Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Translation and Mutations Practice ANSWERS 1) Below is a strand of mRNA. The underlined segments represent introns, and those not underlined represent exons. What will be the final strand of mRNA (write the final strand on the space provided below, making sure each codon fits between the dotted lines)? The first one has been done for you. UUACGUAUGGUGAGUACCCGAGGUAACUCGGGAUUGUGA mRNA codons: UUU AUG UAC CCG AGG UGG GAU UGA tRNA anticodons: AAA UAC AUG GGC UCC ACC CUA ACU Amino Acids: Met. Tyr. Pro. Arg. Asp. Stop Codon Phen. a) How many codons does the finished mRNA represent? Try. 8 2) Using the space above, fill in the missing tRNA anticodons. 3) Using the space above, fill in the missing amino acids. *remember that translation begins with a certain start codon. a) How many amino acids long is your finished polypeptide? 6 Section 8.7 (Mutations) Answers to questions 1-3 on page 255: 1. Explain why frameshift mutations have a greater effect than do point mutations? Frameshift mutations are more severe than point mutations because point mutations only change a single codon (1 amino acid change), where frameshift mutations can affect the ENTIRE sequence after the mutation (many amino acid changes). 2. If GUA is changed to GUU, will the resulting protein be affected? Explain. If GUA were changed to GUU, the resulting protein WOULD NOT be affected. This is because both GUA and GUU code for the same amino acid. This is called a SILENT (point) mutation. 3. Explain how mutagens can cause genetic mutations in spite of your body’s DNA repair enzymes? Sometimes mutagens cause so much damage, that the repair enzymes cannot keep up (ex: UV sunlight radiation).