDR/ABCG deduced amino acid
sequences, by using the Maximum Likelihood method. All the proteins aligned
belong to PDR/ABCG subfamily except for ATNRT1 that is a major facilitator protein. StPDR1, 2and 4 belong to the same group of full size PDR/ABCG proteins, while
StPDR3 belongs to a different group. StPDR1–4 genes are highlighted with yellow
box. (For interpretation of the references to colour in this figure legend, the reader
is referred to the web version of the article.)
Please cite this article in press as: Ruocco M, et al. Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic
factors and Phytophthora infestans infection. J Plant Physiol (2011), doi:10.1016/j.jplph.2011.07.008
ARTICLE IN PRESS
G Model
JPLPH-51322; No. of Pages 9
M. Ruocco et al. / Journal of Plant Physiology xxx (2011) xxx–xxx
6
Table 4
Solanum tuberosum StPDR1–4 gene sequence data.
Gene name
DNA partial
sequence
length in bp
DNA partial
sequence Acc.
No.
DNA complete
sequence length
in bp
DNA complete
sequence
PGSC0003DMS Acc. No.
Predicted
introns No.
cDNA length in
bp
cDNA sequence
Acc. No.
Putative protein
sequence length in
AA
StPDR1
547
AY 165018
7394
000001829
17
3099
JF720054
1032
StPDR2
550
AY 165019
9241
000001347
17
4132
JF440348
1378
StPDR3
565
AY 165020
9687
000001349
20
3519
JF720055
1172
StPDR4
546
AY 165021
7068
000001855
24
4272
JF720056
1423
subfamily genes confirmed the similarities obtained with Blastp
analysis. Three distinct subgroups were formed, one containing all
the half-size proteins of the subfamily ABCG/WBC (white–brown
complex), such as AtWBC16, AtWBC20, AtWBC25, AtWBC28 and
AtWBC29. The four StPDR sequences divided into 2 sub-groups,
one containing StPDR1,2 and 4 and the other containing StPDR3.
Amino acidic sequence comparison indicated that the four S. tuberosum transporters are more closely related to each other than to
PDR5 from S. cerevisiae, the prototype of the PDR family (data not
shown). DNA gel blot analysis demonstrated that StPDR1, 2 and
4 are single-copy genes, while StPDR3 has more than one copy
(Fig. 2).
which was low in cell cultures, was unaffected by most of the added
compounds and down-regulated by some of them, such as B. cinerea
cell walls, DAS and sclareol. StPDR2 was up-regulated by sclareol,
B. cinerea cell walls, 2,4-dichlorophenoxyacetic acid, sulfometuron
Expression in potato tissues and cell cultures
We used RT-PCR analysis to determine expression levels of
the four PDR/ABCG genes in S. tuberosum roots, tubers, stems and
leaves. StPDR1 and StPDR4 were expressed in all tissues, StPDR2
in roots and leaves, and StPDR3 mainly in roots (Fig. 3). Expression levels of the StPDR1–4 genes in tuber slices left to air oxidize
for 24 h were similar to those obtained from fresh tissue (data not
shown).
The results obtained by RT-PCR performed on total RNA from
potato cell cultures are reported in Fig. 4. Transcript levels for all
samples were normalized to that of the 18S rRNA. The designed
primers (Table 1) produced amplicons of 258, 280, 290 and 242 bp
in size for the StPDR1–4 genes, respectively. Expression of StPDR1,
Fig. 3. Expression of PDR transporter genes in Solanum tuberosum cell cultures
and different tissues. RT-PCR analyses were performed with Poly(A)+ RNA obtained
from: leaves (lane 1); tuber (lane 2); stem (lane 3); roots (lane 4).
Fig. 2. DNA gel blot analysis of Solanum tuberosum DNA digested with SalI (lane
1, 3, 5, 7) or NotI (lane 2, 4, 6, 8) and probed with PDR transporter gene fragments
(StPDR1–4). Probes were obtained by using the digoxigenin-labelled PCR kit. StPDR1
probe = lanes 1 and 2; StPDR2 probe = lanes 3 and 4; StPDR3 probe = lanes 5 and 6;
StPDR4 probe = lanes 7 and 8). Lane M = molecular weight markers in kb.
Fig. 4. Expression of PDR transporter genes of Solanum tuberosum cell cultures treated with different compounds. B. cinerea cell wall = lane 1; arachidonic
acid = lane 2; hydrogen peroxide = lane 3; NaCl = lane 4; 2,4-dichlorophenol = lane
5; cadmium sulphate = lane 6; sulfometuron methyl = lane 7; abscisic acid = lane
8; 4,15-diacetoxyscirpenol = lane 9; DMSO = lane 10; fusaric acid = lane 11;
sclareol = lane 12; ␣-solanine = lane 13. Control include: potato cell culture not
induced = lane 14; 30 PCR cycles were run and 18S ribosomal subunit was used
as a housekeeping gene.
Please cite this article in press as: Ruocco M, et al. Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic
factors and Phytophthora infestans infection. J Plant Physiol (2011), doi:10.1016/j.jplph.2011.07.008
G Model
JPLPH-51322; No. of Pages 9
ARTICLE IN PRESS
M. Ruocco et al. / Journal of Plant Physiology xxx (2011) xxx–xxx
7
Fig. 5. Changes in transcription level of S. tuberosum PDR1–4 transporter genes following P. infestans leaf infection. The relative amounts of ABC transporter genes and relative
levels of 18S ribosomial subunit transcripts were determined by a standard curve (i.e., Cts plotted against logarithm of the cDNA concentrations). The values represent the
numbers of times the genes are expressed compared to that of the t0 time point (leaves collected before infection set at 1.00). Results are averages of three repetitions.
methyl and sodium chloride. StPDR3 was constitutively expressed
and apparently down-regulated by most of the added compounds,
with the exception of NaCl, DMSO and ␣-solanine. StPDR4 was only
slightly altered, in most cases up-regulated, by the tested compounds.
Transcript levels of StPDR1–4 during potato–P. infestans
interaction
Transcript levels of StPDR1–4 in potato leaves infected with P.
infestans are shown in Fig. 5. StPDR1 and StPDR2 were up-regulated
about 13- and 37-fold in comparison to untreated controls at 48 hpi,
which corresponds to the necrotrophic phase of the infection process. StPDR3 and StPDR4 showed different expression patterns. The
first was activated (4- to 5-fold) at 24 and 48 hpi and then its expression rapidly decreased. StPDR4 mRNA accumulation was increased
about 4-fold at 12 and 24 hpi, decreased at 48 hpi and increased
again at 96 hpi.
Discussion
StPDR1–4 were the first PDR/ABCG transporter genes reported
for S. tuberosum. They encode plant ABC transporters with high
homology to the well characterized yeast PDR5-like gene products, NpPDR1 from N. plumbaginifolia, SpTUR2 from S. polyrrhiza
and AtPDR12 from A. thaliana (Campbell et al., 2003; Jasinski et al.,
2001; Tommasini et al., 1997). StPDR1, 2, 3 and 4 grouped with
full size ABCG, while the half size proteins belong to another group
(Fig. 1). However, StPDR3 clustered in a group different from that of
StPDR1, 2, and 4. It is interesting to note that, like StPDR3, all genes
coding for the ABCGs present in this group are mainly expressed in
roots. To our knowledge, only another ABC transporter gene, PMDR1
of the ABCB subfamily, has been studied in potato. The expression
of this gene was found to be constitutive in all organs examined,
with higher levels in the stem and stolon tip; further, it reached
a maximum during tuber initiation and decreased during tuber
development (Wang et al., 1996). Previous studies (Kolaczkowski
et al., 1998; Tommasini et al., 1997) demonstrated that the plant
PDR5 homologues are subject to complex environmental regulation and may confer resistance to microbial compounds produced
during plant–pathogen defense responses (Campbell et al., 2003;
Jasinski et al., 2003). This hypothesis is supported by evidence that
the wheat gene Lr34, used for more than 50 years by breeders to
introduce resistance to leaf rust, stripe rust and powdery mildew,
encodes a protein that resembles adenosine triphosphate-binding
cassette transporters of the PDR/ABCG subfamily (Krattinger et al.,
2009).
StPDR1–4 expression levels were determined on total RNA from
different tissues (root, tuber, stem and leaf) of S. tuberosum cv
Desireé. In roots and leaves, all four genes are expressed (in
leaf, StPDR3 is lightly expressed), while in tubers and stems, only
transcripts of StPDR1 and StPDR4 were found. StPDR3 was highly
expressed in roots as were N. tabacum NtPDR3 (Ducos et al., 2005),
Arabidopsis PDR9 (Ruzicka et al., 2010; Strader et al., 2008) and
PDR2 (Ticconi et al., 2004, 2009) homologues. ABC genes can be
expressed in different plant organs. Jasinski et al. (2009), for example, by analyzing the 19 genes of the ABCG subfamily present in
Medicago truncatula, observed that MtABCG3, MtABCG4, MtABCG7
and MtABCG14 are expressed in roots, while MtABCG13 is expressed
in flowers. However, close homologous genes of this family can be
expressed in different organs, where they can have similar roles or
diverse substrates (Gaedeke et al., 2001; Jasinski et al., 2009). In
M. truncatula, the majority of the ABCG genes were expressed in
Please cite this article in press as: Ruocco M, et al. Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic
factors and Phytophthora infestans infection. J Plant Physiol (2011), doi:10.1016/j.jplph.2011.07.008
G Model
JPLPH-51322; No. of Pages 9
8
ARTICLE IN PRESS
M. Ruocco et al. / Journal of Plant Physiology xxx (2011) xxx–xxx
roots. Since in rhizosphere very complex and dynamic interactions
between roots and the surrounding environment take place, this
suggests that ABCG genes may play an important role by providing, for example, efficient transport through cellular membranes of
different molecules, such as root exudates.
We also investigated the expression of the four cloned
PDR/ABCG transporters in leaves during the interaction potato–P.
infestans. Wang et al. (2005), on the basis of the expression of genes
involved in the whole infection process, clearly identified three distinct stages of the P. infestans–potato interaction: the early stage
(2–6 hpi), mid stage (8–24 hpi), and late stage (36–72 hpi). At 24 hpi,
the biotrophic phase ends and the necrotrophic phase starts. Looking at the expression patterns of leaf potato genes during the three
stages they found that, from 24 up to 72 hpi, more than 80% of the
genes were up-regulated and 9.8% of them were related to secondary metabolite pathways. We extended our experiments up
to 96 hpi to examine whether some of the PDR/ABCG genes were
also involved in the late stage of the infection process. StPDR1–4
genes were up-regulated during the infection, but in different ways.
StPDR1 and StPDR2, which showed the strongest activation among
the four genes (13- and 37-fold, respectively), were induced only
at 48 hpi, during the passage from the mid to the late phase of the
infection (Fig. 5). The StPDR2 sharp induction at 48 hpi could be due
to the presence of a specific compound(s). Stukkens et al. (2005)
found that NpPDR1, a N. plumbaginifolia gene showing high homology with StPDR2, was constitutively expressed in the whole root,
leaf glandular trichomes, and flower petals. In trichomes, NpPDR1
expression was related to secretion of sclareol, a major diterpene
constituent of N. plumbaginifolia foliar exudates, with fungal toxic
activity (Jasinski et al., 2001).
StPDR3 and StPDR4 were activated during the early phases of
the interaction. However, StPDR3 activation increased by reaching a maximum at 48 hpi and then decreased, while StPDR4 was
induced up to 24 hpi, returned to normal level at 48 hpi and was upregulated again at 96 hpi (very late stage). This indicates that the
latter gene can have a role in the transport of compounds produced
both during biotrophic and necrotrophic stages.
To identify the substrates for StPDR1–4, the expression of these
genes was determined in cell culture suspensions added with
a number of compounds selected by considering the possible
involvement of ABC transporters in response to biotic and abiotic
stresses. These experiments were based on the assumption that
there is a direct correlation between the cellular concentration of
some molecules and the expression level of the transporter that
secrete them (Del Sorbo et al., 2000; Fleissner et al., 2002; Muhitch
et al., 2000). Direct treatment of S. tuberosum cell culture suspension proved to be a very convenient tool; it provided a homogenous
sample in which cells are in direct contact with the surrounding
medium and responded evenly (Jasinski et al., 2001).
In cell culture, StPDR1 was weakly expressed. Addition of hydrogen peroxide, 2,4-dichlorophenoxyacetic, dimethyl sulphoxide,
fusaric acid and ␣-solanine were ineffective, while B. cinerea cell
walls, sodium chloride, cadmium sulphate, sulfometuron methyl,
4,15-diacetoxyscirpenol, abscisic acid and sclareol down-regulate
its expression. We found that addition of sclareol, B. cinerea
cell walls, sodium chloride, 2,4-dichlorophenoxyacetic, sulfometuron methyl and ␣-solanine strongly induced StPDR2 expression
in cell suspensions. This result is in good agreement with the
up-regulation shown by this gene during the potato–P. infestans
interaction and strongly indicates that StPDR2 could be involved
in plant defense responses to biotic and abiotic stresses. Further
StPDR2 may be functionally related to the previously identified
ABC transporters SpTUR2, AtPDR12 and NpABC1, which transport
sclareol and are involved in general defense responses (Campbell
et al., 2003; Sasabe et al., 2002; Smart and Fleming, 1996). A similar
role has also been hypothesized for PEN3/PDR8 of A. thaliana, which
exports a family of chemically related toxic compounds (Stein et al.,
2006).
The result that in cell culture only StPDR2 expression is upregulated could depend on the fact that none of the tested
compounds is a substrate for StPDR1, StPDR3 and StPDR4. Nevertheless, we cannot exclude the possibility that StPDR1, StPDR3 and
StPDR4 expression requires induction times longer than those used
in our study, or that the activation patterns of these genes could be
different in cell cultures and plant organs. Dorey et al. (1999) found
that elicitin exhibits different behavior in cell cultures compared to
leaves.
This is, to our knowledge, the first study on several PDR/ABCG
genes’ expression in S. tuberosum that also shows that the activation
of at least one (StPDR2) is correlated with the pathogen (P. infestans)
infection. We hypothesize that the StPDR1–4 genes could be part of
a complex marshalling interacting components that modulate and
regulate the potato response to pathogens and abiotic stresses.
Acknowledgements
We thank Giuseppe Andolfo, who gave us important suggestions
for molecular phylogenetic analysis. The present paper is dedicated
to the memory of Prof. Giovanni Del Sorbo.
References
Altomare C, Logrieco A, Bottalico A, Mule G, Moretti A, Evidente A. Production of typea Trichothecenes and Enniatin-B by Fusarium Sambucinum Fuckel Sensu-Lato.
Mycopathologia 1995;129:177–81.
Badri DV, Quintana N, El Kassis EG, Kim HK, Choi YH, Sugiyama A, et al. An ABC
transporter mutation alters root exudation of phytochemicals that provoke an
overhaul of natural soil microbiota. Plant Physiol 2009;151:2006–17.
Bauer BE, Wolfger H, Kuchler K. Inventory and function of yeast ABC proteins: about
sex, stress, pleiotropic drug and heavy metal resistance. BBA: Biomembranes
1999;1461:217–36.
Benschop JJ, Mohammed S, O’Flaherty M, Heck AJR, Slijper M, Menke FLH. Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. Mol Cell
Proteomics 2007;6:1198–214.
Bissinger PH, Kuchler K. Molecular-cloning and expression of the Saccharomyces
cerevisiae Sts1 gene-product – a yeast Abc transporter conferring mycotoxin
resistance. J Biol Chem 1994;269:4180–6.
Campbell EJ, Schenk PM, Kazan K, Penninckx IA, Anderson JP, Maclean DJ, et al.
Pathogen-responsive expression of a putative ATP-binding cassette transporter
gene conferring resistance to the diterpenoid sclareol is regulated by multiple
defense signaling pathways in Arabidopsis. Plant Physiol 2003;133:1272–84.
Crouzet J, Trombik T, Fraysse AS, Boutry M. Organization and function of
the plant pleiotropic drug resistance ABC transporter family. FEBS Lett
2006;580:1123–30.
Davies TGE, Coleman JOD. The Arabidopsis thaliana ATP-binding cassette proteins:
an emerging superfamily. Plant Cell Environ 2000;23:431–43.
Del Sorbo G, Schoonbeek H, De Waard MA. Fungal transporters involved in efflux of
natural toxic compounds and fungicides. Fungal Genet Biol 2000;30:1–15.
Delledonne M, Zeier J, Marocco A, Lamb C. Signal interactions between nitric oxide
and reactive oxygen intermediates in the plant hypersensitive disease resistance
response. Proc Natl Acad Sci USA 2001;98:13454–9.
Dorey S, Kopp M, Geoffroy P, Fritig B, Kauffmann S. Hydrogen peroxide from the
oxidative burst is neither necessary nor sufficient for hypersensitive cell death
induction, phenylalanine ammonia lyase stimulation, salicylic acid accumulation, or scopoletin consumption in cultured tobacco cells treated with elicitin.
Plant Physiol 1999;121:163–72.
Ducos E, Fraysse S, Boutry M. NtPDR3, an iron-deficiency inducible ABC transporter
in Nicotiana tabacum. FEBS Lett 2005;579:6791–5.
Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Res 2004;32:1792–7.
Felsenstein J. Confidence-limits on phylogenies – an approach using the bootstrap.
Evolution 1985;39:783–91.
Fleissner A, Sopalla C, Weltring KM. An ATP-binding cassette multidrug-resistance
transporter is necessary for tolerance of Gibberella pulicaris to phytoalexins and
virulence on potato tubers. Mol Plant Microbe Interact 2002;15:102–8.
Gaedeke N, Klein M, Kolukisaoglu U, Forestier C, Muller A, Ansorge M, et al. The
Arabidopsis thaliana ABC transporter AtMRP5 controls root development and
stomata movement. EMBO J 2001;20:1875–87.
Garcia O, Bouige P, Forestier C, Dassa E. Inventory and comparative analysis of rice
Arabidopsis ATP-binding cassette (ABC) systems. J Mol Biol 2004;343:249–65.
Hammes UZ, Schachtman DP, Berg RH, Nielsen E, Koch W, McIntyre LM, et al.
Nematode-induced changes of transporter gene expression in Arabidopsis roots.
Mol Plant Microbe Interact 2005;18:1247–57.
Please cite this article in press as: Ruocco M, et al. Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic
factors and Phytophthora infestans infection. J Plant Physiol (2011), doi:10.1016/j.jplph.2011.07.008
G Model
JPLPH-51322; No. of Pages 9
ARTICLE IN PRESS
M. Ruocco et al. / Journal of Plant Physiology xxx (2011) xxx–xxx
Hayashi M, Nito K, Takei-Hoshi R, Yagi M, Kondo M, Suenaga A, et al. Ped3p is a
peroxisomal ATP-binding cassette transporter that might supply substrates for
fatty acid beta-oxidation. Plant Cell Physiol 2002;43:1–11.
Higgins CF. ABC transporters: physiology, structure and mechanism – an overview.
Res Microbiol 2001;152:205–10.
Ito H, Gray WM. A gain-of-function mutation in the Arabidopsis pleiotropic drug
resistance transporter PDR9 confers resistance to auxinic herbicides. Plant Physiol 2006;142:63–74.
Jasinski M, Ducos E, Martinoia E, Boutry M. The ATP-binding cassette transporters:
structure, function, and gene family comparison between rice and Arabidopsis.
Plant Physiol 2003;131:1169–77.
Jasinski M, Banasiak J, Radom M, Kalitkiewicz A, Figlerowicz M. Full-size ABC transporters from the ABCG subfamily in Medicago truncatula. Mol Plant Microbe
Interact 2009;22:921–31.
Jasinski M, Stukkens Y, Degand H, Purnelle B, Marchand-Brynaert J, Boutry M. A
plant plasma membrane ATP binding cassette-type transporter is involved in
antifungal terpenoid secretion. Plant Cell 2001;13:1095–107.
Kang J, Hwang JU, Lee M, Kim YY, Assmann SM, Martinoia E, et al. PDR-type ABC
transporter mediates cellular uptake of the phytohormone abscisic acid. Proc
Natl Acad Sci USA 2010;107:2355–60.
Klein M, Geisler M, Suh SJ, Kolukisaoglu HU, Azevedo L, Plaza S, et al. Disruption of
AtMRP4, a guard cell plasma membrane ABCC-type ABC transporter, leads to
deregulation of stomatal opening and increased drought susceptibility. Plant J
2004;39:219–36.
Knight VI, Wang H, Lincoln JE, Lulai EC, Gilchrist DG, Bostock RM. Hydroperoxides
of fatty acids induce programmed cell death in tomato protoplasts. Physiol Mol
Plant Pathol 2001;59:277–86.
Kolaczkowski M, Kolaczkowska A, Luczynski J, Witek S, Goffeau A. In vivo characterization of the drug resistance profile of the major ABC transporters and other
components of the yeast pleiotropic drug resistance network. Microb Drug Resist
– Mechan Epidemiol Dis 1998;4:143–58.
Krattinger SG, Lagudah ES, Spielmeyer W, Singh RP, Huerta-Espino J, McFadden H,
et al. A putative ABC transporter confers durable resistance to multiple fungal
pathogens in wheat. Science 2009;323:1360–3.
Lee M, Lee K, Lee J, Noh EW, Lee Y. AtPDR12 contributes to lead resistance in arabidopsis. Plant Physiol 2005;138:827–36.
Leone A, Costa A, Tucci M, Grillo S. Adaptation versus shock response to polyethylene glycol-induced low water potential in cultured potato cells. Physiol Plant
1994;92:21–30.
Luo B, Xue XY, Hu WL, Wang LJ, Chen XY. An ABC transporter gene of Arabidopsis
thaliana AtWBC11, is involved in cuticle development and prevention of organ
fusion. Plant Cell Physiol 2007;48:1790–802.
Martinoia E, Klein M, Geisler M, Bovet L, Forestier C, Kolukisaoglu U, et al. Multifunctionality of plant ABC transporters – more than just detoxifiers. Planta
2002;214:345–55.
Muhitch MJ, McCormick SP, Alexander NJ, Hohn TM. Transgenic expression of the
TRI101 or PDR5 gene increases resistance of tobacco to the phytotoxic effects of
the trichothecene 4,15-diacetoxyscirpenol. Plant Sci 2000;157:201–7.
Nitithamyong A, Vonelbe JH, Wheeler RM, Tibbitts TW. Glycoalkaloids in potato
tubers grown under controlled environments. Am Potato J 1999;76:337–43.
Rea PA. Plant ATP-binding cassette transporters. Annu Rev Plant Biol
2007;58:347–75.
Reader U, Broda P. Rapid preparation of DNA from filamentous fungi. Lett Appl
Microbiol 1985;1:4.
Ruocco M, Lanzuise S, Vinale F, Marra R, Turra D, Woo SL, et al. Identification of a
new biocontrol gene in Trichoderma atroviride: the role of an ABC transporter
membrane pump in the interaction with different plant–pathogenic fungi. Mol
Plant Microbe Interact 2009;22:291–301.
Ruzicka K, Strader LC, Bailly A, Yang HB, Blakeslee J, Langowski L, et al. Arabidopsis
PIS1 encodes the ABCG37 transporter of auxinic compounds including the auxin
precursor indole-3-butyric acid. Proc Natl Acad Sci USA 2010;107:10749–53.
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed.
Cold Spring Harnor, NY: Cold Spring Harbour Laboratory Press; 1989.
Sanchez-Fernandez R, Davies TG, Coleman JO, Rea PA. The Arabidopsis thaliana ABC
protein superfamily, a complete inventory. J Biol Chem 2001;276:30231–44.
Sasabe M, Toyoda K, Shiraishi T, Inagaki Y, Ichinose Y. cDNA cloning and characterization of tobacco ABC transporter: NtPDR1 is a novel elicitor-responsive gene.
FEBS Lett 2002;518:164–8.
9
Schenke D, Sasabe M, Toyoda K, Inagaki YS, Shiraishi T, Ichinose Y. Genomic structure
of the NtPDR1 gene, harboring the two miniature inverted-repeat transposable elements, NtToya1 and NtStowaway101. Genes Genet Syst 2003;78:
409–18.
Schirmbock M, Lorito M, Wang YL, Hayes CK, Arisan-Atac I, Scala F, et al.
Parallel formation and synergism of hydrolytic enzymes and peptaibol
antibiotics, molecular mechanisms involved in the antagonistic action of Trichoderma harzianum against phytopathogenic fungi. Appl Environ Microbiol
1994;60:4364–70.
Schoonbeek H, Del Sorbo G, De Waard MA. The ABC transporter BcatrB affects the
sensitivity of Botrytis cinerea to the phytoalexin resveratrol and the fungicide
fenpiclonil. Mol Plant Microbe Interact 2001;14:562–71.
Smart CC, Fleming AJ. Hormonal and environmental regulation of a plant PDR5-like
ABC transporter. J Biol Chem 1996;271:19351–7.
Stein M, Dittgen J, Sanchez-Rodriguez C, Hou BH, Molina A, Schulze-Lefert P, et al.
Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to
nonhost resistance to inappropriate pathogens that enter by direct penetration.
Plant Cell 2006;18:731–46.
Strader LC, Monroe-Augustus M, Rogers KC, Lin GL, Bartel B. Arabidopsis IBA
response5 suppressors separate responses to various hormones. Genetics
2008;180:2019–31.
Stukkens Y, Bultreys A, Grec S, Trombik T, Vanham D, Boutry M. NpPDR1, a
pleiotropic drug resistance-type ATP-binding cassette transporter from Nicotiana plumbaginifolia, plays a major role in plant pathogen defense. Plant Physiol
2005;139:341–52.
Tavazza R, Ordas RJ. Ancora g Procedure for regeneration of plants from cell suspension, protoplasts of tetraploid potato (Solanum tuberosum) cv. Desiree. Plant Sci
1998;58:8.
Ticconi CA, Delatorre CA, Lahner B, Salt DE, Abel S. Arabidopsis pdr2 reveals
a phosphate-sensitive checkpoint in root development. Plant J 2004;37:
801–14.
Ticconi CA, Lucero RD, Sakhonwasee S, Adamson AW, Creff A, Nussaume L, et al.
ER-resident proteins PDR2 and LPR1 mediate the developmental response
of root meristems to phosphate availability. P Natl Acad Sci USA 2009;106:
14174–9.
Titapiwatanakun B, Murphy AS. Post-transcriptional regulation of auxin transport
proteins: cellular trafficking, protein phosphorylation, protein maturation, ubiquitination, and membrane composition. J Exp Bot 2009;60:1093–107.
Tommasini R, Vogt E, Schmid J, Fromentau M, Amrhein N, Martinoia E. Differential
expression of genes coding for ABC transporters after treatment of Arabidopsis
thaliana with xenobiotics. FEBS Lett 1997;411:206–10.
van den Brule S, Smart CC. The plant PDR family of ABC transporters. Planta
2002;216:95–106.
van den Brule S, Muller A, Fleming AJ, Smart CC. The ABC transporter SpTUR2 confers
resistance to the antifungal diterpene sclareol. Plant J 2002;30:649–62.
Vasiukova NI, Chalenko GI, Gerasimova NG, Perekhod EA, Ozeretskovskaia OL, Il’ina
AV, et al. Derivatives of chitin and chitosan as elicitors of potato resistance to
late blight. Prikl Biokhim Mikrobiol 2000;36:433–8.
Verrier PJ, Bird D, Burla B, Dassa E, Forestier C, Geisler M, et al. Plant ABC proteins – a
unified nomenclature and updated inventory. Trends Plant Sci 2008;13:151–9.
Walker JE, Saraste M, Runswick MJ, Gay NJ. Distantly related sequences in the alphaand beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring
enzymes and a common nucleotide binding fold. EMBO J 1982;1:945–51.
Wang BL, Liu J, Tian ZD, Song BT, Xie CH. Monitoring the expression patterns of potato
genes associated with quantitative resistance to late blight during Phytophthora
infestans infection using cDNA microarrays. Plant Sci 2005;169:1155–67.
Wang W, Takezawa D, Poovaiah BW. A potato cDNA encoding a homologue of mammalian multidrug resistant P-glycoprotein. Plant Mol Biol 1996;31:683–7.
Whelan S, Goldman N. A general empirical model of protein evolution derived from
multiple protein families using a maximum-likelihood approach. Mol Biol Evol
2001;18:691–9.
Yazaki K, Yamanaka N, Masuno T, Konagai S, Shitan N, Kaneko S, et al. Heterologous expression of a mammalian ABC transporter in plant and its application to
phytoremediation. Plant Mol Biol 2006;61:491–503.
Zientara K, Wawrzynska A, Lukomska J, Lopez-Moya JR, Liszewska F, Assuncao AG,
et al. Activity of the AtMRP3 promoter in transgenic Arabidopsis thaliana and
Nicotiana tabacum plants is increased by cadmium, nickel, arsenic, cobalt and
lead but not by zinc and iron. J Biotechnol 2009;139:258–63.
Please cite this article in press as: Ruocco M, et al. Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic
factors and Phytophthora infestans infection. J Plant Physiol (2011), doi:10.1016/j.jplph.2011.07.008