Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Two-hybrid screening wikipedia , lookup
Molecular ecology wikipedia , lookup
Fatty acid synthesis wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetic code wikipedia , lookup
Butyric acid wikipedia , lookup
Biosynthesis wikipedia , lookup
Biochemistry wikipedia , lookup
FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN PhD thesis Davide Ravasio Flavour compounds in fungi Flavour analysis in ascomycetes and the contribution of the Ehrlich pathway to flavour production in Saccharomyces cerevisiae and Ashbya gossypii Academic advisor: Prof. Steen Holmberg, Department of Biology, University of Copenhagen. Co-supervisor: Prof. Jürgen Wendland, Yeast Genetics Group, Carlsberg Laboratory Submitted: 01/10/14 “There is nothing like looking, if you want to find something. You certainly usually find something, if you look, but it is not always quite the something you were after.” ― J.R.R. Tolkien, The Hobbit Institutnavn: Natur- og Biovidenskabelige Fakultet Name of department: Department of Biology Author: Davide Ravasio Titel: Flavour-forbindelser i svampe. Flavour-analyse i ascomyceter og bidrag fra Ehrlich biosyntesevejen til smagsproduktion i Saccharomyces cerevisiae og Ashbya gossypii Title: Flavour compounds in fungi. Flavour analysis in ascomycetes and the contribution of the Ehrlich pathway to flavour production in Saccharomyces cerevisiae and Ashbya gossypii Academic advisor: Prof. Steen Holmberg, Prof. Jürgen Wendland Submitted: 01/10/14 Table of contents Preface ................................................................................................................................................ 1 List of Papers ..................................................................................................................................... 2 Summary ............................................................................................................................................ 3 Resumé ............................................................................................................................................... 5 Acknowledgments .............................................................................................................................. 7 Abbreviations ................................................................................................................................... 10 1. Introduction .............................................................................................................................. 11 1.1 The Fungi Kingdom ........................................................................................................... 11 1.2 Ascomycota: The Saccharomycotina clade ...................................................................... 12 1.3 Saccharomyces cerevisiae: the model organism ............................................................ 15 1.4 Yeast carbon metabolism ................................................................................................. 18 1.5 The Eremothecium genus: Ashbya gossypii and Eremothecium cymbalariae ............ 20 Ashbya gossypii ....................................................................................................................... 21 Eremothecium cymbalariae .................................................................................................... 23 1.6 Fungal system and their contribution to industrial processes ........................................ 23 1.7 Aroma and flavour definition, chemical type .................................................................. 24 1.8 Flavour additives and natural flavours ............................................................................ 26 1.9 Bioflavour production (Ehrlich pathway, FFAs and lactate) .......................................... 29 Ehrlich pathway ....................................................................................................................... 30 Fatty acids as substrates for flavour formation ....................................................................... 33 Metabolism of lactate and citrate ............................................................................................ 34 1.10 Biological properties of quorum sensing molecules and VOCs as signaling molecules . 35 1.11 Biotechnological application of fungal VOCs .................................................................. 37 1.12 Fungal VOC collection and detection ............................................................................... 38 VOC collection .......................................................................................................................... 38 VOC separation ........................................................................................................................ 39 VOC detection........................................................................................................................... 39 2. Aim ............................................................................................................................................40 3. Objectives and state-of-the-art ................................................................................................ 41 3.1 Functional analysis of the ARO gene family in S.cerevisiae and A. gossypii ................. 41 3.2 Analysis of the different volatile profiles of A. gossypii and E. cymbalariae is correlated to their genetic backgrounds. ...................................................................................................... 43 3.3 4. 5. Flavour molecules produced in the Saccharomyces clade. ............................................. 44 Discussion ................................................................................................................................. 44 4.1 Reporter assay for ARO genes in S. cerevisiae and A. gossypii ...................................... 44 4.2 Use of a lacZ- reporter assay to correlate reporter gene activity with flavour production ........................................................................................................................................... 46 4.3 General flavour differences between A. gossypii and E. cymbalariae ........................... 47 4.4 VOCs produced in the Saccharomyces clade ................................................................... 49 Conclusions and Outlook ......................................................................................................... 53 References ........................................................................................................................................ 55 Paper 1 .............................................................................................................................................. 64 Paper 2 ............................................................................................................................................. 65 Paper 3 ............................................................................................................................................. 66 Appendix .......................................................................................................................................... 67 Preface This thesis “Flavour compounds in fungi: Flavour analysis in ascomycetes and the contribution of the Ehrlich pathway to flavour production in Saccharomyces cerevisiae and Ashbya gossypii” represents an overview of my PhD internship carried out at the Carlsberg Laboratory in Denmark. This project was supervised by Prof. Jürgen Wendland, head of the Yeast Genetics Group in the Carlsberg Laboratory and Prof. Steen Holmberg at the Department of Biology, University of Copenhagen. My thesis was funded by the European Union Marie Curie Initial Training Network, Cornucopia. 1 List of Papers I. Davide Ravasio, Andrea Walther, Kajetan Trost, Urska Vrhovsek and Jürgen Wendland (2014). An indirect assay for volatile compound production in yeast strains. Scientific report 4: 3707. II. Davide Ravasio, Jürgen Wendland and Andrea Walther (2014). Major contribution of the Ehrlich pathway for 2-phenylethanol/rose flavour production in Ashbya gossypii. FEMS Yeast Res. doi: 10.1111/1567-1364.12172. III. Davide Ravasio, Silvia Carlin, Teun Boekhout, Urska Vrhovsek, Jürgen Wendland and Andrea Walther (2014). A survey of flavor production among non-conventional yeasts. Manuscript. 2 Summary Fungi produce a variety of volatile organic compounds (VOCs) during their primary or secondary metabolism and with a wide range of functions. The main focus of this research work has been put on flavour molecules that are produced during fermentation processes, mainly esters and alcohols derived from the catabolism of amino acids. These compounds are produced by the Ehrlich pathway. The conversion of amino acids into aroma alcohols is accomplished by three enzymatic steps: i) a transamination, ii) a decarboxylation and iii) a dehydration reaction. The transaminase and decarboxylase enzymes are encoded by the ARO gene family which represents a widely conserved set of genes in the Saccharomyces clade. Comparative genomic analysis revealed conservation of these genes also in the riboflavin over producer Ashbya gossypii, a closely related species belonging to the Eremothecium clade. ARO80 is a transcription factor that represents the key regulator of the ARO gene family. The first part of the thesis will unveil the ARO80-dependent regulation of the Ehrlich pathway in both Saccharomyces cerevisiae and A. gossypii. Promoter analyses of the ARO genes in S. cerevisiae showed that the ScARO9 promoter region is directly regulated by the ScAro80 transcription factor. This interaction has been used to create a lacZ-reporter system to correlate the formation of two volatile compounds, 2phenylethanol and 2-phenylethyl acetate in yeast with ARO9 expression levels. This indirect genetic assay also provides a tool for the prediction of volatile production in other Saccharomyces sensu stricto species. It can be used to screen a large number of strains for their flavour production within a short time and with low costs and effort. In Ashbya single mutations in the ARO genes led to a strong reduction in volatile production, especially in the amount of isoamyl alcohol and 2-phenylethanol. In contrast, the overexpression of the transcriptional regulator AgARO80 did only increase the level of isoamyl alcohol but did not enhance the 2-phenylethanol yield. Promoter analyses of the ARO genes in A. gossypii identified both ARO8 and ARO10 to be activated by Aro80. In this study we further analyzed the aroma profile of another Eremothecium species, Eremothecium cymbalariae. This species lacks most of the ARO genes involved in amino acid catabolism. The only ARO gene present in E. cymbalariae is a homolog of the A. gossypii ARO8a, which is a non-syntenic homolog of ARO8 in yeast. We compared the VOC profiles of both species in order to investigate the consequences of their different gene set up on their 3 flavour profiles. Here we found that in contrast to A. gossypii E. cymbalariae does not produce 2-phenylethanol and 2-phenylacetate. The last part of this thesis presents the initial characterization of twenty non-conventional yeasts (NCY) and their potential application in fermentative processes. These strains have been selected as they have been previously isolated from various fermented food sources. This selection of strains was used in fermentations with the aim of identifying new interesting flavour producers. Fermentation profiles, volatile analyses, off-flavour identification and resistance to osmotic/oxidative stress have been addressed to highlight new candidates to use for industrial applications. This resulted in the identification of Wickerhamomyces anomalus and Pichia kluyveri as high producers of esters fruity compounds, which contribute to enhance the complexity of wine and beer product. In addition the strain Debaromyces subglobosus showed high yields of aldehydes and fruity ketones, which constitute active aroma compounds in dry cured ham. 4 Resumé Svampe producerer en række flygtige organiske forbindelser (VOC, Volative Organic Compounds) under deres primær eller sekundær metabolisme og med en bred vifte af funktioner. Hovedfokus i dette forskningsarbejde er på flavour molekyler, der produceres under gæringsprocesser, primært estere og alkoholer fra aminosyrers catabolisme. Disse forbindelser dannes under Ehrlich reaktionsvejen. Omdannelsen af aminosyrer til alkoholer opnås ved tre enzymatiske trin: i) transaminering, ii) decarboxylering og iii) dehydreringsreaktion. Transaminase- og decarboxylase enzymer kodes af ARO-genfamilien, som repræsenterer et bredt konserveret sæt af gener i Saccharomyces cladus. Komparativ genomisk analyse viste konservering af disse gener også i riboflavin-overproduceren Ashbya gossypii, en nært beslægtet art, der tilhører Eremothecium cladus. ARO80 er en transkriptionsfaktor, der repræsenterer nøgleregulatoren i ARO-genfamilien. Første del af afhandlingen viser ARO80afhængig regulering af Ehrlich-biosyntesevejen i både Saccharomyces cerevisiae og A. gossypii. Promotor analyse af ARO-generne i S. cerevisiae viste, at ScARO9 promotor-regionen er direkte reguleret af ScAro80 transskriptionsfaktoren. Denne interaktion er blevet brugt til at konstruere et lacZ-reporter-system for at korrelere dannelsen af to flygtige forbindelser, 2-phenylethanol og 2-phenylethylacetat i gær med ekspressionsniveauet af ARO9. Dette indirekte genetiske assay er også et redskab til at forudsige produktionen af flygtige forbindelser i andre Saccharomyces sensu stricto arter. Det kan anvendes til på kort tid og lave omkostninger at screene et stort antal stammer for deres flavourproduktion. I Ashbya, førte enkeltmutationer i ARO gene rned til en kraftig reduktion i produktion af flygtige forbindelser, især i mængden af isoamylalkohol og 2-phenylethanol. I modsætning hertil førte overekspression af den transkriptionelle regulator AgARO80 kun til øget isoamylalkoholdannelse men ikke forøget 2-phenylethanol udbytte. Promotoranalyser af ARO generne i A. gossypii viste at både ARO8 og ARO10 aktiveres af Aro80. I denne undersøgelse analyserede vi yderligere aromaprofilen i en anden Eremothecium art, Eremothecium cymbalariae. Denne art mangler de fleste af ARO generne, involveret i aminosyre catabolisme. Det eneste ARO-gen, der findes i E. cymbalariae er en homolog af A. gossypii ARO8a, som er et ikke-syntenisk homolog af ARO8 i gær. Vi sammenlignede VOCprofilerne i begge arter for at undersøge konsekvenserne af deres forskellige gen-set up på deres smagsprofiler. Her fandt vi, at A. gossypii i modsætning til E. cymbalariae ikke producerer 2phenylethanol og 2-phenylacetat. 5 Den sidste del af denne afhandling præsenterer den indledende karakterisering af tyve ikkekonventionelle gærtyper (NCY, Non-Conventional Yeasts) samt deres potentielle anvendelse i gæringsprocesser. Disse stammer er valgt, fordi de tidligere er blevet isoleret fra forskellige fermenterede fødevarer. Formålet var at identificere nye interessante flavour-producenter. Gæringsprofiler, analyse af volatile forbindelser, off-flvour bestemmelse og modstandsdygtighed mod osmotisk/oxidativ stress er blevet undersøgt for at adressere nye kandidater til brug for industriel anvendelse. Dette resulterede i identifikationen af Wickerhamomyces anomalus og Pichia kluyveri som høj-producenter af frugtagtige esterforbindelser. Disse kan bidrage til at øge kompleksiteten af vin og øl produkter. Desuden viste Debaromyces subglobosus høje udbytter af aldehyder og frugtagtige ketoner, der udgør aktive aromastoffer i tørret skinke. 6 Acknowledgments Sometimes what you need it is a chance to prove yourself and have the courage to make it happen. My PhD experience and this thesis would not be possible without all the support I received to carry out this astonishing scientific opportunity. First, I would like to give my honest and profound gratitude to Prof. Jürgen Wendland to offer me this position. Without his acceptance and thoughtful guidance this PhD would not have been possible. You bet on me even though you could have chosen many other more qualified students. I just want to let you know that your inputs, ideas, supervision and support became important for the success of this PhD project. I am indebted to my academic supervisor Prof. Steen Holmberg because his supervision during my PhD and kindness to examine this thesis. My deepest thanks to the opponents of my PhD defense which have spent time to read this thesis and evaluate my work. I am particularly grateful also to Andrea. We have done so many things together than I do not know where to start. You helped me to settled down and get around here in Copenhagen. You taught me almost all the techniques I acquired during my PhD. We shared funny moments together during conferences and extra work activities. Our LONG discussions were extremely useful to improve my skills and delineate well organized experiments. I have so many things to be thankful that one page would not be enough. I guess my biggest satisfaction was to introduce you the GC/MS technique. That time you were the student and I was the teacher. This turned around situation made me understand all the progress I made thanks to you and Jürgen. The next person I would like to give my gratitude is Prof. Laura Popolo, my previous supervisor at the University of Milan. She trained and offered me a wonderful year experience in her lab during my master thesis. The research work with C. albicans opened my future development, clarified my interests and opened the way to my career decision. You told me about the Cornucopia project and you convinced me to send the application. From that moment on my life changed completely and I will never stop to thank you for encouraging me to take this first step. Klaus, you are like the German Terminator but with less muscles and HUGE brain. Every time Google did not have an answer for me you had one. You are an unlimited source of useful information. If we connected your brain to the server we could also survive without internet connection. Thanks also for bringing up funny stories and topics during our lunches. You have the attitude to have always the right word to say, turning each situation in a pleasant moment. Lisa, I can be the Superman in the lab but you are definitely the Supermom in the daily life! You managed to get a great success during your PhD even though you had a husband and a small daughter to take care of. Apparently all the early mornings did not bother you at all. On the contrary you looked always resolute and full of motivation. Keep going with this attitude and I wish you a bright future, wherever that will be! 7 I have to give my special thanks also to “my girls” Ana and Jevgenia. I have started this PhD path with you two in the office. I will never forget our discussions and the funny moments we shared together. Ana thanks for your IT help. If Neo in Matrix was the chosen one you can be our Neo here at Carlsberg. I will not be surprised if one day I will see a plug behind your skull! Jevgenia, “tusind tak” for supporting my/our research every day. I do not know how many selection plates and YPD media I used that were made by you. You made our daily experience in the lab easier, taking care of the needs of everyone in the group. The word “multitasking” fits perfectly to you! Therese, thanks for the good time in the lab as well as being an inspiration for starting my thesis writing. The experience in Asilomar was the greatest conference ever thanks to you, Ana and Andrea. We had a lot of fun and I will never forget the pleasant and joyful atmosphere you helped to create. Claudia, you do not talk too much but when you show your qualities you are among the best. In our last team building event you brought out your innate talent with the bowling. By keeping a low profile and using a questionable technique you defeated everyone in the group (except Jürgen of course). Thank you too for the good company and the nice discussion we had from time to time. Klara, you were the last one who joined our group but in these few months you shared your honest beer enthusiasm with us. Thanks for helping us with the organization of the FungiBrain workshop. You have been a very irreplaceable resource to coordinate all the activities and to accommodate the students. I wish you all the best with your PhD project and do not stop to use passion in your work! Claes, thanks a lot with your help with the Danish summary. With my current Danish skills I could have written maximum 2 lines, full of grammar mistakes most likely. Big thanks to Dr. Urska Vrhovsek and her team for introducing me to the GC/MS technique and for hosting me during my stay at the Fondazione Edmund Mach, Research and Innovation Centre (Italy). Your exceptional and high qualified support was extremely important for the success of this PhD thesis. Special thanks also to the entire Carlsberg laboratory for providing a high quality research and exciting work environment. The last three years have been memorable and they will always represent an example of genuine and high scientific research work. I am also deep indebted with the Cornucopia consortium, with all the PIs and organizers of the network. You have done an incredible work with me and all the other PhD students. You have found the right mixture of good scientific spirit and social activities to make this journey precious. A special gratitude to Prof. Jure Piskur who was the coordinator and main organizer of the EU-project. Your scientific mood will always be with us as well as the funny moments you promoted. A particular note also to all the PhD (and non) fellows in the Cornucopia consortium. Anna, Jiří, Nerve, Honeylet, Md, Alicia, Amparo, Ida, Raquel, Benjamin, Dorota and Jana 8 you helped to make these three years’ experience brilliant and extraordinary. We shared worries, doubts, happiness, stress, connections, interests, information and much more. Thanks to all of you for making every Cornucopia workshop a pleasant event. Lucia, ci siamo conosciuti all’inizio di questa esperienza. La tua permanenza doveva essere breve ma il destino ha voluto che restassi e condividessimo preoccupazioni e gioie. A dire il vero abbiamo pure finito con il condividere la lavatrice ma questa è tutta un’altra storia. Grazie di essere sempre stata un’ottima amica nonostante i miei continui scherni. Sappi che sei stata di grande aiuto in tutto, anche se a volte posso non averlo dimostrato come dovevo. Spero vivamente che tutti i tuoi sogni si realizzino e che in un modo o nell’altro tu riesca a capire che non sei proprio “brava” come pensi nelle attività manuali! :-P Solfa, Andrea, Sara e Conzi che dire... voi siete senz’altro i numeri 1. Mi avete assistito e supportato fin dal principio di questo viaggio. Mi siete stati accanto nelle lunga distanza ma soprattutto nei miei ritorni a casa. Senza di voi restare qui sarebbe stato impossibile. I bei trascorsi passati insieme mi sono stati di conforto negli ultimi anni, aiutandomi a superare momenti “bui” che avrebbero potuto farmi vacillare. Restate come siete, vi voglio bene. Frank, io e te siamo cresciuti insieme e abbiamo condiviso tante di quelle cose che manco me le ricordo tutte. Comunque per dovere di cronaca io me ne ricordo più di te di sicuro! Ad un certo punto le nostre strade si sono divise...ma è più forte di noi, non esiste che ci perdiamo di vista. Finchè al cinema ci saranno film inutili da vedere noi dobbiamo andarci. Siamo come Frodo e Sam, non esiste che ci separino. Grazie di essere come sei e volerti bene mi sembra quasi scontato dopo tanti anni! Papà, mamma, sorellina, nonne, Piero e bodolino. Nessuno più di voi ha supportato questa insolita esperienza. Non so neanche da che parte cominciare con i ringraziamenti. Siete le colonne portanti della mia vita, quindi PhD o meno voi avrete sempre il mio amore e la mia gratitudine. Mi siete mancati moltissimo in questi anni e Dio solo sa quanto vi avrei voluto qui accanto a me. Niente di tutto ciò che sono sarebbe stato possibile senza il vostro aiuto. Grazie di T-U-T-T-O!!!!!! 9 Abbreviations ADP Adenosine diphosphate ATP Adenosine triphosphate bp Base pair ChIP Chromatin Immunoprecipitation DNA Deoxyribonucleic acid FAD Flavin adenine dinucleotide FFA Free fatty acid FID Flame ionization detector GC-MS Gas chromatography–mass spectrometry kb Kilo base pair NAD Nicotinamide adenine dinucleotide NADP Nicotinamide adenine dinucleotide phosphate NCY Non-conventional yeast PCA Principal component analysis PCR Polymerase chain reaction pFA plasmid for Functional Analysis pKa Logaritmic acid dissociation constant PUFA Polyunsaturated fatty acid RNA Ribonucleic acid SPME Solid-phase microextraction TCA Tricarboxylic acid cycle TCD Thermal conductivity detector TF Trascriptional factor VOC Volatile organic compund X-Gal 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside 10 1. Introduction 1.1 The Fungi Kingdom Fungi are eukaryotic, heterotrophic organisms, encompassing both single-celled yeasts and multi-cellular filamentous fungi. Their existence is strictly linked to the decomposition of organic material. Many fungal species can survive in oligotrophic environments, scavenging nutrients from the substrate which they colonize [1]. With over 900 million years of evolution the Fungal Kingdom shows an enormous evolutionary and biological diversity [2] (Figure 1). Mycologists have classified fungi into four groups according to their sexual reproduction and molecular structure: chytridiomycetes, zygomycetes, ascomycetes and basidiomycetes. chytridiomycetes occupy a wide range of natural habitats and today represent the most ancient phylum of fungi present on earth [3]. Unlike the others, chytridiomycetes produce zoospores, motile spores propelled by a flagellum which allows them to move towards light or chemical stimuli [4]. Basidiomycetes contain about 30,000 described species and are best known for the production of large fruiting bodies. Most of the fungal body is made of the mycelium, which constitutes the vegetative part of the fungus. The fruiting bodies, the mushrooms, are the results of sexual reproduction and are normally the visible part of the fungus. zygomycetes, which encompass most of the organisms we define as “molds”, typically grow inside their food. They can reproduce sexually and asexually, through a process that is light governed. Their rapid asexual reproduction involves the formation of sporangia and sporangiospores. The presence of sporangia and unseptate hyphae represents a common feature in this class of fungi [5]. The ascomycota is the most studied phylum, and accounts for approximately 75% of all described fungi. Their defining feature is the ascus, a sexual structure in which non-motile ascospores are produced. However, asexual reproduction is the most common form of propagation, responsible for the rapid spread of these fungi into new areas or the conquest of short-lived [6]. The phylum harbors very diverse organisms and includes a number of industrially relevant fungi (i.e. Saccharomyces cerevisiae, Penicillium chrysogenum) but also plant pathogens (i.e. Magnaporthe grisea, Cryphonecrita parasitica, Fusarium oxysporum) and human pathogens (i.e. Candida albicans, Aspergillus fumigatus, Coccidioides immitis). Ascomycetes have gained great importance especially as producers of antibiotics and in food production (bread, beer, wine, cheese, etc.). 11 Figure 1. Phylogeny of the fungal kingdom. The diamonds represent evolutionary branch points and indicate approximate time points. The colored lines define the major fungal groups [7]. 1.2 Ascomycota: The Saccharomycotina clade The ascomycota, or sac fungi, are the largest monophyletic phylum of Fungi, with over 64,000 species [8]. Molecular phylogenetic analyses of nuclear and mitochondrial ribosomal RNA divided them into three main groups: 1) Schizosaccharomyces and Protomyces; 2) ‘filamentous fungi’ (Pezizomycotina); and 3) budding yeast (Saccharomycotina) [7]. This last group comprises yeasts and is home to the most commonly known fungi. Numerous studies have examined the phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ (Figure 2). Multigene sequence analysis resolved 75 species into 14 clades [9]. 12 Figure 2. Phylogenetic tree resolving species of the ‘Saccharomyces complex’ into 14 clades [9]. S. cerevisiae (Clade 1) is part of the Saccharomyces sensu stricto complex, which includes S. paradoxus, S. mikatae, S. cariocanus, S. kudriavzevii, S. arbicola, S. eubayanus and S. uvarum. Among them stable interspecies hybrids are common and widely used in wine, cider, and beer industry. Yeast hybrids share multiple origins, harboring chimeric allopolyploid genomes with different ratios of their parental genomes. The hybridization event may have taken place in the production environments during the domestication of the strain under manmade selection conditions or could occur in nature (Figure 3) [10] [11]. 13 S. cerevisiae S. cerevisiae x S. kudriavzevii S. paradoxus S. mikatae S. pastorianus S. kudriavzevii S. carlsbergensis S. arboricola S. eubayanus S. bayanus S. uvarum Figure 3. Saccharomyces sensu stricto complex and hybrids [12] The genetic constitution of these hybrids offers the advantage to acquire physiological properties from both parents, generating strains better suited for extreme environmental or production conditions. Yeast breeding and selection processes have been used to improve industrial strains , e.g. by generating strains with novel flavours, cold adapted hybrids with higher fermentation rates or osmotolerance [13] [14]. The first Saccharomyces interspecies hybrid identified was the lager brewing yeast S. pastorianus (S. carlsbergensis). Initially named Unterhefe No. 1 by Emil Chr. Hansen the hybrid has been used in beer production since 1883. The introduction of this hybrid as pure strain in beer industry revolutionized the production process completely, stabilizing and improving fermentation performance [15]. Later, other yeast hybrids have been discovered and characterized. S. cerevisiae × S. kudriavzevii hybrids are widely used in wine and brewing production [16] [17]. S. cerevisiae × S. bayanus yeasts often appear in wine, cider and brewing production. They favor to preserve the S. bayanus-like genome and reduce the S. cerevisiae part [18]. Furthermore, S. cerevisiae × S. paradoxus natural and artificial crosses have been documented [19] [20]. In the natural isolates introgression occurred and rare progeny was found due to post zygotic isolation [21]. In conclusion, Saccharomyces yeasts and their hybrids represent key resources in different industrial processes. Their existence inspired new molecular genetic studies, offering new insight into the evolution of genomic variation and genomic architecture. 14 This study will focus not only on representatives of clade 1 but also on other clades: clade 13 with Hanseniaspora as representative genus; clade 9 with Torulaspora; clade 7 with Zygosaccharomyces species and clade 12 with Eremothecium species. The Eremothecium genus contains attractive study models and industrially important species, which will be described below in more detail (Paragraph 1.4). Among the Saccharomycotina I will also consider other species such as Candida, Kazachstania, Pichia, Wickerhamomyces and Kluyveromyces, which are not represented in Figure 2. 1.3 Saccharomyces cerevisiae: the model organism Saccharomyces cerevisiae with its intrinsic ability to ferment sugar into carbon dioxide and ethanol has gained a central role in food industry in being a leavening agent for bread and a producer of alcoholic beverages [22]. The use of fermentation, particularly for beverages, has existed since the Neolithic era. The oldest archeological evidence has been documented dating from 7000–6600 B.C. in Jiahu, China (Figure 4) [23]. Even without any deeper knowledge about the process, early human societies could use the combined leavening action of yeasts and bacteria (i.e. sourdough). Around the 19th century bakers had started to use the yeasts from beer brewers by collecting them after wort fermentation [24]. As consequence of that the bread started to have a sweet note, lacking the sourness acquired by co-fermenting with Lactobacilli. In the late 1700 Antoine Lavoisier was the first who tried to describe the fermentation process identifying the raw material necessary for the process: sugar, water, and “ferment” paste [25]. At that time the fermentative process was considered a simple chemical reaction where the “living material” had only a secondary role. In the second half of the 19th century, Louis Pasteur proved that alcoholic fermentation was the result of a microbial process (Figure 4) [25]. In 1857 Pasteur showed that lactic acid fermentation is also caused by living organisms and some years later he defined fermentation as a “form of life without air” (“Pasteur effect”). By the early 1900s still no one could exactly explain the biochemistry of the process until the German chemist Eduard Buechner could ferment a sugar solution by using the first “yeast-extract” ever made. He proved that “cellular machineries” inside microorganisms are able to catalyze all the chemical reactions that occur inside the cell [26]. Enzymatic studies followed and scientists began to analyze and purify the components of cell-free extract. Eduard Buchner detected the active components of the cells extract, coined them as “zymase” in 1897 (Figure 4). Some years later Arthur Harden and William Young could distinguish two fractions of yeast extract: i) A high molecular weight and heat sensitive fraction, which contained mainly enzymes; and ii) a low molecular not heat 15 sensitive fraction, which was enriched in cofactors (i.e. NAD, NADH, NADP,ATP, ADP, etc.). A major breakthrough in enzyme research was then reached after the 1940s when Otto Meyerhof and Luis Leloir resolved details about the glycolytic pathway, showing the complexity of an enzymatic pathways for the first time [27] [28]. Another important milestone in the history of fermentation was the definition of the Crabtree effect by the English biochemist Herbert Grace Crabtree [29]. This effect can be described as the production of ethanol in aerobic condition instead of the production of biomass via the tricarboxylic acid cycle (TCA). This mechanism clearly denies the “Pasteur effect” described above. At high glucose concentrations and in the presence of oxygen, S. cerevisiae and other Crabtree positive yeasts first consume the glucose and then start consuming the by-product ethanol when the glucose is depleted. This mechanism is now known to be controlled by glucose repressing respiratory enzymes (e.g. Mig1), which control sugar metabolism and glucose transport activity [30]. Several authors speculated that the origin of the fermentation mechanism and the relative molecular controls are linked with the origin of modern plants with fruits, at the end of the Cretaceous age, more than 125 million years ago [31]. In this environment the competition for fruit sugars started among the microbial communities. The Crabtree effect could have been a strategic solution for yeast to outcompete bacteria. By sacrificing biomass, the production of ethanol and the increased glucose uptake would have given yeasts an advantage to secure the carbon source and inhibit the environment from microbial competitors [32]. 16 Figure 4. Timeline showing the major discoveries which have contributed to define the fermentation process. In the 1930s advances in microbiology and biochemistry made it possible to obtain the first mutated yeast by physical and chemical treatment. The easy propagation of yeast cells and manipulation of the genome combined with the simple cellular physiology made S. cerevisiae a model system. Sequencing technologies provided the possibilities to sequence entire genomes, unveiling the comprehensive biological information contained therein. In this genomic era S. cerevisiae was the first eukaryotic species to be completely sequenced [33]. With this knowledge about the genetic material questions about gene regulation, structure-function relationships of proteins and chromosome structure could be answered [34]. Moreover, the finding that 40% of yeast proteins share part of their primary amino acid sequence with the corresponding human protein indicate that genes and functions are widely conserved in certain processes [35]. For instance, human and yeast HMG-CoA reductase proteins are 66% identical. They are responsible for starting the steroid biosynthesis in both species. Even though yeast does not produce cholesterol the yeast proteins can function in the human cholesterol biosynthesis pathway [36]. The yeast receptor Ste2 is involved in the recognition of α-mating factor. A similar protein is found in human called β-adrenergic receptor which functions as a regulator of the blood 17 pressure [36]. Overall many secretary proteins, heat-shock proteins, G-proteins and transcriptional factors of yeast show homologs in the human genome and have similar function in both species. This relationship can be used as a powerful tool to unveil the function of unknown sequences of human and other higher eukaryotic genes [37]. Even though S. cerevisiae has played a central role as a model organism as far back as the early 1900s it is just one representative of the entire yeast community. Most of these species were described in the last 20 years (i.e. sensu stricto species), but the yeast variety is enormous and new species are discovered continuously [38]. Therefore, studying new species represent a unique opportunity to open and create new research directions, intended to understand more about biological processes or to unveil new industrial applications. 1.4 Yeast carbon metabolism A tightly regulated carbon metabolism is a fundamental requirement for in the fermentation process. Yeast can thrive on different carbon sources but glucose and fructose are favored over others [39]. In yeasts the glucose uptake occurs by facilitated diffusion through the plasma membrane by hexose transporters. These plasma membrane proteins belong to the HXT family where each of them exhibits different glucose affinity depending on the glucose concentration. Their expression is tightly regulated by glucose sensor proteins placed in the plasma membrane. Due to these sensors the expression of the optimal hexose transporters is achieved for the respective concentration of glucose available outside the cell [40] [41]. When yeast is grown on carbon sources other than glucose (e.g. maltose) the sugar is imported into the cell by a proton symport mechanism. This transport requires the establishment of an electrochemical gradient of protons which can only be achieved by depletion of internal ATP [42] [43]. The first step of the glycolytic pathway is the conversion of glucose into glucose-6-phosphate by hexokinases (Hxk1/Hxk2) or the glucokinase Glk1 (Figure 5; 1). This step is the first irreversible step of the glycolysis and results in the retention of glucose inside the cell. In particular, Hxk2 is highly expressed during the growth phase when fermentable carbon sources (i.e. glucose, fructose…) are provided. Hk1 and Glk1 on the other hand are de-repressed when a nonfermentable carbon source (i.e. ethanol, glycerol…) is present [39]. 18 After phosphorylation a series of chemical reactions lead to the formation of pyruvate [44]. Once pyruvate is formed it can be fed either into the respiratory or fermentative pathways (Figure 5; 2). In the respiratory pathway, pyruvate enters the mitochondria where it is converted into acetyl CoA by the mitochondrial pyruvate dehydrogenase enzyme complex [45]. The acetyl CoA is then further oxidized in the tricarboxylic acid cycle (TCA cycle) where it generates reducing power (i.e. NADH and FADH) necessary for the final production of ATP (Figure 5; 3). Since TCA intermediates are also used as building blocks to generate biomass, several anaplerotic reactions are available to ensure a proper flux in the TCA cycle. An example of an anaplerotic reaction is the enzymatic conversion of pyruvate into oxaloacetate, which can directly enter the mitochondria [44] (Figure 5; 4). In fermentative conditions the pyruvate is decarboxylated into acetaldehyde and - depending on the redox status of the cell - it can follow two fates. Acetaldehyde can be reduced to ethanol by the enzyme alcohol dehydrogenase [46] or oxidized to acetate by aldehyde dehydrogenase [47] (Figure 5; 5 and 6). If we look at the energetic yields, respiration is far more efficient. Fermentation generates only a net of 2 ATP per molecule of glucose, whereas respiration produces 38 ATP in S. cerevisiae. On the other hand, fermentation does not utilize an electrochemical gradient to form ATP, which simplifies the overall redox balance of the cell. Moreover to counterbalance this low ATP yield yeasts increase the glycolytic flux by up regulating glucose transporters. This mechanism ensures a rapid conversion to pyruvate and final fermentation products, producing enough ATP to allow cell growth [48]. 19 Figure 5. Schematic overview of the carbon metabolic pathways in yeasts. 1.5 The Eremothecium genus: Ashbya gossypii and Eremothecium cymbalariae The Eremothecium genus was instated by Antonino Borzi (1852-1921) with the description of Eremothecium cymbalariae in 1888 [49]. The genus has been assigned to clade 12 (Figure 2) of the ‘Saccharomyces complex’ [9] and shows interspecific divergence [50]. It contains seven members: Eremothecium gossypii (better known as Ashbya gossypii; [51]; Eremothecium cymbalariae [49]; Nematospora/Eremothecium coryli [52] [53]; Nematospora/Holleya/Erem othecium sinecaudum [52], [54]; Eremothecium ashbyi [55]; Ashbya aceri [56]. 20 Ashbya gossypii Ashbya gossypii is a filamentous fungus, originally isolated from cotton as a pathogen causing stigmatomycosis. The fungus uses insects of the Pyrrohocoridae family as vectors [51]. With today’s use of insecticides fungal infections via insect vectors are less problematic. A. gossypii is mainly used in industry for the production of riboflavin (vitamin B2) [57] [58]. Several studies have elucidated the molecular pathways involved in riboflavin production [59] and aimed at improving the riboflavin yield by utilizing different substrates [60] [61] [62] [63]. The life cycle of A. gossypii starts with the germination of needle-shaped spore and the formation of a spherical germ cell (Figure 6). This stage is characterized by DNA replication, accompanied by an isotropic growth phase. After a switch from isotropic to polar growth a hyphal tip is formed that grows to a juvenile mycelium by lateral branching. The hyphae are compartmentalized into multinucleated cells whose borders are separated by chitin-rich septa. About 20-24 hours post germination hyphal maturation results in the formation of a mature mycelium, which is characterized by an accelerated growth speed and dichotomous branches at the hyphal tips. Upon nutrient limitation, initiated in older segments of a mycelium, hyphae generate sporangia which contain needle shaped spores. The life cycle ends with the formation of 26-30 µm long spores, clumping together via terminal filaments [57].Due to the biotechnological interest in riboflavin production molecular analyses were already started in the 1990s. Molecular studies revealed the identification of an efficient homologous recombination system in A. gossypii [64]. Based on that, efficient gene targeting methods for molecular manipulation have been successfully developed by the Philippsen group [65]. In 2004 the A. gossypii complete genome sequence was published. Its annotation revealed a large degree of synteny with the genome of the close relative S. cerevisiae [66]. About 95% of all the 4718 protein-coding genes in A. gossypii have a homologue in yeast, indicating that the basic cellular functions and morphogenetic machineries are well conserved [57]. However, the Eremothecium and Saccharomyces genera diverged more than 100 million years ago before the whole genome duplication occurred in S. cerevisiae. This duplication event created about 5000 twin ORFs in the duplicated S. cerevisiae genome, raising the possibility to diverge the function of the duplicates. A. gossypii with its 8.8 million base pairs evolved to a very compact genome caused by the reduction of intergenic regions [50]. 21 Figure 6. A. gossypii life cycle. Isotropic growth phase of the germinated spore (a) is followed by the generation of the first germ tube (b). The formation of the second germ tube is opposite to the first (c). The growing hyphae start the lateral branching pattern (d) before they mature and switch from lateral to dichotomous tip branching with an increased growth speed (from 10 µm/h to 200 µm/h) (e). In older hyphae sporangia formation and hyphal fragmentation occur, and sporulation and breakdown of the ascus walls takes place (f) [57]. The picture in the background of the life cycle shows a juvenile mycelium of A. gossypii stained with Calcofluor white. Septal sites and hyphal cell walls contain chitin and are, therefore, highlighted with the dye. Additionally, it could be shown that the average length of introns (107 bp) is less than half of the average intron size in S. cerevisiae (244 bp) [56]. The ease of genetic manipulation combined with the available genome sequence and industrial interest of the strain made A. gossypii an attractive model for studying the formation and maintenance of filamentous growth and a model for comparative genomics and evolutionary studies [57]. 22 Eremothecium cymbalariae Eremothecium cymbalariae is a close relative of A. gossypii, which was recently sequenced and annotated. Its genome consists of 9,7 million bp encoding for 4712 [50].Both fungi share about 97%of homologous genes. Nevertheless, there are significant differences in their genomes. A. gossypii has only 7 chromosomes whereas E. cymbalariae has 8. The high GC content of 52% in A. gossypii was not found in E. cymbalariae. With 40% GC content it is more similar to that of S. cerevisiae (38.3%) [50]. As for A. gossypii, Eremothecium cymbalariae is a homothallic fungus. [67] In contrast to A. gossypii the spores are produced in aerial sporangia. Additionally, E. cymbalariae is not over producing riboflavin like A. gossypii [50] (Figure 7). Figure 7. Juvenile mycelium of A. gossypii (A) and E. cymbalariae (B). In the upper right corner are displayed the different spores shape of A. gossypii and E. cymbalariae. 1.6 Fungal system and their contribution to industrial processes In the history of mankind fungi have been involved in many processes such as the production of fermented food and drinks. The use of fungi in spontaneous fermentations led to an increase in the shelf life of the food products and to the production of fermented beverages. The consumption of alcoholic drinks may have started as a religious procedure but became very popular and was a way of avoiding water-borne diseases [68]. Later, biotechnological advances provided new ways to use fungi as cell factories [69]. Discoveries and the development of molecular biology provided new insights into biological pathways offering wide applications in the food, chemical, cosmetic and pharmaceutical sector [70]. Nowadays, biotechnological applications are generally preferred over chemical processes. Among others the main reasons are that chemical syntheses often involve environmentally unfriendly production processes coupled with an undesirable racemic mixture of compounds [71]. Advantages of bio-production 23 are the reduced material and energy consumption, increased use of renewable and biodegradable materials, reduced waste generation and the production of more environmentally friendly stereospecific products [72]. Table 1 contains a list of some common industrial application of fungi. 1.7 Aroma and flavour definition, chemical type The word “aroma” derives from Latin and was coined in the 13 century to define “sweet odors”. Also the Greek word “ἄρωμα“describes any “seasonal spice or sweet herb”. “Flavour” on the other hand, derived from the vulgar Latin word flator , literally "that who blows”, and the old French word flaour "smell, odor" (http://www.etymonline.com/). Today flavours are defined as a complex combination of the olfactory, gustatory and trigeminal sensations perceived during tasting (according to the International Organization for Standardization). Nevertheless, the term "flavour" is used to describe different things. Sensory experts use flavour to describe the combination of taste and smell. Flavour chemists typically mean a single aroma, while chefs tend to use it not only on the food per se, but also for its overall presentation on the plate. In many cases the flavouring agents have a defined molecular structure, making food attractive and eating or drinking a pleasure. Flavour substances can be either volatile or non-volatile. The latter consists mainly of carbohydrates, amino acids and fruit acids, and includes taste substances only. The volatile part includes both taste and odor substances, and contains alcohols, esters, acids, aldehydes, amines and sulfur and nitrogen compounds (Table 2). When we compare the relative sensitivity of our senses we realize the big difference between our smell and taste sensitivities. The sense of smell is approximately 10.000 fold more sensitive than our sense of taste [73]. Furthermore, without an appropriate volatile bouquet our food would taste very alike. Hence studying the vast variety of volatile constituents of food and fermented products is of great importance. 24 Application List of compounds Organism Description Food, drinks and fodder Alcohols, pyrazines, ketones Saccharomyces sp., Lactobacillus sp., Brettanomyces sp., Zygosaccharomyces sp., Hanseniospora sp. and Candida sp. Bread, beer, wine, cheese are just a sample of the fermented products produced by yeast fermentation. Metabolic products esters, acids, aldehydes and B group vitamins Ashbya gossypii , Eremothecium ashbyi, Brewer’s yeast Antibiotics: Cephalosporin C, Penicillin, Griseofulvin Penicillium notatum, Cephalosporium sp., Penicillium griseofulvum ImmunoCyclosporin A suppressives: Tolypocladium inflatum Statins: Lovastatin, Mevastatin Aspergillus terreus, Penicillium citrinum Polyunsaturated fatty acids (PUFAs) Morteriella circinelloides Antitumor: Taxol Taxomyces andreanae Pigments Blakeslea trispora, Monascus purpureus Microbial leaching Citrate, Succinate, Oxalacetate Biological control of pathogen Naphthalene, Nitrosoamide Environment protection Depolymerases Oxalate, Citronellal, isabellina, Fungal secondary metabolites are extremely important to our health and nutrition. More and more metabolites are produced by fungal species, some of them modified and optimized by genetic engineering (for istance organic acids, vitamins, antibiotics, steroids). In this category we also find production of enzymes and recombinant polypeptides (insulin, hirudin, statins, taxol) . Mucor Mucor sp., Paecilomyces sp., Penicillium sp., Trichoderma sp., Cladosporium sp., Alternaria and Apergillus sp. Metal-containing ores are percolated with the microrganism. The metal is then solubilized by the fungal metabolism and then extracted or precipitated. Phoma sp., Muscodor sp., Rhizopus sp., Fusarium sp. In oder to reduce the need for chemical compounds is now possible to prepare a mixture of fungal species to control insect pests. Apergillus sp., Pestalotiopsis sp., Mucor sp. Gentically modied fungi have been shown to be able to degrade plastic materials and highly toxic hydrocarbon species Table 1. Sample list of the more common biotechnological application of fungi. 25 1.8 Flavour additives and natural flavours Adding substances to food for conservation, flavouring, or appearance is not a modern-day invention [74]. Before the first refrigeration system was invented, salts were used to preserve meats and fish. Sugar was added to preserve fruits and cloves were placed in hams to inhibit the growth of bacteria [75]. Ancient cultures added sulfites to preserve wine and spices and colorings were used to enhance flavours of foods [74]. Today, there are thousands of food additives found in foods. Functional group Alcohol -OH Source Example Smell Plants Geraniol, linalool Menthol Fresh, floral Mint Aroma-active alcohols > c3 Sweet or pungent Fat Milk products Diacetyl Like butter Cheese Formic acid Capric acid Pungent Like goats’ milk Ester, lactone Solvent (these chemicals are used as solvents) Ethyl acetate Glue -COOR Fruit Methyl/ethyl butyrate Pineapple Amyl/butyl acetate Pentyl butyrate 2-isobutyl-3methoxypyrazine Banana Apricot Aldehyde; ketone -CHO; >C=O Acid (C1-C12) -COOH Pyrazine aromatic =N- Roasted, fermented foods S-compounds: aliphatic, aromatic Vegetables Phenols (mono-, poly-) Smoked food cooked, Earth, spice, green pepper 2-acetyl-tetrahydro-pyridine Diallyldisulphide 1,2-dithiolane-4-carboxylic acid Guaiacol Cresol Popcorn Garlic Asparagus Wood smoke Tarry Table 2. List of the most common volatile compounds and relative perception descriptors (www.scienceinschool.org). The increasing demand for high quality food products made a radical change in food production and technology necessary. Most of the global market is now dominated by processed food which requires food additives to reestablish flavour and taste characteristics. A food additive is defined as “any substance the intended use of which results (…), in its becoming a component or otherwise affecting the characteristics of any food” [76]. Direct food additives are added 26 intentionally to a food for a specific purpose like the sweetener aspartame, sugar or salt which are used to give taste and texture to the products. Indirect food additives are those substances which become part of the food product during the packaging, storage and handling [77]. Direct food additives have different functions: they improve the texture appearance, keep freshness, increase the nutritional contents and improve flavour and taste of the products [78] (Table 3). Due to the increasing number of food additives, the European Economic Community (EEC) established code names to identify food additives. All food additives used in the European Union are identified by an E-number and each food additive is assigned a unique number. The numbering scheme follows precise rules which place the food additive in the respective category (for more details look at the European commission website: http://ec.europa.eu/food/food/fAE F/additives/lists_authorised_fA_en.htm). Typical flavour additives are fruit flavours, sweeteners, cheesy flavours, buttery or roasted flavours, dosed in either natural or artificial concentrations. The difference between them is not at the chemical level. The natural process and the chemical synthesis lead to the same chemical compound. The difference between natural and chemical flavours lies in the source of the flavour. The so called “natural” flavours” are substance obtained by appropriate physical, enzymatic or microbiological processes from material of vegetable, animal or microbiological origin [76]. Food manufacturers often use natural flavours simply because the term "natural" appears healthier to consumers. The result of this trend was a remarkable increase in natural flavour production, reaching a market of $3.5 billion in 2011 and a predicted (http://www.marketsandmarkets.com). 27 market of $5 billion in 2017 Types of food additivies Function Examples Fruit sauces and jellies, beverages, baked goods, cured meats, oils and margarines, cereals, dressings, snack foods, fruits and vegetables Beverages, baked goods, confections, table-top sugar, substitutes, many processed foods Names Found on Product Labels Ascorbic acid, citric acid, sodium benzoate, calcium propionate, sodium erythorbate, sodium nitrite, calcium sorbate, potassium sorbate, BHA, BHT, EDTA, tocopherols (Vitamin E) Preservative Prevent food spoilage from bacteria, molds, fungi, or yeast Sweeteners Add sweetness with or without the extra calories Color Additives Offset color loss due to exposure to light, air, temperature extremes, moisture and storage conditions; correct and enhance natural variations in color Many processed foods, (candies, snack foods margarine, cheese, soft drinks)) FD&C Blue Nos. 1 and 2, FD&C Green No. 3, FD&C Red Nos. 3 and 40, FD&C Yellow Nos. 5 and 6, Orange B, Citrus Red No. 2, annatto extract, beta-carotene, grape skin extract, cochineal extract or carmine, paprika oleoresin, caramel color, fruit and vegetable juices, saffron Flavours and Spices Add specific flavours (natural and synthetic) Pudding and pie fillings, gelatin dessert mixes, cake mixes, salad dressings, candies, soft drinks, ice cream Natural flavouring, artificial flavour, and spices Flavour Enhancers Enhance flavours already present in foods (without providing their own separate flavour) Many processed foods Fat Replacers Provide expected texture and a creamy "mouth-feel" in reduced-fat foods Nutrients Replace vitamins and minerals lost in processing (enrichment), add nutrients that may be lacking in the diet (fortification) Emulsifiers Allow smooth mixing of ingredients, prevent separation Stabilizers Thickeners and Produce uniform texture, improve "mouth-feel" Baked goods, dressings, frozen desserts, confections, cake and dessert mixes, dairy products Flour, breads, cereals, rice, macaroni, margarine, salt, milk, fruit beverages, energy bars, Salad dressings, peanut butter, chocolate, margarine, frozen desserts Frozen desserts, dairy products, cakes, pudding and gelatin mixes, dressings, jams and jellies, sauces Beverages, frozen desserts, chocolate, low acid canned foods, baking powder Sucrose (sugar), glucose, fructose, sorbitol, mannitol, corn syrup, high fructose corn syrup, saccharin, aspartame, sucralose Monosodium glutamate (MSG), hydrolyzed soy protein, autolyzed yeast extract, disodium guanylate or inosinate Olestra, cellulose gel, carrageenan, polydextrose, modified food starch, microparticulated egg white protein, guar gum, xanthan gum, whey protein concentrate Thiamine hydrochloride, riboflavin (Vitamin B2), niacin, niacin amide, folate or folic acid, beta carotene, potassium iodide, iron or ferrous sulfate Soy lecithin, mono- and diglycerides, egg yolks, polysorbates, sorbitan monostearate Gelatin, pectin, guar gum, carrageenan, xanthan gum, whey pH control agents and acidulants Control acidity and alkalinity, prevent spoilage Leavening Agents Promote rising of baked goods Breads and other baked goods Anti-caking agents Keep powdered foods free-flowing, prevent moisture absorption Humectants Retain moisture Salt, baking powder, confectioner's sugar Shredded coconut, marshmallows, soft candies, confections Yeast Nutrients Dough strengtheners and conditioners Firming agents Enzyme preparations Promote growth of yeast Breads and other baked goods Calcium sulfate, ammonium phosphate Produce more stable dough Breads and other baked goods Ammonium sulfate, azodicarbonamide, L-cysteine Maintain crispness and firmness Modify proteins, polysaccharides and fats Gases Serve as propellant, aerate, or create carbonation Processed fruits and vegetables Cheese, dairy products, meat Oil cooking spray, whipped cream, carbonated beverages Calcium chloride, calcium lactate Enzymes, lactase, papain, rennet, chymosin Carbon dioxide, nitrous oxide Table 3. Summary list of the most common food ingredients (http://www.fda.gov) 28 Lactic acid, citric acid, ammonium hydroxide, sodium carbonate Baking soda, monocalcium phosphate, calcium carbonate Calcium silicate, iron ammonium citrate, silicon dioxide Glycerin, sorbitol 1.9 Bioflavour production (Ehrlich pathway, FFAs and lactate) Up to date, plants and animals represent the main source of bioflavours. Nevertheless, these compounds are often produced in low concentration, making extraction, purification and formulation too expensive for the market. Therefore, microbial processes represent a promising frontier, offering de novo flavour synthesis or bioconversion of natural precursors [79]. The ability to produce flavour compounds can be applied in two different ways: i) in situ flavour generation, where the compounds become an integral part of food or beverage (i.e. cheese, yogurt, beer, wine) and ii) specifically designed processes where the obtained aroma compounds are isolated and used later as ‘natural’ additives in food production [80]. Several fungi are able to produce various mixtures of so-called gas-phase or generally named volatile organic compounds (VOCs). Diverse definitions of the term VOCs are in use, depending on laws and government agencies. Biologically generated VOCs can be defined as any organic chemical that has a high vapor pressure at room temperature. Fungal VOCs are mainly derived from secondary metabolism pathways. Due to their small sizes they can be very difficult to detect. Furthermore, VOC profiles are species or strain dependent and can vary according to different parameters such as temperature, micronutrients, oxygen, redox status of the cell, pressure, incubation time, carbon and nitrogen sources and others environmental factors [81]. At the beginning of the 20th century, researchers clarified some of the major biochemical pathways involved in flavour formation and unveiled relationships between a specific microorganism and a desirable mix of flavours [79]. Despite that, flavour yields are often quite low and the limited knowledge about the biochemical pathways and the regulation of key enzymes still represents a bottleneck for novel technologies. In the following paragraphs I provide a brief description of the three main molecular pathways involved in the flavour synthesis in fungi (Figure 8), with emphasis on the catabolism of amino acids and related events in yeast. 29 Figure 8. Schematic representation of the three main pathways responsible for the flavour formation in yeast (modified from [82]). Ehrlich pathway In 1907 the German biochemist Felix Ehrlich (1877-1942) proposed that amino acids were split by a “hydrating” enzyme activity to form the corresponding fusel alcohols, along with carbon dioxide and ammonia [83]. Following work by Lampitt [84], Yamada [85], and [86] [87] could show that the higher alcohols produced by yeast are derived from amino acid catabolism. This pathway, which later was named after its discoverer, Ehrlich, utilizes valine, leucine, isoleucine, methionine, phenylalanine, tyrosine and tryptophan to generate higher volatiles with distinctive flavours (Table 4). 30 Amino acid a-Keto acid Fusel aldehyde Fusel alcohol Fusel acetate Leu 4-Methyl-2-oxopentanoate 3-Methylbutanal Isoamyl alcohol Isoamyl acetate Val 3-Methyl-2-oxobutanoate 2-Methylpropanal Isobutanol Isobutyl acetate Ile 3-Methyl-2-oxopentanoate 2-Methylbutanal 2-Methylbutanol Ethyl pentanoate Phe 3-Phenyl-2-oxopropanoate 2-Phenylethanal 2-Phenyl ethanol 2-Phenylacetate Tyr 3-(4-Hydroxyphenyl 2-oxopropanoate 2-(4Hydroxyphenyl) ethanal 2-(4Hydroxyphenyl) ethanol 2-(4Hydroxyphenyl) ethanoate Trp 3-(Indol-3-yl)-2oxopropanoate 2-(Indol-3-yl)ethanal Tryptophol 2-(Indol-3-yl) ethanoate Met 4-Methylthio-2oxobutanoate Methional Methionol 3-(Methylthio) propanoate Table 4: The Ehrlich pathway intermediates (modified from [88]). The catabolism of the amino acids is characterized by three enzymatic steps: including a transaminase, a decarboxylase and an aldehyde dehydrogenase reaction (Figure 9). Although this pathway has been discovered a century ago little is known about the metabolic and genetic regulation of each step. Furthermore, it is still unclear why these secondary metabolites are produced since yeast could use the amino acids for its protein synthesis instead. Several publications consider the higher volatile production as a way to remove toxic compounds from the cell, to help maintaining the NADH/NAD+ ratio and redox balance [89] or to balance the cells nitrogen sources [90] [91]. Furthermore, volatiles are also known to be important signal molecules used as attractants to insect which are then used as vectors for dispersal [92]. 31 Figure 9: The Ehrlich pathway. The three enzymatic reactions responsible for converting aromatic and branched-chain amino acids into aromatic compounds (modified from [88]). Respective genes of S. cerevisiae are listed aside for each enzymatic reaction. Increasing demand for natural flavour compounds, such as 2-phenylethanol, isoamyl alcohol and their respective esters has led to a new interest in research to investigate this pathway in order to control the flavour production in fermented products. The first transamination step of the catabolic degradation of amino acids via the Ehrlich pathway is controlled by four genes, namely BAT1, BAT2, ARO8 and ARO9. BAT1 and BAT2 encode mitochondrial and cytosolic amino acid aminotransferases, respectively. The expression of the mitochondrial enzyme Bat1 is higher in the exponential phase of growth whereas the cytosolic Bat2 is preferably expressed during stationary phase [93]. Recent studies demonstrated the fundamental importance of BAT2 during flavour production. Overexpression and deletion of this gene resulted in a drastic increase or reduction of the level of higher volatile compounds, respectively [94]. The two additional aminotransferases ARO8 and ARO9 are not specifically expressed in distinct growth phases only. However, little is known about the regulation of ARO8 or ARO9 [88]. The second reaction of the Ehrlich pathway is a decarboxylation step. This step can be performed by five thiamine diphosphate (TPP)dependent decarboxylases, namely Pdc1, Pdc5, Pdc6, Aro10, and Thi3. Presumably, each 32 decarboxylase has an α-keto acid specificity but to date there are no convincing results available. Only Aro10 seems to have a broad activity towards α-keto acids [88]. The third step of the Ehrlich pathway is a reduction/oxidation. This step is strictly dependent on the growth condition. Under anaerobic condition yeast cells have excessive production of NADH. The Ehrlich pathway may then guarantee an efficient NAD(P)+ regeneration. The cellular redox status is most likely the major factor that controls the ratio of fusel acid or fusel alcohol production. In the S. cerevisae genome six aldehyde dehydrogenase and 16 alcohol dehydrogenase genes are found. Unfortunately, glucose-limiting chemostats with phenylalanine, methionine, or leucine as the sole nitrogen source did not show conclusive results of their regulation since these enzymes strongly overlap in their function [95]. Transcriptional and post-transcriptional regulation of the Ehrlich pathway genes is poorly understood. ChIP–chip experiments (chromatin immuno-precipitation on a microarray) revealed that ARO80 is the main transcription factor (TF) that regulates the expression of the ARO9, ARO10 and ARO80 itself [96]. Other approaches e.g. in vivo studies confirmed this regulation pattern [97]. Aro80 belongs to the Zn2Cys6 family of transcription factors known to bind palindromic elements. Recent literature reveals several ARO80 binding sequences which are all different and unique binding site [96] [98] [99]. Although the DNA binding motive is unclear all studies agree on the Aro80-dependent expression of ARO10 and ARO9. Once volatile compounds are made they are transported out of the cell. The export of higher alcohols might occur by simple membrane diffusion, although the ATP-dependent transporter Pdr12 seems to be involved in the export of weak organic acids [100]. Fatty acids as substrates for flavour formation Free fatty acids (FFAs) are considered important precursors for different varieties of volatile compounds, especially in the flavour development of cheese. Lipolysis is an important biochemical step in cheese ripening. In particular the process is essential in Italian cheese varieties and blue mold cheeses. Indeed, milk-fat contains high concentration of short and intermediate triglycerides which then can become free after hydrolysis. Lipases in cheese can originate from several sources: milk, starter bacteria or fungi but also lipase preparations. Lactococcus sp. has a weak lipolytic capability but if present in high numbers can be responsible for the liberation of high levels of FFAs. In contrast, Penicillium sp. exhibits high levels of 33 lipolytic activity and is responsible for the distinctive lipolysis in mold ripened cheeses [82]. As shown in Figure 10 FFAs are the precursors for a number of flavour molecules. Figure 10. General pathways for the catabolism of FFAs (modified from [82]). Floral and fruity lactones are the results of a spontaneous intramolecular esterification of hydroxyl fatty acids. For instance, γ -and δ -lactones contribute to a peculiar peach note in Cheddar cheese. FFAs can also interact with alcohols to yield long chain esters. In Emmenthal cheese fourteen different esters have been found and in the Italian Parmiaggiano Reggiano up to 38 esters, suggesting their importance in the final product [82]. Metabolism of lactate and citrate Lactose is the starting fermenting substrate and the major carbon sources in food industry applications. For example, the dairy processing starts with certain starter bacteria (Leuconostoc sp., Lactococcus sp., Clostridium sp.) able to metabolize the lactose into a racemic mixture or Lor D-lactate (Figure 8). The lactate is then utilized by bacteria to produce mainly propionate, acetate and CO2. Acetate and propionate contribute to the flavour of the cheese whereas carbon dioxide is important for the “eye” formation in the cheese, the typical holes found in Emmenthal and Swiss-type cheeses [82]. Camembert and Brie are the results of mixed-fermentation of bacteria and fungi. Initially lactic acid bacteria release lactate which is rapidly metabolized by fungi such as Debaryomyces hansenii, Geotrichum candidum, Penicillium camemberti [101]. The role of the fungi is to convert the lactate into CO2 and water, and therewith to increase the pH at the cheese surface. Deacidification is an important step during cheese production, because it allows growth of coryneform bacteria involved in the ripening and flavour maturation of many 34 cheeses. Furthermore, the alkaline pH on the surface makes the final maturation step possible that is carried out by Penicillium camemberti in Camembert cheese. In this last part the amino acids released from the casein are converted into NH3 and fruity esters [82]. As mentioned earlier citrate is a key intermediate in the TCA cycle but it is also one of the constituents of milk (ca. 8 mmol∙L-1). Further, citrate is present in fruit juices, vegetables and is generally added as a preservative to foods. In nature, only a limited number of bacteria are able to ferment citrate [101]. Generally, it is not used as a carbon source but it is metabolized together with lactose and other carbon compounds. The products of the citrate metabolism are 4-carbon compounds, diacetyl, acetate, acetoin and 2,3-butanediol. Diacetyl is well studied and usually produced only in small amounts (1-10 µg∙mL-1 in milk) [82]. In cheeses and yogurts it has a very positive effect on the aroma profile because it gives the typical buttery note to the final products. In contrast, diacetyl is considered an off-flavour in lager beer production when it exceeds a concentration higher than 0,15 ppm [102]. 1.10 Biological properties of quorum sensing molecules and VOCs as signaling molecules Biofilm formation and morphological development are controlled by the exchange of chemical compounds, better known as quorum-sensing signals. When a quorum sensing molecule reaches a critical concentration, the entire population of a species reacts by activating specific target genes. For instance, yeasts grown in the presence of isoamyl alcohol, one of the major alcohols produced during beer/wine fermentation, induce pseudohyphal growth [103] [104]. The effect is not limited to this alcohol alone, since 2-phenylethanol, another compounds derived from the amino acids catabolism, seems to affect morphogenesis as well and induces invasive growth [105]. The same two compounds are produced in low concentration also in Candida albicans and Candida dubliniensis. In these species they participate in the dynamics of biofilm formation [106]. However tyrosol and farnesol are the main extracellular molecule which controls mycelia development in C. albicans. Tyrosol stimulates germ tube formation, whereas farnesol act as an inhibitor of mycelia development [107] [108]. When both signals are present the farnesol is dominant over tyrosol [109]. Further, volatiles and several flavouring molecules are known to be used as biological signals for communication. Many fungal-insect, fungal-fungal, fungal-bacterial and fungal-plant interactions have been discovered in a broad range of disciplines. For practical reasons very few 35 studies have been done using gas phases, assuming that the physical state of the compounds only matters the critical dosage necessary to trigger an effect. Furthermore VOCs produced by a given fungal species can raise different responses, depending on the environmental context. The classical example is the ubiquitous fungal volatile 1-octen-3-ol. In Aspergillus nidulans this C-8 compounds acts as inhibitor of conidiation when it reaches high concentrations. It is a selfcontrol system to steer the asexual reproduction. The inhibitory effect is reversible since conidiospores could normally germinate when the 1-octen-3-ol was removed [110]. When Arabidospis thaliana is exposed to 1-octen-3-ol the plant’s defense mechanisms become active [111] blocking the expansion of the pathogen, Botrytis cinerea, on infected leaves. In insects, the C-8 alcohols production by wood-decay fungi stimulate the reproduction of the conifer feeding bark beetle, and inhibit the growth of their natural predators [112]. Furthermore, the R enantiomer of the 1-octen-3-ol is commercially known as “roctenol” and is widely used as insect attractant [113] [114]. Even though fungal volatiles are generally perceived as attracting agents for insects, they can also act as repellents. Oviposition of female houseflies is blocked in substrates infected by Fusarium, Phoma, Rhizopus, and other fungi. The VOCs responsible for this reaction are dimethyl disulfide, phenylacetaldehyde, 2-penylethanol, citronellal, and norphytone [115]. Bacillus nematocida is an interesting example of bacterial predation against nematodes. It produces the worm attracting, volatile, organic compounds benzaldehyde and 2-heptanone. The secretion of these bacteria attracts the nematodes and once in the nematode guts they produce proteases leading the host to death [116]. Moreover, several fungi are known to establish symbiotic interactions with plants as mycorrhizae. Gas phase molecules can easily diffuse in cavity of the soil, reach far distances and produce intermediate molecules to promote interspecies interactions. This mutualistic relationship between fungi and plants is dynamic and controlled by different stimuli such as nitrogen to phosphate ratio, abundance in the soil, soil moisture, etc. Advantages of such mycorrhizal interactions are an increased nutrient uptake and resistance to pathogen attacks [117]. In conclusion, these small metabolites produced by a variety of organisms are responsible for a number of biological activities and interactions. Many of them are still poorly understood and need to be investigated. Presumably, technological advances and further research will elucidate more of these chemical interactions, offering new prospective for applied disciplines. 36 1.11 Biotechnological application of fungal VOCs Beside their role in biological activities VOCs have also an enormous potential in biotechnological applications. In agriculture they can be used as biocontrol compounds, reducing fungicides applied on crop plants. Precisely designed mixtures of volatiles are able to inhibit plant pathogens [118]. The advantage of using small volatile compounds lies in their ability to travel long distances and infiltrate in the soil pores. For instance, the non-pathogenic Fusarium oxysporum MSA35 lives in association with a consortium of ectosymbiotic bacteria. This association is able to suppress Fusarium wilt of pathogenic F. oxysporum. It has been shown that the volatiles emitted by the fungus-bacteria consortium are able to modify the mycelia surface of another pathogenic Fusarium isolates [119]. Another example is Muscodor albus which is able to inhibit the growth of the broccoli pathogen Rhizoctonia solani and the pathogen Phytophthora capsici, which cause root rot in bell pepper [120]. Mixture of volatiles from M. albus can also be used in non-agricultural applications, for instance in controlling and significantly reducing common building molds [121]. Also, it has been discovered that a number of antifungal volatiles are active against several human pathogens [122] [123], and this may offer an additional alternative to fight against drug resistant strains. Recent evidence suggests that single VOCs are generally not effective [124] [125]. Organic volatile mixtures are more predominant making it necessary to decrypt this chemical complex to achieve the antifungal activity observed in vivo. The analysis of these VOC mixtures could also become useful in medical areas to identify bacterial, viral and fungal infections in the lungs [126]. Characteristic volatile mixture can serve as biomarkers to assess human infections by using rapid and non-invasive techniques [127]. VOC emissions can also be used to mimic flower essences to attract pollinating insects and facilitate pollen transfer [128]. By using mixtures of volatiles that are normally produced by fungi to attract and promote their dispersion nature, scents can be created to increase yields of fruit and seed crops [129]. Botanophila flies, which are the common vectors for the endophytic fungal genus Epichloë, are attracted by a volatile sesquiterpenoid alcohol, and a methyl ester emitted by the fungus [130]. Additionally, fungal VOCs can be applied for their insecticidal activity. An example is naphthalene produced by Muscodor vitigenus, an endophytic fungus which colonizes the Amazonian plant Paullinia paullinioides. This compound was initially used in “moth balls” due to its effective functions as insect repellent [131]. In the last years VOCs have also been considered as biofuel precursors or additives. Many organic volatiles derived from saprotrophic fungi, including alcohols, alkanes, alkenes, esters, ketones, sesquiterpens, propylene, ethane, are similar to biofuel target compounds [132] [133] [134]. But only very little information is available concerning the 37 pathways involved. New studies including metabolomic and transcriptomic data are now trying to correlate and clarify which genes and enzymes are involved in the production of these hydrocarbon compounds [135]. 1.12 Fungal VOC collection and detection VOC collection The intrinsic small nature of VOCs and their low concentrations make them very difficult to characterize and study. In addition, fungi produce very complicated mixtures of volatiles which require powerful separation technologies to unravel this complicated composition of organic compounds. Depending on the application and the chemical nature of the volatile of interest, different sample preparation, separation, identification, and quantification methods can be applied. At present, gas chromatography-mass spectrometry (GC-MS) is the traditional technology applied because it combines efficient separation methods with highly sensitive detection capabilities and precise quantification (up to part-per-billion/trillion) (Figure 11). Sampling and trapping of the VOCs is the initial critical step of the analysis. Each sampling method has its own advantages and disadvantages, the choice should be made according to chemical nature of the analyte(s) and the concentration in the gas mixture. The goal is to prepare an extract that is representative for the original sample. Chemical instability, variation in volatility and matrix composition are the main factors which have to be considered in this process. In general the extraction methods can be separated into two classes: adsorbing and solvent extraction methods. In adsorbing techniques a fiber/membrane is used which traps and collects volatile compounds present in the headspace. No sample preparation is required for the headspace sampling. It can be done either for liquid or solid samples. Besides, gradients of temperature and an inert gas flow can be applied to improve the sampling of the headspace. Various fibers are available on the market coated with different selective properties, depending on the polar character of the analyte(s). Among the different absorbing materials are charcoal filters, Tenax and Super Q fibers are the most frequently used. In all cases the volatile compounds released from the sample are trapped and concentrated into the absorbing material. Later thermal desorption is applied to release the organic compounds into the GC-MS system. Recently, trapping procedures using the solid phase micro-extraction (SPME) fiber technique have become a popular method in several contexts [136]. The technique combines extraction, concentration and introduction of the volatiles into one automated step, offering the advantage to directly profile living fungal cultures [137]. Steam distillation extraction (SD) and liquid38 liquid extraction offer the advantage to extract volatiles that show reduced volatility [138]. Therewith they get separated from the aqueous phase containing proteins and carbohydrates which are not wanted in the GC-MS system. Though, the choice of the organic solvents (i.e. dichloromethane, hexane, pentane) can affect the final VOC profile, excluding highly volatile or early eluting compounds [139]. Already in 1995 Larsen and Frisvad showed that different profiles of fungal VOCs can be obtained by applying varying collection techniques. VOC separation After the extraction step the separation of the volatiles occurs in the GC system. The gaseous compounds fly through a thin column, pushed by an unreactive gas (usually nitrogen or hydrogen). The process is also called ‘mobile-phase’. The chemical components of the VOC mixture have different progression rates into the column (‘stationary phase’), depending on the strength of adsorption. Compounds which have a low affinity with the column are eluted first and vice versa chemicals which establish more interactions with the solid phase are eluted last. The separation process can be optimized by modifying different parameters such as polarity of the column, temperature, pressure of the mobile phase and amount of samples run through the column. VOC detection Once the separation is completed the organic compounds are received and captured by a detector. The flame ionization detector (FID) and the thermal conductivity detector (TCD) are the most common and robust detectors used in combination with GC systems. They can detect a wide range of compounds with a sensitivity of approximately 0.5ng/µL for carbon compounds. Nowadays most of the GC systems are coupled with a mass spectrometer (MS) which acts as the detector. In the MS the compounds eluting from the column are bombarded with high-energy electrons breaking them into charged fragments. These small fragments are separated by their mass to charge ratios (m/z) in the analyzer and produce a spectral pattern unique to the compound. Compounds can then be recognized by using a library of mass spectra. The resulting output of the detector is a chromatogram, based on peaks and areas. The retention time taken from the tip of the peak can be used to identify the compounds. The area below the peak is proportional to the amount of analyte in the sample. A mathematical integration of the peak and a calibration curve then allow a quantification of each compound of interest. 39 Figure 11. Schematic representation of a GC-MS system. 2. Aim This PhD thesis project is part of the EU Marie Curie Initial Training Network Cornucopia. The general task of the program has been to make use of the yeast biodiversity and find new applications for non-conventional species. The goal of this thesis is to give more insight into the molecular pathways, in particular into the Ehrlich pathway, which drives flavour production in fungi. The Ehrlich pathway is a linear and well conserved pathway that converts amino acids into either fusel acids or fusel alcohols. In yeast this secondary metabolism is one of the major routes that contribute to the aroma profile of fermented products. One of the goals of this study was to examine the main genes and their corresponding proteins that are involved in the Ehrlich pathway. In particular, I focussed on the ARO gene family of Saccharomyces cerevisiae. As a result I gained insight into the transcriptional regulation of the ARO genes. This knowledge enabled me to develop a tool that allows the prediction of volatile production in Saccharomyces sensu stricto species that can be used to screen a large number of strains within a short time and low effort and investment. 40 I further analysed the function of the ARO gene family in Ashbya gossypii, a very aromatically smelling Eremothecium species. In particular, I focused my attention on the key transcription factor of the pathway, ARO80. I could show that the deletion of each of the ARO genes except for ARO8a affects the flavour profile of the fungus. Furthermore, I investigated the volatile compound profiles of the two closely related Eremothecium species, A. gossypii and E. cymbalariae. The purpose was to determine differences in flavour production and relate these profiles to the gene set of the species. Finally, 53 novel flavour producers strains selected within the Saccharomyces clade have been investigated to study their potential for industrial fermentation. For this purpose a high throughput screening of non-conventional yeasts was performed to test fermentation performance and flavour characteristics of these non-Saccharomyces yeasts. 3. 3.1 Objectives and state-of-the-art Functional analysis of the ARO gene family in S.cerevisiae and A. gossypii During the last years several studies have been started to elucidate the genetic regulation of the Ehrlich pathway, however, not with focus on the ARO gene family. ARO8 and ARO9 were initially isolated by the complementation of the phenylalanine/tyrosine auxotrophy [140], and were defined as the aromatic amino acid aminotransferases I and II, respectively [141]. Aro8 is responsible for the phenylalanine and tyrosine biosynthesis and is constitutively expressed. Aro9p, on the other hand, is more a catabolic enzyme and is involved in the tryptophan degradation [142] [140]. However the double mutant aro8/aro9 can be partially complemented by one of the two, suggesting broad substrate specificity and reversibility of the transaminase reaction [140]. The irreversible decarboxylation step was prematurely attributed to the pyruvate decarboxylases, PDC1, PDC5 and PDC6 [143]. Only years later, after combining genetic, physiological, and biochemical approaches, Aro10p was identified as the major decarboxylases of the Ehrlich pathway, showing an overlapping substrate specificity when phenylalanine, leucine, or methionine was used as a nitrogen source [144] [145]. The transcriptional regulation of the ARO genes is mediated by two factors: the amino acids availability and the quality of the nitrogen source. The amino acid activation is controlled by the transcription factor Aro80 [141] [146], whereas the response to nitrogen is governed by nitrogen 41 catabolite repression (NCR) conveyed by the GATA factors Gat1 and Gln3. Optimal conditions for the ARO9 and ARO10 induction are therefore the presence of inducers, aromatic amino acids and the absence of an optimal nitrogen sources like ammonia or glutamine [146]. Only recently, the interplay of GATA activators and the transcription factor Aro80 has been explained in respect of the amino acids catabolism. As shown by Kyusung Lee and Ji-Sook Hahn Aro80 is constitutively bound to its target promoters and is necessary to recruit Gat1 and Gln3 to the Aro80 target promoters. Nevertheless, the binding of the GATA factors is independent of the Aro80 activity and they do not have any influence on the binding of Aro80. Figure 12 shows the proposed transcriptional activation model of ARO9 and ARO10. Figure 12. ARO9 and ARO10 transcriptional control by Aro80 and GATA activators (modified from [146]). Although studies have been done to elucidate the interplay between Aro80 and the GATA factors, still little is known about the precise binding site of Aro80 to the target promoter regions. Several binding sites have been proposed which make the establishment of a consensus sequence difficult [97] [99] [96] [88] [98]. All authors agreed that the binding should be in proximity of the CCG triplets, the typical recognition site for the Zn2Cys6 transcription factor family. In Paper 1 we identified promoter regions of several genes which were more responsive to ARO80 over expression. We co-transformed a plasmid containing ARO80 under control of the A. gossypii TEF-promoter and plasmids containing ARO8, ARO9, ARO10 and ARO80 promoter-StlacZ reporter gene fusions into S. cerevisiae. We measured the β-galactosidase activity and identified the promoter regions which were most responsive to the ARO80 expression level. Based on the assumption that high expression levels of the ARO80 transcription factor results in high activation of the Ehrlich pathway we used the ARO9 promoter to correlate reporter gene activity and flavour formation in yeast. To determine the 42 applicability of the ARo9-StlacZ system as a screening tool we transformed various strains with this ARO9p-StlacZ reporter gene construct. Then we measured the β-galactosidase activities and compared them with the corresponding flavour profiles. The same approach has been used to study the genetic regulation of the conserved ARO genes in A. gossypii. We tested the Aro80 dependent expression of the AgARO genes by applying the same set up described above (Figures 9, Paper 2 and our unpublished data). 3.2 Analysis of the different volatile profiles of A. gossypii and E. cymbalariae is correlated to their genetic backgrounds. The contribution of S. cerevisiae to the aromatic profile of food and beverages is well documented [147]. However the fungal biodiversity has not been explored to its full potential. In Paper 2 we studied the potential use of A. gossypii for flavour production, employing the GCMS technique to explore the complete aroma profile. Comparative genomic analysis has shown a conservation of the key genes of the Ehrlich pathway in A. gossypii, especially the family of the ARO genes. As shown in the Table 5, A. gossypii does not contain the ARO9 gene but we found a duplication of ARO8. The two ARO8 paralogs were named ARO8a (AGR167w, non-syntenic homolog of S. cerevisiae ARO8) and ARO8b (AFR548w, syntenic homolog of S. cerevisiae ARO8). Species Transaminase Decarboxylase S. cerevisiae YGL202W (ARO8) YDR380W (ARO10) YHR137W (ARO9) YLR044C (PDC1) YHR208W (BAT1) YLR134W (PDC5) YJR148W (BAT2) YGR087C (PDC6) AGR167w (ARO8a) ACR211W (ARO10) AFR548c (ARO8b) ACL134C (PDC1) ACL072C (BAT1) AAL073W (PDC6) Ecym_7228 (ARO8a) Ecym_2369 (PDC1) Ecym_7477 (BAT1) Ecym_3186 (PDC6) A. gossypii E. cymbalariae Table 5. Genes contributing to the Ehrlich pathway. 43 To address the metabolic role of the ARO genes for the Ehrlich pathway in A. gossypii, we generated the respective deletion mutants and investigated the overall impact on flavour production. In addition, we also analysed the VOC formation of the closely related specie E. cymbalariae, which does not show the fruity flavour characteristics of A. gossypii. In line with that, E. cymbalariae possess an even more limited set of genes that encode for enzymes of the Ehrlich pathway (Table 5). The same gene setup was observed in L. waltii, where only the transaminase; ARO8a and ARO8b, are present (see Paper 2 for more details). Here, the objective was to present a comparative flavour profile of A. gossypii and E. cymbalariae, in order to extend our knowledge of the Ehrlich pathway and its role in the production of natural flavouring molecules. 3.3 Flavour molecules produced in the Saccharomyces clade. A wide selection of non-conventional yeasts (NCY) has been studied in this thesis. The list contained more than 50 strains encompassing a wide variety of species within the Saccharomyces clade. Compared to previous works our approach was not limited to certain geographical regions [148]. On the contrary, our selection included strains isolated worldwide from different natural sources (i.e. meat, cereals, fruits, cocoa beans, olive, cheese, etc.). The strain repertoire was also based on the previous identification of these strains in fermentation processes [149]. The complete list of strains is shown in Table 1 (Paper 3). All strains were tested on plate assays for their response to stresses (i.e. ethanol, osmolarity and temperature) but also for the production of off-flavours (H2S and phenolic compounds). Furthermore, all strains were tested in fermentation condition and the produced volatiles were sampled by headspace solid-phase microextraction (SPME) and analyzed by gas chromatography–mass spectroscopy (GC–MS). Data mining and statistical analysis software were employed to cluster and highlight species related flavours. 4. Discussion 4.1 Reporter assay for ARO genes in S. cerevisiae and A. gossypii The genetic regulation of the Ehrlich pathway has gained increasing interest in the last years, with respect to the critical role in fermenting processes. Particular attention was paid to the 44 ARO genes family, due to the broad substrate activities of the encoding enzymes. The transcriptional control of these genes depends at least in part on the transcription factor Aro80. Recent studies have proposed the molecular mechanism of this network [146]. However, despite computational predictions and chromatin immuno-precipitation (ChIP) experiments, it was not clearly shown which genes were more responsive to increased ARO80 expression. In addition, previously there was no information available on the regulation of ARO genes in A. gossypii. The ß-galactosidase assay presented in this thesis (see also Paper 1 and Paper 2 for detailed assay information) investigated the potential of AgAro80/ScAro80 to activate target promoter regions (Figure 13). AgARO80 ScARO80 AgARO80 900 1800 800 1600 700 1400 Miller Units Miller Units 1000 600 500 400 300 1200 1000 800 600 200 400 100 200 0 ScARO8 ScARO9 ScARO10 ScARO80 0 ScARO80 AgARO8a AgARO8b AgARO10 AgARO80 Figure 13. A ß-galactosidase reporter assay was used to examine target promoters of AgAro80 and ScAro80 and to quantify the activation of these promoters. Plasmids containing AgTEF1p driven AgARO80 or ScARO80 sequence and plasmids with an ARO gene promoter StlacZ constructs were cotransformed into S. cerevisiae. StlacZ served as a reporter to quantify the activation of the target promoter. In A. gossypii, Aro80 positively regulates the expression of all ARO promoters tested. The highest activation was found for the AgARO8a promoter. In S. cerevisiae, ScAro80 predominantly activates the ScARO9 promoter, but shows very low activation of other ARO gene promoters. It was described in the literature that ScAro8o does not regulate the expression of ScARO8 [97]. Our results could confirm this finding (see Figure 13 upper diagram). However, in contrast to the computational results and ChIP experiments, we could not observe a strong activation of the ScARO10 promoter region. Surprisingly, we could observe a higher activation of ARO10p by AgAro80 than by ScAro80. The functional analysis of the AgARO deletion mutants showed no growth phenotype of the mutants but a substantial reduction in the production of the rose flavour 2-phenylethanol (Paper 2). Interestingly, and unlike 45 S. cerevisiae, neither the double mutant AgARO8a/b nor the single mutants showed any amino acid auxotrophies. This may imply a different regulation in the amino acids biosynthetic pathway or an additional enzyme which can provide such an activity in A. gossypii. 4.2 Use of a lacZ- reporter assay to correlate reporter gene activity with flavour production Flavours are small volatile organic compounds produced during yeast fermentation. Their natural presence in the gas-phase has been used to collect, separate and analyze them by modern GC-MS technologies. Even though high-throughput fermentation screening systems have been improved enormously over the last years, the aroma profiling still requires a lot of manual and analytical work. In addition the fermentation process needs days to be completed, preventing the possibility of fast screening with low material and labour costs. In Paper 1 we discussed an indirect genetic method to identify flavour active strains, exploring their genetic potential to produce high amounts of aromas for an industrial interest. ScAro80 represents one of the key transcription factors involved in the regulation of the Ehrlich pathway in yeast. Based on the results of the ß-galactosidase assay, we can conclude that the ARO80 expression level directly influences the regulation of the ARO9 promoter. Further experiments found a correlation between the β-galactosidase activity of ARO9 and the amount of β-phenylacetate and β-phenylethanol produced during fermentations. This finding was recently supported by other studies which have used ARO9 and ARO80 overexpression to improve significantly the biocatalytic production of β-phenylethanol [150]. Thus, this newly developed fast tool can conveniently streamline the identification of yeast strains with potential flavour characteristics. It is designed to be applied for high throughput screening of yeast collections. However, the genetic tool builds on the conservation of the transcriptional regulatory circuits found in S. cerevisiae. Thus, one limitation of the assay is the range of species or hybrids in which the use of ScARO80 provides reliable correlations with flavour production Nevertheless, new screening tools can be developed based on our genetic tool using other species’ ARO80 target genes. Furthermore, the genetic tool can be used to screen a large variety of S. cerevisiae strains or hybrids for the flavour production as well as large numbers of progeny of these strains. 46 4.3 General flavour differences between A. gossypii and E. cymbalariae In this study we present the aroma profile analysis of two closely related filamentous ascomycetes, A. gossypii and E. cymbalariae (Paper 2). We used the volatile profiling analysis to provide a quick access to the metabolites they produced. Specifically, we focused on all the VOCs linked to the Ehrlich pathway in which particularly aromatic and branched chain amino acids get catabolized into higher flavour compounds, also known as fusel products. In general, the amounts of branched-chain aldehydes are rather high in both fungal species, whereas the production of aromatic volatiles was found to be specific for A. gossypii. Comparing the gene set linked to the Ehrlich pathway we observed that E. cymbalariae lacks two important genes that are known to be involved in catabolism of aromatic amino acids, namely ARO9 and ARO80 [151]. A. gossypii lacks only the homolog of ARO9 but contains two paralogs of ARO8. We could show that the transcription factor AgAro80 can activate the transcription of both ARO8 genes as well as ARO10 in A. gossypii (Figures 13). Although A. gossypii lacks the homologous ScARO9 gene, we concluded that one of the ARO8 genes may function as a transaminase in the catabolism of phenylalanine. Though, this has to be confirmed by future experiments. Branched-chain aldehydes such as 3-methyl butanal, 2-methyl butanal and 2-methyl propanal are derived from branched chain amino acid degradation. These compounds are key flavour metabolites [152]. Mainly perceived as malty or chocolate-like they are usually formed during the fermentation of many food related substrates, especially during the fermentation of cocoa beans. The high reactivity of the aldehyde carbonyl group makes this class of compounds very easy to be reduced to the respective alcohols or oxidized to the corresponding acids. A high flux in the leucine biosynthesis pathway of both fungi might explain the high levels of these intermediates. Having an exaggerated leucine production could maintain the Ehrlich pathway catabolism of leucine and therefore keep a high level of intermediates at all times. A genetic evidence for a high production and flux in the leucine synthesis pathway might support this hypothesis. In A. gossypii a duplication of the LEU4 (AFL229w) gene has been found (ADL015c, non syntenic homolog of ScLEU4, Figure 14). 47 Figure 14. Gene synteny of the LEU4 loci in S. cerevisiae, A. gossypii and E. cymbalariae. The red stars indicate positions of tRNA in A. gossypii. LEU4 encodes a α-isopropylmalate synthase, responsible for the first step in the leucine biosynthesis pathway. In S. cerevisiae LEU4 has a paralog, LEU9, which arose from the whole genome duplication. Functional analyses in conjunction with non-fermentable carbon sources demonstrated that only LEU4 is required to maintain normal growth rates of S. cerevisiae in the absence of leucine [153] LEU9 plays an auxiliary role in yeast since about 80% of total αisopropylmalate synthase activity in wild-type cells is provided by LEU4 [154] The second LEU4 gene in A. gossypii (ADL015c) is not in synteny to the S. cerevisiae LEU4 or LEU9 gene and therefore arose by a unique duplication event in A. gossypii (Figure 14). In E. cymbalariae no duplication of the LEU4 gene occurred. The role of LEU4 in A. gossypii has been investigated by deletion mutants. The single LEU4 deletions did not show any growth delay or difference in the VOCs production. We failed to delete both LEU4 genes of A. gossypii concluding that this double deletion is lethal even in media with excessive amounts of leucine. These results suggest a different regulation of the leucine biosynthesis pathway in A. gossypii. 3-methyl butanal is a key intermediate in the isoamyl alcohol biosynthesis. By continuous feeding of the pathway with this leucine derived intermediate the fungus can then overproduce the respective fusel alcohol. However, the reason why the Eremothecium species produce high yields of this particular alcohol is still unknown. In S. cerevisiae isoamyl alcohol together with 248 phenyl ethanol, and tryptophol can induce pseudohyphal growth and stimulate flocculation [104] [105]. In A. gossypii the production of fruity flavours could provide a benefit in its ecological niche to attract spore-transmitting insects for dispersal to reach new sites of infection. Further experiments are necessary to test this hypothesis. 4.4 VOCs produced in the Saccharomyces clade Non-conventional yeasts (NCY) represent a new frontier for industrial applications. In the last years a lot of studies have explored the yeast biodiversity looking for new traits that can make a breakthrough in biotechnological processes. In this study we focused our attention on novel flavour producers within the Saccharomyces clade. Initial results showed that yeast strains which belong to the same species exhibited similar VOCs pattern (Paper 3). During fermentation we collected various parameters (i.e. fermentation kinetics, ethanol content, pH of the media and sugar content) which allowed us to make a rational selection of the NCY we wanted to continue with. This approach streamlined the strain selection to 18 representative NCY, which were then further tested for specific traits and flavour profiles. Comparing the fermentation profiles we noticed that almost all the NCY finished fermentation after four days and showed a typical sigmoidal growth curve-like pattern of the CO2 release. The final Plato at the end of all fermentations was in a range between 3 and 4. It is not yet known why yeast strains stop fermenting before all fermentable sugar is consumed [155] Accumulation of toxic intermediates, oxidative stress, lacking of micronutrients and deplete of all the fermentable sugars could be possible explanations for an incomplete sugar fermentation. The only exception we noticed was in fermentation of Wickerhamomyces anomalus. The strain did not show a lag-phase of CO2 release but a linear CO2 curve instead, which ended after eleven days. During the fermentation of W. anomalus we observed a water-insoluble layer emerging on top of the fermentation cylinder. This might explain the slower and constant CO2 release. The formation of the film layer has been reported as a typical phenomenon in stored wines. Apparently the residual amount of oxygen in the headspace of the fermenters triggers the formation of a biofilm. The main volatiles produced by this film are acetic acid, acetaldehyde and acetate esters [156]. 49 Nevertheless, Wickerhamomyces anomalus and Pichia kluyveri generated the highest amount of CO2 at the end of the fermentation process (up to 2.8 g/40ml media). On the other hand, they produced the lowest amount of ethanol with 6 and 4% v/v, respectively. The strain Debaromyces subglobosus showed an opposite fermentation profile. It was able to produce 8% v/v ethanol and utilize most of the sugar available in the media. However, it released the lowest CO2 content (1, 3 g/40ml media). In all the other fermentations we noticed a reasonable relation between ethanol production and sugar consumption. Ethanol is not the only product of the fermentation process. Volatiles also contribute to CO2 production. Our data showed a clear correlation between the fermentation performance of Wickerhamomyces anomalus and Pichia kluyveri species and the amount of volatiles produced. The highest CO2 release was coupled with the extremely high production of esters in these strains. In particular, the strains produced large amounts of ethyl acetate, isoamyl acetate and phenyl acetate. Together with the esters high yields of acetic acid were registered. Both ethanol and acetic acid are generated from the common intermediate acetaldehyde by the aldehyde dehydrogenase, reducing one molecule of NAD(P)+. Ethanol and acetate can both inhibit yeast growth if present at high concentrations. Ethanol generally diffuses out from cell and just a very low concentration is retained inside. Acetic acid accumulation inside the cell is toxic. It can generate high turgor pressure and trigger the formation of free oxygen radicals and consequently oxidative stress [157]. Moreover, the passive diffusion through the plasma membrane is very limited due to the largest dissociated form of the acid since the intracellular pH is higher than 4.75, which is the pKa of the acetic acid. Therefore, the cell needs to either pump it out by ATP-hydrolyzing transporter systems (ABC transporters) or convert the acetate into a less toxic compound. The first option of detoxification implies the use of ATP, which is quite limited in fermentative conditions [158]. In the second case an enzymatic reaction is required. Ethyl acetate can be synthetized by two different pathways in which both require ethanol as substrate. Alcohol acetyl transferases can synthetize ethyl acetate by a reaction that involve acetyl co-enzyme A as a cofactor [159]. Generally, this pathway is involved in the production of isoamyl acetate, using isoamyl alcohol instead of ethanol as a substrate for the reaction. The other enzymatic way for the production of ethyl acetate is by esterase activity. This reaction that is a reverse hydrolysis uses the acetate and ethanol to produce ethyl acetate (Figure 15). 50 Figure 15. Enzymatic routes for the production of ethyl acetate. W. anomalus differs from S. cerevisiae by producing most of acetate esters by the inverse esterase reaction [160]. More recent studies from Rojas et al. (2002) [161] confirmed the high ester synthase activity in W. anomalus. The authors argue that the natural overproduction ethyl acetate could be related with the anti-fungal activity of this compound. Along with other NCY, W. anomalus could have developed the ability to accumulate damaging compounds to outcompete S. cerevisiae or other microorganism for nutrients, oxygen and space. For this reason, W. anomalus has been studied as a bio control agent, especially against molds. The inhibitory effect against Penicillium roqueforti has been shown to be related to the combined effect of ethanol and ethyl acetate [162]. Esters are also important in food production due to the organoleptic properties that they imply. A balance among them is important to give the typical bouquet to specific product. The high ester production of W. anomalus, P. kluyveri and Z. mellis has been reported in other works and it is known as a common feature for NCY. Together with their lower fermentation abilities the uncontrolled production of esters is the main reason that has prevented their use as starter culture in mixed fermentation. Despite that, recent studies have reevaluated the application of these strains, applying them in different production processes. For instance, Wickerhamomyces sp. are commonly used in the production of soya-sauce, where the high amount of esters, especially ethyl acetate have shown to give the strong and sweet/caramel like aroma to the product [163]. Pichia kluyveri has been extensively tested as multistarter culture for cocoa, tequila and wine fermentation. It has been shown that controlled mixed fermentation of Pichia kluyveri and Kluyveromyces marxianus enhanced the sensory quality of the cocoa beans, offering a valid alternative to the standard spontaneous fermentation used in cocoa production [164]. Moreover the strains have been investigated for industrial application of tequila mixed 51 fermentation. Compare to standard S. cerevisiae fermentations, P. kluyveri and K. marxianus mixtures were more efficient in alcohol and ester production [165]. P. kluyveri strains are also commercialized by Chr. Hansen in products like Viniflora® FrootZen™. The strains are used to start the alcoholic fermentation of must until they reach an alcohol content of 4%. Then a standard S. cerevisiae strain is added to complete the process. Again, the advantage of the second strain is to add additional fruity flavours to the wine resulting in a higher complexity of the wine (for more details look at http://www.pros.co.nz/PDF/PDS/FROOTZEN%20PDS.pdf). Debaromyces subglobosus showed another exceptional profile of volatiles. Characterized by delayed fermentation the strain was yet able to produce large amount of aldehydes. In literature Debaromyces sp. are described as strains with weak fermentation properties [166] but a notable halotolerance [167]. We could confirm this high tolerance in our studies as well by growing D. subglobosus in SD media with 4% NaCl (Paper 3, data not shown). This natural salt tolerance of the genus has been used for production processes such as the synthesis of dairy products such as cheese and fermentation of meat products [166]. Fruity ketones are important chemical compounds in cheese ripening as well. In line with that, the largest amount of pyranone was detected in D. subglobosus. In contrast, we detected extremely low levels of esters by GC-MS. Van den Tempel and Jacobsen (2000) [168] found high esterase activity in different isolates of D. hansenii which could explain this low amount of esters. In meat production Debaryomyces sp. have been reported to generate volatile compounds during the fermentation of dry-fermented sausages. In particular, several species inhibit the formation of lipid oxidation compounds and generate ethyl esters [169]. Also, branch-chained aldehydes are critical components for the maturation of meat products, giving nutty, cheesy and salty notes to the food products [152]. Generally these aldehydes are produced by heat-induced processes (Strecker degradation) but small amounts of aldehydes are also produced enzymatically during food fermentation. D. subglobosus shows the highest production of aldehydes among our yeast selection. As one of them 3-methyl butanal, an intermediate in leucine degradation, is produced in higher amount in fermentations with D. subglobosus and Z. mellis. 3-methyl butanal is a common aldehyde produced in cured-hams by lactic acid bacteria and Micrococcaceae [170]. Since the strains produced detectable amounts of 3-methyl butanal but also other compounds derived from Strecker degradation, i.e. 5hydroxymethylfurfural, furfural, 5-methylfurfural they might have a possible application in meat processing. In summary we did an initial characterization of 20 NCYs by correlating their fermentation performances with their aroma profiles. In this first screening D. subglobosus, W. anomalus, P. 52 kluyveri and Z. mellis displayed unique fermentation and volatile profiles that may be used for supply of additional flavours, e.g. in mixed fermentations. 5. Conclusions and Outlook Flavours and volatile compounds have a growing market potential, especially for food and beverages or fragrance industries. Fungi are able to produce various mixtures of VOCs and thus provide various opportunities to generate desirable natural flavours. The Ehrlich pathway is one of the main routes involved in the synthesis of volatile aroma compounds, especially during yeast fermentations of beverages. Previous observations identified the ARO gene family as a target set of genes with a strong impact on the activity of the Ehrlich pathway. Comparative genetic analysis showed a clear conservation of this gene family in the Saccharomyces clade. In our experiments we focused on the key transcriptional factor, ARO80. By using a lacZ-reporter system we quantified the Aro80-dependent expression of key ARO genes in both S. cerevisiae and A. gossypii. Expression of ARO-genes is also known to depend on other transcriptional regulators, e.g. the general biosynthetic amino acids regulator GCN4, which contributes to the complex regulation of ARO genes. At present, the regulation of ARO-genes has only been studied on a transcriptional level. Further studies are needed to elucidate if there also is a regulation of ARO genes on a post-transcriptional stage. In our promoter analyses we found that the ScARO9 expression is induced by Aro80. This prompted us to generate a ScARO9- lacZ reporter system. This indicated that the expression level of ARO9 correlates with the formation of two aroma alcohol products, 2-phenylethanol and 2-phenylethyl acetate. We went on to transfer this reporter tool into other Sacchamyces sensu stricto species. With these studies we could confirm the correlation of ARO9 gene expression with the production of 2-phenylethanol and 2-phenylethyl acetate. This tool opens the way for high throughput screenings of entire strain collections or the analysis of progeny pools using microtiter plate assays. This inexpensive indirect assay offers new opportunities for the isolation of candidate strains with increased flavour production.. Our data with A. gossypii showed that AgARO8a/b and AgARO10 are regulated by AgAro80. Deletion of almost all the ARO genes resulted in a severe decrease in flavour production, especially in 2-phenylethanol and isoamyl alcohol. However, overexpression of ARO80 resulted 53 specifically increased the production of isoamyl alcohol but not of 2-phenylethanol. Experiments in S. cerevisiae showed an increased flavour production on media with poor nitrogen sources. These growth conditions could be tested in A. gossypii as well to further increase the production of flavour components. Additionally, spiking of media with amino acids could induce flavour product formation. Further experiments will be necessary to identify the underlying causes of natural over production of isoamyl alcohol in A. gossypii. We have begun to analyze the leucine biosynthesis pathway of A. gossypii. Also, the biological function for the production of the high levels of this alcohol should be addressed. Recent studies showed that 2-phenylethanol and isoamyl alcohol emitted by the fungus Aureobasidium pullulans are involved in the attraction of eusocial wasps [92]. Similar experiments could be used in A. gossypii to test the ability to attract spore-transmitting insects on which A. gossypii depends for its dispersal. The close relative of A. gossypii, Eremothecium cymbalariae, produced a very distinct flavour profile, particularly with regards to its high production of ethyl acetate. The biological function of this is also unknown. Ethyl acetate could represent a strategy to avoid high concentrations of acetic acid in a similar mechanism as described for W. anomalus (see paragraph 4.4). Studies could be done to address the enzymatic activity of esterases and alcohol acetyl transferase in E. cymbalariae. In collaboration with the EU consortium Cornucopia, which is focusing on the identification of novel potentials of NCY, we characterized a selection of 18 different species that are presented in this thesis. In this characterization we recorded their fermentation performance followed by a flavour profiling. The volatile aroma profiles of W. anomalus, P. kluyveri and Z. mellis and D. subglobosus were unique from all other strains. These four species will be characterized further in various fermentation conditions, i.e. different carbon and nitrogen sources, temperature and pH to explore their potential in food production. Additionally, these strains might be favorable in mixed-fermentations. By using NCY strains in different co-fermentation regimes new flavour mixes may be generated and to be used in new kinds of beverages. 54 References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. Hattenschwiler, S., N. Fromin, and S. Barantal, Functional diversity of terrestrial microbial decomposers and their substrates. C R Biol, 2011. 334(5-6): p. 393-402. Mueller, M.F.G.B.a.G., Biodiversity of Fungi: Inventory and Monitoring Methods. Imprint: Academic Press, 2004. Wubah, D.A., D.E. Akin, and W.S. Borneman, Biology, fiber-degradation, and enzymology of anaerobic zoosporic fungi. Crit Rev Microbiol, 1993. 19(2): p. 99-115. Velez, C.G., et al., Molecular phylogenetic and zoospore ultrastructural analyses of Chytridium olla establish the limits of a monophyletic Chytridiales. Mycologia, 2011. 103(1): p. 118-30. Ferreira, J.A., et al., Zygomycetes-based biorefinery: present status and future prospects. Bioresour Technol, 2013. 135: p. 523-32. Suh, S.O., et al., Phylogenetics of Saccharomycetales, the ascomycete yeasts. Mycologia, 2006. 98(6): p. 1006-17. Galagan, J.E., et al., Genomics of the fungal kingdom: insights into eukaryotic biology. Genome Res, 2005. 15(12): p. 1620-31. Kirk, P.M., Cannon, P.F., David, J.C. and Stalpers, J.A., Ainsworth & Bisby's Dictionary of the Fungi, 9th Edition. CABI Publishing, 2001. Kurtzman, C. and C. Robnett, Phylogenetic relationships among yeasts of the ? complex? determined from multigene sequence analyses. FEMS Yeast Research, 2003. 3(4): p. 417-432. Gonzalez, S.S., et al., Natural hybrids from Saccharomyces cerevisiae, Saccharomyces bayanus and Saccharomyces kudriavzevii in wine fermentations. FEMS Yeast Res, 2006. 6(8): p. 1221-34. Stefanini, I., et al., Role of social wasps in Saccharomyces cerevisiae ecology and evolution. Proc Natl Acad Sci U S A, 2012. 109(33): p. 13398-403. Hittinger, C.T., Saccharomyces diversity and evolution: a budding model genus. Trends Genet, 2013. 29(5): p. 309-17. Gangl, H., et al., Exceptional fermentation characteristics of natural hybrids from Saccharomyces cerevisiae and S. kudriavzevii. N Biotechnol, 2009. 25(4): p. 244-51. Gibson, B.R., et al., Comparative physiology and fermentation performance of Saaz and Frohberg lager yeast strains and the parental species Saccharomyces eubayanus. Yeast, 2013. 30(7): p. 255-66. Walther, A., A. Hesselbart, and J. Wendland, Genome sequence of Saccharomyces carlsbergensis, the world's first pure culture lager yeast. G3 (Bethesda), 2014. 4(5): p. 783-93. John E. Bradbury, K.D.R., Heather A. Niederer, Soon A. Lee, P. Rod Dunbar, Richard C. Gardner, A homozygous diploid subset of commercial wine yeast strains. Antonie van Leeuwenhoek, 2006. 89(1): p. 27-37. Gonzalez, S.S., E. Barrio, and A. Querol, Molecular characterization of new natural hybrids of Saccharomyces cerevisiae and S. kudriavzevii in brewing. Appl Environ Microbiol, 2008. 74(8): p. 2314-20. Gerton, J.L., et al., Global mapping of meiotic recombination hotspots and coldspots in the yeast Saccharomyces cerevisiae. Proc Natl Acad Sci U S A, 2000. 97(21): p. 1138390. Hawthorne D, P.P., Genetic and molecular analysis of hybrids in the genus Saccharomyces involving S. cerevisiae, S. uvarum and a new species, S. douglasii. Yeast, 2000. 10(10). Hunter, N., et al., The mismatch repair system contributes to meiotic sterility in an interspecific yeast hybrid. EMBO J, 1996. 15(7): p. 1726-33. 55 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. Naumov, G.I., E.S. Naumova, and A. Querol, Genetic Study of Natural Introgression Supports Delimitation of Biological Species in the Saccharomyces Sensu Stricto Complex. Systematic and Applied Microbiology, 1997. 20(4): p. 595-601. Donalies, U.E., et al., Improvement of Saccharomyces yeast strains used in brewing, wine making and baking. Adv Biochem Eng Biotechnol, 2008. 111: p. 67-98. McGovern, P.E., et al., Fermented beverages of pre- and proto-historic China. Proc Natl Acad Sci U S A, 2004. 101(51): p. 17593-8. Horsford, E.N., Report on Vienna Bread. In U.S. Commission to the Vienna exhibition, 1873. Reports. 1875-76. v.2, B Volume 2 of Reports, U.S. Commission to the Vienna exhibition, 1873. 1875, U.S. Government Printing Office, 1875. p. 122. Barnett, J.A., A history of research on yeasts 2: Louis Pasteur and his contemporaries, 1850-1880. Yeast, 2000. 16(8): p. 755-71. Barnett, J.A. and F.W. Lichtenthaler, A history of research on yeasts 3: Emil Fischer, Eduard Buchner and their contemporaries, 1880-1900. Yeast, 2001. 18(4): p. 363-388. Kresge, N., R.D. Simoni, and R.L. Hill, Otto Fritz Meyerhof and the elucidation of the glycolytic pathway. J Biol Chem, 2005. 280(4): p. e3. Nicole Kresge, R.D.S., and Robert L. Hill, JBC Historical Perspectives: Glycobiology and Carbohydrates. The Journal of Biological Chemistry, 2002. 277(16). De Deken, R.H., The Crabtree effect: a regulatory system in yeast. J Gen Microbiol, 1966. 44(2): p. 149-56. van den Brink, J., et al., Energetic limits to metabolic flexibility: responses of Saccharomyces cerevisiae to glucose-galactose transitions. Microbiology, 2009. 155(4): p. 1340-1350. Sun, G., et al., A eudicot from the Early Cretaceous of China. Nature, 2011. 471(7340): p. 625-8. Dashko, S., et al., Why, when, and how did yeast evolve alcoholic fermentation? FEMS Yeast Res, 2014. Goffeau, A., et al., Life with 6000 genes. Science, 1996. 274(5287): p. 546, 563-7. Tugendreich, S., et al., Genes conserved in yeast and humans. Hum Mol Genet, 1994. 3 Spec No: p. 1509-17. Foury, F., Human genetic diseases: a cross-talk between man and yeast. Gene, 1997. 195(1): p. 1-10. Bostein, D. Why yeast? 1991; Available from: https://www.princeton.edu/genomics/botstein/publications/1991_Botstein_Why.pdf. Mattiazzi, M., U. Petrovic, and I. Krizaj, Yeast as a model eukaryote in toxinology: a functional genomics approach to studying the molecular basis of action of pharmacologically active molecules. Toxicon, 2012. 60(4): p. 558-71. Kurtzman, C.P., Recognition of Yeast Species from Gene Sequence Comparisons. The Open Applied Informatics Journal, 2011. 5(Suppl 1-M4): p. 20-29. JM., G., Yeast carbon catabolite repression. Microbiol Mol Biol Rev. , 1998. 62(2): p. 334-61. Leandro, M.J., C. Fonseca, and P. Goncalves, Hexose and pentose transport in ascomycetous yeasts: an overview. FEMS Yeast Res, 2009. 9(4): p. 511-25. Filip Rolland, J.W., Johan M. Thevelein, Glucose-sensing and -signalling mechanisms in yeast. FEMS Yeast Research, 2002. 2: p. 183-201. Serrano, R., Energy requirements for maltose transport in yeast. Eur J Biochem, 1977. 80(1): p. 97-102. Sr|an Novak, V.Z.-K.a.V.M., Regulation of Maltose Transport and Metabolism in Saccharomyces cerevisiae. Food Technol. Biotechnol., 2004. 42(3): p. 213–218. Gancedo, C.S., R. , Energy-yielding metabolism. In The Yeasts. New York : Academic Press, 1989. 3: p. 205-259. 56 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. Kresze GB, R.H., Pyruvate dehydrogenase complex from baker's yeast. 2. Molecular structure, dissociation, and implications for the origin of mitochondria. Eur J Biochem., 1991. 119(3): p. 581-7. Lutstorf, U. and R. Megnet, Multiple forms of alcohol dehydrogenase in Saccharomyces cerevisiae. I. Physiological control of ADH-2 and properties of ADH-2 and ADH-4. Arch Biochem Biophys, 1968. 126(3): p. 933-44. Jacobson, M.K. and C. Bernofsky, Mitochondrial acetaldehyde dehydrogenase from Saccharomyces cerevisiae. Biochim Biophys Acta, 1974. 350(2): p. 277-91. Conant, G.C. and K.H. Wolfe, Increased glycolytic flux as an outcome of whole-genome duplication in yeast. Mol Syst Biol, 2007. 3: p. 129. A., B., Eremotheciuim cymbalariae, nuovoascomicete. Nuovo giornale botanico italiano, 1888. 20: p. 452-456. Wendland, J. and A. Walther, Genome evolution in the eremothecium clade of the Saccharomyces complex revealed by comparative genomics. G3 (Bethesda), 2011. 1(7): p. 539-48. Ashby, S.F.a.N.W., The fungi of stigmatomycosis. Ann Bot, 1926. 40(1). EC, H., Grundlagen zur Systematik der Saccharomyceten. Zbl Bakt II Natur., 1904. 12: p. 529-538. Kurtzman, C.P., Relationships among the genera Ashbya, Eremothecium, Holleya and Nematospora determined from rDNA sequence divergence. J Ind Microbiol, 1995. 14(6): p. 523-30. Prillinger, H., et al., Phytopathogenic filamentous (Ashbya, Eremothecium) and dimorphic fungi (Holleya, Nematospora) with needle-shaped ascospores as new members within the Saccharomycetaceae. Yeast, 1997. 13(10): p. 945-60. Guilliermond, C. r. hebd. Séanc Acad. Sci., Paris, 1935. 200(19): p. 1556. Dietrich, F.S., et al., Genomes of Ashbya fungi isolated from insects reveal four matingtype loci, numerous translocations, lack of transposons, and distinct gene duplications. G3 (Bethesda), 2013. 3(8): p. 1225-39. Wendland, J. and A. Walther, Ashbya gossypii: a model for fungal developmental biology. Nat Rev Microbiol, 2005. 3(5): p. 421-9. Kato, T. and E.Y. Park, Riboflavin production by Ashbya gossypii. Biotechnol Lett, 2012. 34(4): p. 611-8. Stahmann K. P., R.J.L., Seulberger H, Three biotechnical processes using Ashbya gossypii, Candida famata, or Bacillus subtilis compete with chemical riboflavin production. Appl. Microbiol. Biotechnol., 2000. 53: p. 509–516. Demain, A.L., Riboflavin oversynthesis. Annu Rev Microbiol, 1972. 26: p. 369-88. Tijen Özbaş, T.K., Effects of growth factors on riboflavin production by Ashbya gossypii. Enzyme and Microbial Technology, 1991. 13(7): p. 594-596. Özbas, T. and T. Kutsal, Comparative study of riboflavin production from two microorganisms: Eremothecium ashbyii and Ashbya gossypii. Enzyme and Microbial Technology, 1986. 8(10): p. 593-596. Tajima, S., et al., Increased riboflavin production from activated bleaching earth by a mutant strain of Ashbya gossypii. J Biosci Bioeng, 2009. 108(4): p. 325-9. Steiner, S., et al., Homologous recombination as the main mechanism for DNA integration and cause of rearrangements in the filamentous ascomycete Ashbya gossypii. Genetics, 1995. 140(3): p. 973-87. Wendland, J., et al., PCR-based gene targeting in the filamentous fungus Ashbya gossypii. Gene, 2000. 242(1-2): p. 381-391. Dietrich, F.S., et al., The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces cerevisiae genome. Science, 2004. 304(5668): p. 304-7. 57 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. Wasserstrom, L., et al., Molecular determinants of sporulation in Ashbya gossypii. Genetics, 2013. 195(1): p. 87-99. Chambers, P.J. and I.S. Pretorius, Fermenting knowledge: the history of winemaking, science and yeast research. EMBO Rep, 2010. 11(12): p. 914-20. Porro, D. and P. Branduardi, Yeast cell factory: fishing for the best one or engineering it? Microb Cell Fact, 2009. 8: p. 51. Adrio, J.L. and A.L. Demain, Fungal biotechnology. Int Microbiol, 2003. 6(3): p. 191-9. Advances in Fungal Biotechnology for Industry, Agriculture, and Medicine. 2004. Zhong, J.J. and J.H. Xiao, Secondary metabolites from higher fungi: discovery, bioactivity, and bioproduction. Adv Biochem Eng Biotechnol, 2009. 113: p. 79-150. Gravina, S.A., G.L. Yep, and M. Khan, Human biology of taste. Ann Saudi Med, 2013. 33(3): p. 217-22. Owen R Fenema, P., Fod aditves-an unending controversy. Am J Clin Nutr, 1987. 46(1): p. 201-203. Terr, G.a.F.o.C., Preserving Food Without Freezing or Canning: Traditional Techniques Using Salt, Oil, Sugar, Alcohol, Vinegar, Drying, Cold Storage, and Lactic Fermentation. 2007. 197. Flavourings and certain food ingredients with flavouring properties for use in and on foods. Official Journal of the European Unions, 2008: p. L 354/34. Geueke, B., C.C. Wagner, and J. Muncke, Food contact substances and chemicals of concern: a comparison of inventories. Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2014. 31(8): p. 1438-50. ; Available from: http://www.fda.gov. Vandamme, E.J., Bioflavours and fragrances via fungi and their enzymes. Fungal Diversity, 2003. 13: p. 153-166. Berger, R.G., Biotechnology of flavours--the next generation. Biotechnol Lett, 2009. 31(11): p. 1651-9. Saerens, S.M., et al., Parameters affecting ethyl ester production by Saccharomyces cerevisiae during fermentation. Appl Environ Microbiol, 2008. 74(2): p. 454-61. Paul L.H. MCSWEENEY, M.J.S., Biochemical pathways for the production of flavour compounds in cheeses during ripening: A review. Lait 80, 1999. 2000: p. 293–324. Ehrlich, F., Über die Bedingungen der Fuselölbildung und über ihren Zusammenhang mit dem Eiweißaufbau der Hefe. Berichte der deutschen chemischen Gesellschaft, 1907. 40(1): p. 1027-1047. Lampitt, L.H., Nitrogen Metabolism in Saccharomyces cerevisiae. Biochem J, 1919. 13(4): p. 459-86. M, Y., Decomposition of amino acids by yeast I. Nippon Nogeikagaku Kaishi 1932. 8: p. 428-432. S., T.R., The growth and fermentation of a strain of S. cerevisiae with amino acids as nutrients. J. Inst. Brew, 1941. 47(5): p. 255–272. RS., T., Mechanism of nitrogen assimilation from amino-acids by yeast. Nature, 1949. 164(4165). Hazelwood, L.A., et al., The Ehrlich pathway for fusel alcohol production: a century of research on Saccharomyces cerevisiae metabolism. Appl Environ Microbiol, 2008. 74(8): p. 2259-66. Scheffer, J.P.v.D.a.A., Redox balances in the metabolism of sugars by yeasts. FEMS Microbiology Letters, 1986. 32(3-4): p. 199-224. Boulton Roger B., S.V.L., Linda F. Bisson, Principles and Practices of Winemaking. The Chapman & Hall Enology Library, 1995. 58 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. Vollbrecht D, R.F., The formation of higher alcohols by amino acid auxotrophic mutants of Saccharomyces cerevisiae. I. The conversion of amino acids to higher alcohols. Arch Mikrobiol., 1973. 94(4): p. 351-358. Davis, T.S., K. Boundy-Mills, and P.J. Landolt, Volatile emissions from an epiphytic fungus are semiochemicals for eusocial wasps. Microb Ecol, 2012. 64(4): p. 1056-63. Kispal, G., et al., Mitochondrial and cytosolic branched-chain amino acid transaminases from yeast, homologs of the myc oncogene-regulated Eca39 protein. J Biol Chem, 1996. 271(40): p. 24458-64. Lilly, M., et al., The effect of increased branched-chain amino acid transaminase activity in yeast on the production of higher alcohols and on the flavour profiles of wine and distillates. FEMS Yeast Res, 2006. 6(5): p. 726-43. Dickinson, J.R., L.E. Salgado, and M.J. Hewlins, The catabolism of amino acids to long chain and complex alcohols in Saccharomyces cerevisiae. J Biol Chem, 2003. 278(10): p. 8028-34. Eden, E., et al., Discovering motifs in ranked lists of DNA sequences. PLoS Comput Biol, 2007. 3(3): p. e39. Iraqui, I., et al., Transcriptional induction by aromatic amino acids in Saccharomyces cerevisiae. Mol Cell Biol, 1999. 19(5): p. 3360-71. Zhu, C., et al., High-resolution DNA-binding specificity analysis of yeast transcription factors. Genome Res, 2009. 19(4): p. 556-66. Lee, T.I., et al., Transcriptional regulatory networks in Saccharomyces cerevisiae. Science, 2002. 298(5594): p. 799-804. Hazelwood, L.A., et al., A new physiological role for Pdr12p in Saccharomyces cerevisiae: export of aromatic and branched-chain organic acids produced in amino acid catabolism. FEMS Yeast Res, 2006. 6(6): p. 937-45. Fox, P.F., J.A. Lucey, and T.M. Cogan, Glycolysis and related reactions during cheese manufacture and ripening. Crit Rev Food Sci Nutr, 1990. 29(4): p. 237-53. Duong, C.T., et al., Identification of Sc-type ILV6 as a target to reduce diacetyl formation in lager brewers' yeast. Metab Eng, 2011. 13(6): p. 638-47. Dickinson, J.R. and V. Norte, A study of branched-chain amino acid aminotransferase and isolation of mutations affecting the catabolism of branched-chain amino acids in Saccharomyces cerevisiae. FEBS Lett, 1993. 326(1-3): p. 29-32. Kern, K., et al., Isoamyl alcohol-induced morphological change in Saccharomyces cerevisiae involves increases in mitochondria and cell wall chitin content. FEMS Yeast Res, 2004. 5(1): p. 43-9. Chen, H. and G.R. Fink, Feedback control of morphogenesis in fungi by aromatic alcohols. Genes Dev, 2006. 20(9): p. 1150-61. Martins, M., et al., Morphogenesis control in Candida albicans and Candida dubliniensis through signaling molecules produced by planktonic and biofilm cells. Eukaryot Cell, 2007. 6(12): p. 2429-36. Chen H, F.M., Feng Q, Clardy J, Fink GR., Tyrosol is a quorum-sensing molecule in Candida albicans. Proc Natl Acad Sci U S A., 2004. 101(14): p. 5048-52. Hornby JM, J.E., Lisec AD, Tasto JJ, Jahnke B, Shoemaker R, Dussault P, Nickerson KW., Quorum sensing in the dimorphic fungus Candida albicans is mediated by farneso. Appl Environ Microbiol., 2001. 67(7): p. 2982-92. Kruppa, M., Quorum sensing and Candida albicans. Mycoses, 2009. 52(1): p. 1-10. Herrero-Garcia, E., et al., 8-Carbon oxylipins inhibit germination and growth, and stimulate aerial conidiation in Aspergillus nidulans. Fungal Biol, 2011. 115(4-5): p. 393400. Hung, R., S. Lee, and J.W. Bennett, The effects of low concentrations of the enantiomers of mushroom alcohol (1-octen-3-ol) on. Mycology, 2014. 5(2): p. 73-80. 59 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129. 130. 131. Schlyter, Q.-H.Z.a.F., Olfactory recognition and behavioural avoidance of angiosperm nonhost volatiles by conifer-inhabiting bark beetles. Agricultural and Forest Entomology, 2004. 6: p. 1-19. Kline DL, A.S., Bernier UR, Welch CH, Evaluation of the enantiomers of 1-octen-3-ol and 1-octyn-3-ol as attractants for mosquitoes associated with a freshwater swamp in Florida, U.S.A. Med Vet Entomol, 2007. 21(4): p. 323-31. Bohbot, J.D. and J.C. Dickens, Characterization of an enantioselective odorant receptor in the yellow fever mosquito Aedes aegypti. PLoS One, 2009. 4(9): p. e7032. Lam, K., et al., Semiochemical-mediated oviposition avoidance by female house flies, Musca domestica, on animal feces colonized with harmful fungi. J Chem Ecol, 2010. 36(2): p. 141-7. Niu, X.M., et al., Nematodetoxic aurovertin-type metabolites from a root-knot nematode parasitic fungus Pochonia chlamydosporia. J Agric Food Chem, 2010. 58(2): p. 828-34. Sijam, M.M.T.a.K., Arbuscular mycorrhizal fungi and plant root exudates biocommunications in the rhizosphere. African Journal of Microbiology Research, 2012. 6(46): p. 7295-7301. Strobel, G., et al., An endophytic/pathogenic Phoma sp. from creosote bush producing biologically active volatile compounds having fuel potential. FEMS Microbiol Lett, 2011. 320(2): p. 87-94. Minerdi, D., et al., Volatile organic compounds: a potential direct long-distance mechanism for antagonistic action of Fusarium oxysporum strain MSA 35. Environ Microbiol, 2009. 11(4): p. 844-54. Mercier, J. and D.C. Manker, Biocontrol of soil-borne diseases and plant growth enhancement in greenhouse soilless mix by the volatile-producing fungus Muscodor albus. Crop Protection, 2005. 24(4): p. 355-362. Mercier, J. and J.I. Jimenez, Potential of the volatile-producing fungus Muscodor albus for control of building molds. Can J Microbiol, 2007. 53(3): p. 404-10. Mitchell, A.M., et al., Volatile antimicrobials from Muscodor crispans, a novel endophytic fungus. Microbiology, 2010. 156(Pt 1): p. 270-7. Zhang, C.L., et al., Muscodor fengyangensis sp. nov. from southeast China: morphology, physiology and production of volatile compounds. Fungal Biol, 2010. 114(10): p. 797-808. Strobel, G.A., et al., Volatile antimicrobials from Muscodor albus, a novel endophytic fungus. Microbiology, 2001. 147(Pt 11): p. 2943-50. Singh, S.K., et al., An endophytic Phomopsis sp. possessing bioactivity and fuel potential with its volatile organic compounds. Microb Ecol, 2011. 61(4): p. 729-39. Chambers, S.T., A. Scott-Thomas, and M. Epton, Developments in novel breath tests for bacterial and fungal pulmonary infection. Curr Opin Pulm Med, 2012. 18(3): p. 228-32. Zhu, J., et al., Detecting bacterial lung infections: in vivo evaluation of in vitro volatile fingerprints. J Breath Res, 2013. 7(1): p. 016003. Ngugi, H.K. and H. Scherm, Mimicry in plant-parasitic fungi. FEMS Microbiol Lett, 2006. 257(2): p. 171-6. Schiestl, F.P., et al., Evolution of 'pollinator'- attracting signals in fungi. Biol Lett, 2006. 2(3): p. 401-4. Steinebrunner, F., F.P. Schiestl, and A. Leuchtmann, Ecological role of volatiles produced by Epichloe: differences in antifungal toxicity. FEMS Microbiol Ecol, 2008. 64(2): p. 307-16. Daisy BH, S.G., Castillo U, Ezra D, Sears J, Weaver DK, Runyon JB., Naphthalene, an insect repellent, is produced by Muscodor vitigenus, a novel endophytic fungus. Microbiology, 2002. 148(Pt 11): p. 3737-41. 60 132. 133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. 144. 145. 146. 147. 148. 149. 150. Rude, M.A. and A. Schirmer, New microbial fuels: a biotech perspective. Curr Opin Microbiol, 2009. 12(3): p. 274-81. Griffin, M.A., et al., Volatile organic compound production by organisms in the genus Ascocoryne and a re-evaluation of myco-diesel production by NRRL 50072. Microbiology, 2010. 156(Pt 12): p. 3814-29. Tomsheck, A.R., et al., Hypoxylon sp., an endophyte of Persea indica, producing 1,8cineole and other bioactive volatiles with fuel potential. Microb Ecol, 2010. 60(4): p. 903-14. Gianoulis, T.A., et al., Genomic analysis of the hydrocarbon-producing, cellulolytic, endophytic fungus Ascocoryne sarcoides. PLoS Genet, 2012. 8(3): p. e1002558. Jelen, H.H., Use of solid phase microextraction (SPME) for profiling fungal volatile metabolites. Letters in Applied Microbiology, 2003. 36: p. 263-267. Stoppacher, N., et al., Identification and profiling of volatile metabolites of the biocontrol fungus Trichoderma atroviride by HS-SPME-GC-MS. J Microbiol Methods, 2010. 81(2): p. 187-93. Godefroot, M., P. Sandra, and M. Verzele, New method for quantitative essential oil analysis. Journal of Chromatography A, 1981. 203: p. 325-335. Tait, E., et al., Identification of volatile organic compounds produced by bacteria using HS-SPME-GC-MS. J Chromatogr Sci, 2014. 52(4): p. 363-73. Urrestarazu, A., et al., Phenylalanine- and tyrosine-auxotrophic mutants of Saccharomyces cerevisiae impaired in transamination. Mol Gen Genet, 1998. 257(2): p. 230-7. Iraqui, I., et al., Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferases I and II reveals a new aminotransferase subfamily. Mol Gen Genet, 1998. 257(2): p. 238-48. Kradolfer, P., P. Niederberger, and R. Hutter, Tryptophan degradation in Saccharomyces cerevisiae: characterization of two aromatic aminotransferases. Arch Microbiol, 1982. 133(3): p. 242-8. Derrick, S. and P.J. Large, Activities of the enzymes of the Ehrlich pathway and formation of branched-chain alcohols in Saccharomyces cerevisiae and Candida utilis grown in continuous culture on valine or ammonium as sole nitrogen source. J Gen Microbiol, 1993. 139(11): p. 2783-92. Vuralhan, Z., et al., Physiological characterization of the ARO10-dependent, broadsubstrate-specificity 2-oxo acid decarboxylase activity of Saccharomyces cerevisiae. Appl Environ Microbiol, 2005. 71(6): p. 3276-84. Romagnoli, G., et al., Substrate specificity of thiamine pyrophosphate-dependent 2-oxoacid decarboxylases in Saccharomyces cerevisiae. Appl Environ Microbiol, 2012. 78(21): p. 7538-48. Lee, K. and J.S. Hahn, Interplay of Aro80 and GATA activators in regulation of genes for catabolism of aromatic amino acids in Saccharomyces cerevisiae. Mol Microbiol, 2013. 88(6): p. 1120-34. Encyclopedia of Food Microbiology, ed. C.B. Tortorello. 2014: Academic Press. 2955 Buzzini, P., et al., A study on volatile organic compounds (VOCs) produced by tropical ascomycetous yeasts. Antonie Van Leeuwenhoek, 2003. 84(4): p. 301-11. Jyoti Prakash Tamang, K.K., Fermented foods and beverages of the world. CRC Press, 2010. Kim, B., B.R. Cho, and J.S. Hahn, Metabolic engineering of Saccharomyces cerevisiae for the production of 2-phenylethanol via Ehrlich pathway. Biotechnol Bioeng, 2014. 111(1): p. 115-24. 61 151. 152. 153. 154. 155. 156. 157. 158. 159. 160. 161. 162. 163. 164. 165. 166. 167. 168. 169. Vuralhan, Z., et al., Identification and characterization of phenylpyruvate decarboxylase genes in Saccharomyces cerevisiae. Appl Environ Microbiol, 2003. 69(8): p. 4534-41. Smit, B.A., W.J. Engels, and G. Smit, Branched chain aldehydes: production and breakdown pathways and relevance for flavour in foods. Appl Microbiol Biotechnol, 2009. 81(6): p. 987-99. Casalone, E., et al., Identification by functional analysis of the gene encoding alphaisopropylmalate synthase II (LEU9) in Saccharomyces cerevisiae. Yeast, 2000. 16(6): p. 539-45. Chang LF, G.P., Kohlhaw GB., Total deletion of yeast LEU4: further evidence for a second alpha-isopropylmalate synthase and evidence for tight LEU4-MET4 linkage. Gene, 1985. 33(3): p. 333-9. Huuskonen, A., et al., Selection from industrial lager yeast strains of variants with improved fermentation performance in very-high-gravity worts. Appl Environ Microbiol, 2010. 76(5): p. 1563-73. Pretorius, M.d.T.a.I.S., Microbial Spoilage and Preservation of Wine: Using Weapons from Nature's Own Arsenal- A Review S. Afr. J. Enol. Vitic, 2000. 21(Special Issue): p. 74-96. Peter Piper, C.O.C., † Kostas Hatzixanthis and Mehdi Mollapour, Weak acid adaptation: the stress response that confers yeasts with resistance to organic acid food preservatives. Microbiology, 2001. 147: p. 2635–2642. Van Aelst, L., et al., Molecular cloning of a gene involved in glucose sensing in the yeast Saccharomyces cerevisiae. Mol Microbiol, 1993. 8(5): p. 927-43. Nordström, K., Formation of ethyl acetate in fermentation with Brewer's yeast. Journal of the Institute of Brewing, 1961. 67: p. 173-181. Yoshioka, K.H., N., Ester formation by alcohol acetyltransferase from brewer's yeast. Agricultural and Biological Chemistry, 1981. 45: p. 2183-2190. Rojas, V., Gil, J.V., Manzanares, P., Gavara, R., Piñaga, F. & Flors, A., Measurement of alcohol acetyltransferase and ester hydrolase activities in yeast extract. Enzyme and Microbial Technology, 2002. 30: p. 224-230. Druvefors UA, P.V., Schnürer J, Nutrient effects on biocontrol of Penicillium roqueforti by Pichia anomala J121 during airtight storage of wheat. Appl Environ Microbiol., 2005. 71(4): p. 1865-9. Cao, X., et al., Genome shuffling of Hansenula anomala to improve flavour formation of soy sauce. World J Microbiol Biotechnol, 2012. 28(5): p. 1857-62. Crafack, M., et al., Influencing cocoa flavour using Pichia kluyveri and Kluyveromyces marxianus in a defined mixed starter culture for cocoa fermentation. Int J Food Microbiol, 2013. 167(1): p. 103-16. Amaya-Delgado, L., et al., Performance evaluation of Pichia kluyveri, Kluyveromyces marxianus and Saccharomyces cerevisiae in industrial tequila fermentation. World J Microbiol Biotechnol, 2013. 29(5): p. 875-81. Breuer, U. and H. Harms, Debaryomyces hansenii--an extremophilic yeast with biotechnological potential. Yeast, 2006. 23(6): p. 415-37. Prista C, A.A., Loureiro-Dias MC, Ramos J., Physiological basis for the high salt tolerance of Debaryomyces hanseni. Appl Environ Microbiol. , 1997. 63(10): p. 4005-9. van den Tempel, T. and M. Jakobsen, The technological characteristics of Debaryomyces hansenii and Yarrowia lipolytica and their potential as starter cultures for production of Danablu. International Dairy Journal, 2000. 10(4): p. 263-270. Flores, M., et al., Effect of Debaryomyces spp. on aroma formation and sensory quality of dry-fermented sausages. Meat Sci, 2004. 68(3): p. 439-46. 62 170. Montel, M.C., et al., Biochemical activities of Micrococcaceae and their effects on the aromatic profiles and odours of a dry sausage model. Food Microbiology, 1996. 13(6): p. 489-499. 63 Paper 1 Paper 1 This paper investigated the regulatory network of the ARO gene family in S. cerevisiae. The ARO gene set expresses enzymes that belong to the Ehrlich pathway, producing flavoured alcohols and esters by the amino acid catabolism. ScARO80 is a Zn2Cys6 transcription factor and activator of the pathway. The study investigated the ARO80-dependent expression of the ARO target promoter regions. ScARO9 expression is strongly regulated by ScAro80. This established ScARO9 as a potential reporter to correlate the gene activation and flavour formation in yeast. To determine the applicability of the ARO9-lacZ system as a screening tool we transformed various strains with the ARO9p-lacZ plasmid. GC-MS results confirmed the ability of the lacZsystem to predict the yield of two flavour compounds, 2-phenylethanol and 2phenylacetate. 64 OPEN SUBJECT AREAS: MICROBIOLOGY TECHNIQUES FUNGAL GENETICS Received 9 August 2013 Accepted 6 December 2013 Published 15 January 2014 Correspondence and requests for materials should be addressed to J.W. (juergen. wendland@ carlsberglab.dk) An indirect assay for volatile compound production in yeast strains Davide Ravasio1, Andrea Walther1, Kajetan Trost2, Urska Vrhovsek2 & Jürgen Wendland1 1 Carlsberg Laboratory; Yeast Genetics Gamle Carlsberg Vej 10 DK-1799 Copenhagen V, Denmark, 2Fondazione Edmund Mach Research and Innovation Centre Food Quality and Nutrition Department Via E.Mach 1, I-38010 S.Michele all’Adige, Italy. Traditional flavor analysis relies on gas chromatography coupled to mass spectrometry (GC-MS) methods. Here we describe an indirect method coupling volatile compound formation to an ARO9-promoter-LacZ reporter gene. The resulting b-galactosidase activity correlated well with headspace solid phase micro extraction (HS/SPME) GC-MS data, particularly with respect to the formation of rose flavor. This tool enables large-scale screening of yeast strains and their progeny to identify the most flavor active strains. T he organoleptic perception of beer depends mainly on substances produced by yeast during the fermentation process. Flavor active substances are volatile compounds and include higher alcohols, esters, and fatty acids. In the wine industry attempts are made to increase flavour compounds by either simultaneous or sequential co-fermentations using either different yeast strains, i.e Saccharomyces cerevisiae with a non-Saccharomyces yeast, or mixing bacterial strains, e.g. Oenococcus oeni, with wine yeasts5,8,14,17. Research interest in natural flavors produced by yeasts has gained increasing interest, particularly focusing on isoamyl alcohol (banana flavor) and b-phenylethanol (flowery, rose flavor). Both compounds are produced during amino acid catabolism in yeast9. The Ehrlich pathway, a linear pathway requiring three enzymatic activities, is responsible for converting aromatic amino acids (phenylalanine, tyrosine, and tryptophan), branched-chain amino acids (leucine, isoleucine, and valine) and methionine into higher alcohols. The regulation of the Ehrlich pathway depends at least in part on the Zn2Cys6 transcription factor Aro80, which regulates ARO9 and ARO10 in a nitrogen source dependent manner (Fig. 1A)12. One of the key bottle necks in flavor research is the requirement of chemical analytical tools to measure volatile compounds produced during fermentation, which is generally done using HS/SPME extraction methods coupled to GC-MS2,15. This method, however, is time consuming, requires additional quantitation as well as prior lab scale fermentations and sample preparations, which are often difficult to optimize for high throughput screening. In order to identify a promoter that is most responsive to ARO80 overexpression, we co-transformed ARO80 under the control of the Ashbya gossypii TEF-promoter with plasmids containing ARO8, ARO9, ARO10, and ARO80 promoter-lacZ reporter gene fusions into S. cerevisiae (Fig. 1B). To investigate whether expression of the reporter genes was actually Aro80-dependent we quantified b-galactosidase activity in strains bearing the endogenous ARO80, an ARO80 deletion, or the ARO80 overexpression construct (Fig. 1C). This established the ARO9 as a potential reporter for a strain’s flavor production. To correlate ARO9 reporter gene activity with flavor formation we first determined its activity in a set of strains with S. cerevisiae background expressing ARO80 at wild type levels. This included the laboratory strain CENPK, two hybrid lager yeast strains, collectively known as S. pastorianus as well as a Bordeaux wine yeast. For comparison we used these strains in bench-top fermentation assays and at the end of fermentation volatiles were extracted by HS/SPME and analyzed via GC-MS (Tab. S1). For the comparison of volatile compound formation with b-galactosidase activity we focused our attention to phenylalanine catabolites (rose flavor). This showed that b-galactosidase activity of the ARO9-lacZ reporter correlated well with the amount of b-phenylacetate and bphenylethanol produced by these strains (Fig. 2). To determine the applicability of this tool beyond S. cerevisiae we used the ARO9-reporter with strains from the Saccharomyces sensu stricto complex including S. bayanus, S. cariocanus, S. eubayanus, S. kudriavzevii, S. mikatae, S. paradoxus, and S. uvarum (Fig. 2). The flavor profiles show that there is a great variability in volatile formation between these strains (Tab. S1). This variability is also reflected in the b-galactosidase activity in these strains indicating that high b-galactosidase activity pairs with increased flavor production. A correlation curve was analyzed comparing b-galactosidase activity with the combined flavor values for 2-phenyl ethanol and 2-phenyl acetate (Fig. 2C). This took into account that Aro9 enzymatic activity is upstream of 2-phenyl ethanol and 2-phenyl acetate production. SCIENTIFIC REPORTS | 4 : 3707 | DOI: 10.1038/srep03707 1 www.nature.com/scientificreports Figure 1 | Identification of a reporter gene for Ehrlich Pathway activity. (A) Amino acids (branched-chain amino acids, leucine, isoleucine, and valine, aromatic amino acids, phenylalanine, tyrosine, and tryptphan, or methionine) are converted in the Ehrlich pathway to fusel alcohol or fusel acids in a three step process. The genes encoding enzymes that catalyze single steps are indicated. Oxidation of aldehydes to fusel acids is done by aldehyde dehydrogenases (e.g. ALD1). Reduction of aldehydes to fusel alcohols is done by alcohol dehydrogenases (e.g. ADH1). Transcriptional regulation by Aro80 and co-factor requirement is indicated. (B) Plasmids carrying the ARO80 overexpression and one of the ARO-promoter-lacZ reporter gene constructs were co-transformed into S. cerevisiae (BY4741). (C) Quantitative b-galactosidase assay with strains bearing the indicated ARO-promoter-lacZ constructs in strains in which ScARO80 was either overexpressed or deleted, or contained the wildtype ARO80. Fermented beverages contain only small amounts of volatile compounds; yet, these are of paramount importance for the flavor profile and organoleptic perception of a beverage19,20. Changes in brewing technology, e.g. introduction of high-gravity brewing, can drastically alter the flavor composition - in this case - by resulting in an increase in the amount of acetate esters. Consumer preference is towards all natural flavors and unique flavor signatures10. Based on this nonGMO preference, three main roads are currently followed to improve flavor content of beverages: (i) choice of the starter culture, (ii) mixed fermentations using different yeast species or a combination of yeast and bacterial species, and (iii) selection of strains high in volatile compound formation via yeast breeding approaches1,5,6,22. For example, yeasts belonging to the genera Hanseniaspora and Pichia are good producers of acetate esters, whereas mixed fermentations with S. cerevisiae and Lachancea thermotolerans increased the level of b-phenylethanol4,21. Furthermore, mixed fermentations, including S. cerevisiae and a bacterial strain e.g. Oenococcus oeni, promise to provide novel flavor variations17. With the highly advanced gene function analyses in S. cerevisiae the genetic repertoire involved in volatile compound formation has SCIENTIFIC REPORTS | 4 : 3707 | DOI: 10.1038/srep03707 been elucidated to a great extent18. The Ehrlich pathway plays a central role in aromatic and branched-chain amino acid catabolism resulting in the conversion of amino acids to aroma compounds9. Several studies have described an increase in flavor production by selecting for yeast strains resistant to fluoro-amino acids. An increased production of isoamyl alcohol, for example, can be achieved by selecting mutants resistant to trifluoroleucine3. In such strains a mutation of D578Y in the LEU4 gene releases feedback inhibition and initiates increased production of leucine and its catabolites16. Using a genetic approach it was shown that overexpression of the alcohol acetyl transferases ATF1 and ATF2 substantially increased the production of isoamyl acetate20. The indirect assay described in this study converts Ehrlich pathway activity into a reporter gene readout that can be quantified as b-galactosidase activity. We base the tool on the ARO9 promoter as the ARO8 promoter was not responsive to Aro80 and has been shown to be under general control13. With this method we can preferably assay rose flavor. Apparently, however, this reporter is not discriminatory towards branched chain amino acids (Tab. S1). 2 www.nature.com/scientificreports Figure 2 | Comparison of b-galactosidase activity with volatile compound formation. (A) Assay with either the indicated S. cerevisiae strains (A) or with Saccharomyces sensu stricto strains (B). Upper panels depict b-galactosidase activity based on the ARO9p-lacZ reporter construct. Lower panels show bphenylethanol and b-phenylacetate volatile compounds. Note: Fermentation with the wine strain in (A), was done in YPD due to its lack of MAL-genes. The low amount of flavor produced by S. mikatae, S. cariocanus, and S. cerevisiae in (B) is due to their inability to end-ferment granulated malt used in these fermentations. Correlation of -galactosidase activity and the combined yield of phenylalanine catabolites are shown in (C). Our tool is fast and convenient and can be adapted for use with high throughput microtiter plate assays in yeast7,11. Thus this indirect flavor assay system is inexpensive and allows screening of large libraries of yeast strains as well as F1/F2 populations of interbred strains. This will lead to the rapid identification of strains with potentially improved flavor characteristics compared to the parental strains. Additionally, different growth regimes can lead to altered flavor production. This allows the implementation of changes in oxygen supply and use of different nitrogen sources. 1. Arroyo-Lopez, F. N. et al. Yeasts in table olive processing: desirable or spoilage microorganisms? Int J Food Microbiol 160, 42–49 (2012). 2. Canuti, V. et al. Headspace solid-phase microextraction-gas chromatographymass spectrometry for profiling free volatile compounds in Cabernet Sauvignon grapes and wines. J Chromatogr A 1216, 3012–3022 (2009). 3. Casalone, E. et al. Genetic and biochemical characterization of Saccharomyces cerevisiae mutants resistant to trifluoroleucine. Res Microbiol 148, 613–623 (1997). 4. Comitini, F. et al. Selected non-Saccharomyces wine yeasts in controlled multistarter fermentations with Saccharomyces cerevisiae. Food Microbiol 28, 873–882 (2011). 5. Domizio, P. et al. Outlining a future for non-Saccharomyces yeasts: selection of putative spoilage wine strains to be used in association with Saccharomyces cerevisiae for grape juice fermentation. Int J Food Microbiol 147, 170–180 (2011). 6. Garcia Sanchez, R., Solodovnikova, N. & Wendland, J. Breeding of lager yeast with Saccharomyces cerevisiae improves stress resistance and fermentation performance. Yeast 29, 343–355 (2012). 7. Gietz, R. D. & Schiestl, R. H. Microtiter plate transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc 2, 5–8 (2007). 8. Gobbi, M. et al. Lachancea thermotolerans and Saccharomyces cerevisiae in simultaneous and sequential co-fermentation: a strategy to enhance acidity and improve the overall quality of wine. Food Microbiol 33, 271–281 (2013). 9. Hazelwood, L. A., Daran, J. M., van Maris, A. J., Pronk, J. T. & Dickinson, J. R. The Ehrlich pathway for fusel alcohol production: a century of research on Saccharomyces cerevisiae metabolism. Appl Environ Microbiol 74, 2259–2266 (2008). 10. Hugenholtz, J. Traditional biotechnology for new foods and beverages. Curr Opin Biotechnol 24, 155–159 (2013). 11. Ichikawa, K. & Eki, T. A novel yeast-based reporter assay system for the sensitive detection of genotoxic agents mediated by a DNA damage-inducible LexA-GAL4 protein. J Biochem 139, 105–112 (2006). SCIENTIFIC REPORTS | 4 : 3707 | DOI: 10.1038/srep03707 12. Iraqui, I., Vissers, S., Andre, B. & Urrestarazu, A. Transcriptional induction by aromatic amino acids in Saccharomyces cerevisiae. Mol Cell Biol 19, 3360–3371 (1999). 13. Iraqui, I., Vissers, S., Cartiaux, M. & Urrestarazu, A. Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferases I and II reveals a new aminotransferase subfamily. Mol Gen Genet 257, 238–248 (1998). 14. Kim, D. H., Hong, Y. A. & Park, H. D. Co-fermentation of grape must by Issatchenkia orientalis and Saccharomyces cerevisiae reduces the malic acid content in wine. Biotechnol Lett 30, 1633–1638 (2008). 15. Mauriello, G., Capece, A., D’Auria, M., Garde-Cerdan, T. & Romano, P. SPMEGC method as a tool to differentiate VOC profiles in Saccharomyces cerevisiae wine yeasts. Food Microbiol 26, 246–252 (2009). 16. Oba, T., Nomiyama, S., Hirakawa, H., Tashiro, K. & Kuhara, S. Asp578 in LEU4p is one of the key residues for leucine feedback inhibition release in sake yeast. Biosci Biotechnol Biochem 69, 1270–1273 (2005). 17. Rossouw, D., Du Toit, M. & Bauer, F. F. The impact of co-inoculation with Oenococcus oeni on the trancriptome of Saccharomyces cerevisiae and on the flavour-active metabolite profiles during fermentation in synthetic must. Food Microbiol 29, 121–131 (2012). 18. Styger, G., Jacobson, D., Prior, B. A. & Bauer, F. F. Genetic analysis of the metabolic pathways responsible for aroma metabolite production by Saccharomyces cerevisiae. Appl Microbiol Biotechnol 97, 4429–4442 (2013). 19. Verstrepen, K. J. et al. Flavor-active esters: adding fruitiness to beer. J Biosci Bioeng 96 (2003). 20. Verstrepen, K. J. et al. Expression levels of the yeast alcohol acetyltransferase genes ATF1, Lg-ATF1, and ATF2 control the formation of a broad range of volatile esters. Appl Environ Microbiol 69, 5228–5237 (2003). 21. Viana, F., Gil, J. V., Genoves, S., Valles, S. & Manzanares, P. Rational selection of non-Saccharomyces wine yeasts for mixed starters based on ester formation and enological traits. Food Microbiol 25, 778–785 (2008). 22. Zott, K. et al. The grape must non-Saccharomyces microbial community: impact on volatile thiol release. Int J Food Microbiol 151, 210–215 (2011). Acknowledgments This research was supported in part by the European Union Marie Curie Initial Training Network Cornucopia (http://www.yeast-cornucopia.se/). Author contributions D.R. carried out the molecular experiments; D.R. and K.T. carried out flavor measurements; A.W., J.W.W. and U.V. designed the experiments, A.W. and D.R. prepared the figures, J.W.W. wrote the main manuscript text; all authors reviewed the manuscript. 3 www.nature.com/scientificreports Additional information Supplementary information accompanies this paper at http://www.nature.com/ scientificreports Competing financial interests: The authors declare no competing financial interests. SCIENTIFIC REPORTS | 4 : 3707 | DOI: 10.1038/srep03707 How to cite this article: Ravasio, D., Walther, A., Trost, K., Vrhovsek, U. & Wendland, J. An indirect assay for volatile compound production in yeast strains. Sci. Rep. 4, 3707; DOI:10.1038/srep03707 (2014). This work is licensed under a Creative Commons AttributionNonCommercial-NoDerivs 3.0 Unported license. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-nd/3.0 4 Paper 2 Paper 2 The riboflavin over producer Ashbya gossypii produces significant amounts of fruity flavours compare to the close relative Eremothecium cymbalariae. Comparative genomic analysis showed that E. cymbalariae lacks most of the Ehrlich pathway genes, especially members of conserved ARO gene family. In A. gossypii mutation in the ARO genes led to a strong reduction in volatile production compare to the wild-type. On the other hand AgAro80 over expression produced significantly higher yields of VOCs, especially of isoamyl alcohol. Furthermore, in the study we compared the kinetic volatile profiles of the two Eremothecium species. The volatile compound analysis showed that both Eremothecium species produce large amounts of isoamyl alcohol while E. cymbalariae, lacking the major components of the ARO family, does not produce 2-phenylethanol. 65 RESEARCH ARTICLE Major contribution of the Ehrlich pathway for 2-phenylethanol/ rose flavor production in Ashbya gossypii € rgen Wendland & Andrea Walther Davide Ravasio, Ju Carlsberg Laboratory, Yeast Genetics, Copenhagen V, Denmark €rgen Wendland, Correspondence: Ju Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, DK-1799 Copenhagen V, Denmark. Tel.: +45 3327 5230; fax: +45 3327 4708; e-mail: [email protected] Received 13 May 2014; accepted 3 June 2014. DOI: 10.1111/1567-1364.12172 Editor: Terrance Cooper Keywords ARO80; VOC; volatile flavour compounds; biodiversity. Abstract Aroma alcohols of fermented food and beverages are derived from fungal amino acids catabolism via the Ehrlich pathway. This linear pathway consists of three enzymatic reactions to form fusel alcohols. Regulation of some of the enzymes occurs on the transcriptional level via Aro80. The riboflavin overproducer Ashbya gossypii produces strong fruity flavours in contrast to its much less aromatic relative Eremothecium cymbalariae. Genome comparisons indicated that A. gossypii harbors genes for aromatic amino acid catabolism (ARO8a, ARO8b, ARO10, and ARO80) while E. cymbalariae only encodes ARO8a and thus lacks major components of aromatic amino acid catabolism. Volatile compound (VOC) analysis showed that both Eremothecium species produce large amounts of isoamyl alcohol while A. gossypii also produces high levels of 2-phenylethanol. Deletion of the A. gossypii ARO-genes did not confer any growth deficiencies. However, A. gossypii ARO-mutants (except Agaro8a) were strongly impaired in aroma production, particularly in the production of the rose flavour 2-phenylethanol. Conversely, overexpression of ARO80 via the AgTEF1 promoter resulted in 50% increase in VOC production. Together these data indicate that A. gossypii is a very potent flavour producer and that amongst the non-Saccharomyces biodiversity strains can be identified that could provide positive sensory properties to fermented beverages. YEAST RESEARCH Introduction Fermented beverages contain a variety of flavour active compounds that convey a fruity aroma, which is very prominent in beer and sake (Verstrepen et al., 2003; Kitagaki & Kitamoto, 2013). Volatile esters represent the most important group. Amongst them 2-phenylethanol, isoamyl alcohol, and ethyl caproate convey rose/flower, banana/fruity, and apple aromas, respectively. In lager beer high amounts of isoamyl alcohol can be present while other esters tend to contribute only minor amounts to the overall flavour bouquet. Alterations in beer flavour profile have been experienced when changing the production conditions. The amount of higher alcohols increases when using oxygenated wort or higher fermentation temperatures (Valero et al., 2001). Additionally, high-gravity brewing (providing increased amounts of sugars) results in increased production of acetate esters (Saerens et al., 2008). The biochemistry of volatile compound formation is based on amino acid catabolism. The corresponding FEMS Yeast Res && (2014) 1–12 pathway was already described in 1907 by the German biochemist Felix Ehrlich, (1907). The pathway consists of three reactions: the initial transamination of an amino acid, a decarboxylation and a subsequent alcohol dehydrogenase reaction (Fig. 1; for review see Hazelwood et al., 2008). In Saccharomyces cerevisiae several genes and gene families can perform each reaction. The transamination can be carried out by Aro8/Aro9 and the branched-chain amino acid transaminases Bat1/Bat2. The decarboxylation occurs through the Ehrlich pathway gene ARO10 or by the pyruvate decarboxylases Pdc1/Pdc5/ Pdc6. This will convert an amino acid first into an a-keto acid and then into an aldehyde. In S. cerevisiae these aldehydes are then converted either to aroma alcohols or aroma acids via either alcohol dehydrogenases (encoded by the ADH-gene family) or aldehyde dehydrogenases (encoded by the ALD-gene family), respectively. Genetic studies of these genes and others, including for example the alcohol acetyl transferase genes ATF1/ATF2, contributed greatly to the understanding of the molecular basis of ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 2 D. Ravasio et al. 2-oxoglutarate Amino acid Glutamate CO2 α-keto acid O NAD(P)H, H+ Aldehyde O R O R OH OH O O O Transaminase Acetate R CH OH NH2 CoA Alcohol R R Acyl CoA NAD(P)+ Decarboxylase Dehydrogenase R1 Acetyltransferase Amino acid α-Keto acid Fusel aldehyde Fusel alcohol Fusel acetate Leu 4-Methyl-2-oxopentanoate 3-Methylbutanal* Isoamyl alcohol* Isoamyl acetate** Val 3-Methyl-2-oxobutanoate 2-Methylpropanal* Isobutanol* Isobutyl acetate** Ile 3-Methyl-2-oxopentanoate 2-Methylbutanal* 2-Methylbutanol Ethyl pentanoate Phe 3-Phenyl-2-oxopropanoate 2-Phenylethanal 2-Phenyl ethanol* 2-Phenylacetate** * Compounds detected in A. gossypii and E. cymbalariae; ** Compound detected in E. cymbalariae only flavour production in S. cerevisiae (Iraqui et al., 1998; Dickinson et al., 2003; Verstrepen et al., 2003; Vuralhan et al., 2005; Lilly et al., 2006; Ravasio et al., 2014). The need for all-natural flavour production may guide the selection of suitable lager or wine yeasts. Alternatively, other yeast strains, collectively termed non-Saccharomyces yeasts may be considered as flavour producers (Domizio et al., 2011). This yeast biodiversity has not been evaluated to its full extent. Yeast species derived from several genera, including Dekkera, Hanseniaspora, Lachancea, Pichia, Saccharomycodes, Zygosaccharomyces, have been shown to contribute to the flavour profile of fermented beverages in interesting new ways either in sequential fermentation or when used as co-inoculants (Viana et al., 2008; Ciani et al., 2010; Gobbi et al., 2013). Ashbya gossypii, a known and industrially exploited overproducer of riboflavin/vitamin B2, is a filamentous ascomycete within the Saccharomycetaceae. Ashbya gossypii is a protoploid, pre-whole genome duplication species with a small genome of just 8.7 Mb + rDNA-repeats (Dietrich et al., 2004). Molecular studies have centered on increasing riboflavin productivity (Stahmann et al., 2000; Jimenez et al., 2008; Park et al., 2011). With the identification of highly efficient homologous recombination gene function analyses were initiated studying polar hyphal growth and nuclear dynamics in A. gossypii (for review see Wendland & Walther, 2005; Schmitz & Philippsen, 2011). Comparative genomics revealed marked differences between A. gossypii and its close relative, the filamentous fungus Eremothecium cymbalariae. These include genome size (8.7 Mb vs. 9.7 Mb), chromosome number (7 vs. 8), degree of synteny with the yeast ancestor (higher in E. cymbalariae), and GC-content (52% vs. 40%; Wendland & Walther, 2011). Furthermore, we noticed decisive differences in growth ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved Fig. 1. Ehrlich pathway conversion of amino acids into fusel alcohols and esters. The relevant co-factors are indicated for each reaction. Specific molecular groups are highlighted and enzymatic functions for each reaction are provided. For the amino acids processed in Ehrlich pathway reactions the intermediates are noted. Several of these substances were detected in Eremothecium spec. as indicated. pattern, colony morphology and flavour production between both species. The aim of this report was to study the potential of A. gossypii for flavour production and to compare it with its relatives E. cymbalariae and S. cerevisiae. For that purpose we targeted the Ehrlich pathway ARO-genes for deletion in A. gossypii and employed gas chromatography methods to measure the volatile aroma compound formation in these strains. Our results reveal the potential use of A. gossypii for natural flavour production in beverages, which provides further support for screening the nonSaccharomyces biodiversity for novel strains to be used in the food and beverage industry. Materials and methods Strains and media Strains generated and used in this study are shown in Table 1. Yeast strain CEN.PK2 and WS34/70 were grown in YPD (1% yeast extract, 2% peptone, 2% glucose) at 30 °C. Ashbya gossypii and E. cymbalariae were grown in AFM (1% yeast extract, 2% caseine peptone, 2% glucose) at 30 °C. Antibiotic substances (G418 or ClonNAT) were added using a final concentrations of up to 200 lg mL1 for the selection of transformants. Plates were incubated for 7 days at 30 °C prior to photography. For the growth assays diameter of the mycelium was measured daily. Biological triplicates were performed. For sporulation, an overnight culture of A. gossypii was further incubated in minimal medium (1.7 g L1 YNB w/o ammonium sulphate and w/o amino acids, 0.69 g L1 CSM, 20 g L1 glucose, 1 g L1 asparagine, and 1 g L1 myo-inositol) for up to 5 days. FEMS Yeast Res && (2014) 1–12 3 Ehrlich pathway in Ashbya gossypii Table 1. Strains used and generated in this study Strain Collection number Genotype Source ATCC 10895 A. gossypii Eremothecium cymbalariae Saccharomyces pastorianus CEN.PK2 A. gossypii A. gossypii A. gossypii A. gossypii A. gossypii A. gossypii 71 C64 C44 C598 C692 C694 C703 C632 C696 C787 leu2 Wild-type Weihenstephan Lager Yeast 34/70 Prototrophic strain, (CEN.PK113-7d x CEN.PK113-1A) Δagr167w (Δaro8a) Δafr548w (Δaro8b) Δagr167w/afr548w (Δaroa/b) Δacr211w (Δaro10) Δadr199c (Δaro80) ADR199C XL (ARO80XL) Lab Strain DBVPG 7215 Lab Strain Lab strain This study This study This study This study This study This study Transformation Transformation of A. gossypii was done by electroporation as described previously (Wendland et al., 2000). PCR-based cassettes were amplified from pFA-GEN3/ pFA-SAT1 plasmids (see Table 2) using gene specific S1 and S2 primers. For the deletion of ARO80 a disruption cassette was cloned containing a 2 kb ORF-fragment using the primer G1-AgARO80 (#6117) and G4-AgARO80 (#6118). An internal 1.1 kb EcoRV-NdeI fragment was replaced by kanMX. The ARO80 disruption cassette was cleaved from the vector backbone with KpnI and SpeI and contained flanking homology regions of 0.45 and 0.6 kb at the 50 and 30 ends, respectively. To create a chromosomal ARO80 overexpression strain an integration cassette was generated. The ARO80-ORFterminator fragment was amplified using the primer A1-AgARO80 (#6170) and A4-AgARO80 (#6171). The resulting 3.2 kb fragment was then cloned downstream of the ScTEF1-promoter of the pFA-GEN3-ScTEF1p vector via XhoI/SacII. The AgARO80-promoter served as 50 -flanking homology region. This fragment was amplified by PCR (primers #6287-#6288) and after a PvuII/MscI cleavage cloned into the unique PvuII site upstream of the GEN3 marker gene in pFA-GEN3-ScTEF1p-AgARO80, resulting in pFA-AgARO80p-GEN3-ScTEF1p-AgARO80. Two NcoI sites within the flanking homolog regions were used to release the overexpression cassette, which provided flanking homology regions of 0.26 and 2.7 kb at the 50 and 30 ends, respectively. Table 2. Plasmids used and generated in this study Plasmid Description Source #121 #550 pFA-KanMX6 pFA-SAT1 #C886 #C791 #C886 pFA-AgARO80p-GEN3-ScTEF1p-AgARO80 pSK-AgARO80::kanMX pFA-AgARO80pGEN3-ScTEF1p-AgARO80 Philippsen lab Schaub et al. (2006) This study This study This study FEMS Yeast Res && (2014) 1–12 Primary heterokaryotic transformants were sporulated and homokaryotic mutant mycelia were generated from uninucleate and haploid spores. For each desired genetic manipulation, two independent transformants were generated. All primers are listed in Table 3. Primers were obtained from Integrated DNA Technologies (IDT, Leuven, Belgium). Diagnostic PCR was used for verification of correct integration of a disruption cassette and concomitant absence of the target gene in homokaryotic deletion strains. Fermentation conditions Tall tube cylinders containing 200 mL medium were used for fermentation. As fermentation broth YPD (with 15% glucose) was used for CEN.PK2 and WS34/70 at 20 °C, respectively. The starting cell density was set to OD600 at 0.2. Tall tubes containing magnetic stirrers were placed on stirrer pads run at 190 r.p.m. Fermentation progress was monitored over 5 days measuring CO2 loss and reduction of sugar content using a DMA 35 Anton Paar densitometer, which determines medium gravity in °Plato. The fermentation was considered finished when the sugar content did not drop further. Fermentation supernatants were decanted and used for GC/MS, GC/flame ionization detector (FID) analysis. All fermentations were carried out in biological duplicates. Eremothecium growth conditions for flavor profiling Strains were pre-cultured o/n in AFM. One millilitre of each pre-culture was used to inoculate a 150 mL AFM culture in a 250 mL baffled flasks. At specific time points 50 mL samples were collected. In order to preserve the volatiles and stop cell metabolism samples were kept at 20 °C until analysis. Analytical methods – GC/MS, GC/FID Two different extraction methods were used in this study. For the comparison of A. gossypii mutants with yeast ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 4 D. Ravasio et al. Table 3. Oligos used in this study Oligo Name Sequence 50 -to-30 * #6129 #6130 #6109 #6110 #6111 #6112 #6127 #6128 #6113 #6114 #6115 #6116 #6121 #6122 #6123 #6124 #6125 #6126 #6297 #6171 #6117 #6118 #6193 #6305 #1202 #1198 #6717 #6718 S1-AGR167w (ARO8a) S2- AGR167w (ARO8a) G1-AGR167w G4-AGR167w I1-AGR167w I2-AGR167w S1-AFR548w (ARO8b) S2-AFR548w (ARO8b) G1-AFR548w G4-AFR548w I1-AFR548w I2-AFR548w S1-ACR211w (ARO10) S2-ACR211w (ARO10) G1-ACR211w G4-ACR211w I1-ACR211w I2-ACR211w 50 -ADR199c (KpnI) 30 -ADR199c (XbaI) G1-ADR199c G4-ADR199c I1-ADR199c I2-ADR199c G2-KanMX6 G3-KanMX6 G2-SAT1 G3-SAT1 TAAGTCAGCAAGATCGCTGGGCGCTAAGGTAGATAACGACAAGAGgaagcttcgtacgctgcaggtc GCACCACGAGGCAGGGCAGGTGACTGGAGGCTAGTATTTTATGGActgatatcatcgatgaattcgag CTCGGAACCGGGTCAGTTC GACCTTGGAAGTGGACTCC CAGCACACGGAGAAGTTCCAC CCACGAGCGTGCTGCCCATC CCGCACAGTGGCTCCCGCAGGGCGCTTCTTTGGCTGAGCGCTCCGgaagcttcgtacgctgcaggtc AAGTCTTGGCCACAAGTGGCAATCGAAGTCGGCACCTATAAGTGActgatatcatcgatgaattcgag CTCGTCAAAGCTGGCTTACTG CTGGAGACGCTCTCCTCGG GACGTGCTGGCGACGGTCG GGAGAACGAGTCCAGACGC AACAGGGGTAGGAGGTTTACAGGAGGTAAGCGAGCGGCACGAGACgaagcttcgtacgctgcaggtc CCCCTGCATGTCTTCTGTTGCTCGTCTGCGGAGTAGCTACGCAGCctgatatcatcgatgaattcgag GTGGCTATTCGTGGGCTGG GCGTAGAACCAGCTCTCTTC GGCTCTCAATGGCGTGGCAG CGCATAGTATTGCAGGCGTGC AGAATAggtaccGTCCCAGTGCTTTTGTGACCGTC ATAAGAtctagaGTACCAGCTCCATAGTCCATGGTAATC CTCATCACTTGTGTGGAGCC GCCGTAGAGGATGCGCTC GTCGAATCGCGGTTCTCCG CTGAACTCCGGCTCATCGC GCGTTTCCCTGCTCGCAGGTC CGCCTCGACATCATCTGCCC GCAATAAATCTTGGTGAGAACAGC GCGGCATTGACCTCTTCACG *Restriction sites are in lower case. strains, a solvent extraction with carbon disulphide (CS2) was used. The samples were stirred for 30 min, centrifuged and 2 lL of the liquid organic phase was injected into the gas chromatograph (Agilent 6890 GC). 1-octanol was used as an internal standard. Detection of volatiles was performed using a FID. The volatiles were separated on a DBWAX capillary column (30 m 9 0.32 mm 9 0.25 lm). For comparison of Eremothecium strains volatile compounds were measured using biological and technical duplicates for dynamic headspace sampling. As an internal standard 4 methyl-1 pentanol was added to each sample. All samples were equilibrated to 37 °C in a water bath and then purged with hydrogen (100 mL min1) for 20 min while stirring at 200 r.p.m. The volatile compounds were collected on Tenax-TA traps (250 mg, mesh size 60/80, density 0.37 g mL1, Buchem bv, Apeldoorn, The Netherlands) at 37 °C. To eliminate excess water traps were purged by hydrogen flux of 100 mL min1 for 10 min. The trapped volatiles were desorbed using an automatic thermal desorption unit (ATD 400, Perkin Elmer, Norwalk, CT) and were automatically transferred to a gas chromatograph-mass spectrometer (789OA GC system, 5975C VL MSD, Agilent technologies, Santa ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved Clara, CA). Separation of volatiles was carried out on a ZB-Wax capillary column (Zebron capillary, 30 m 9 0.25 mm 9 0.5 lm). The mass spectra were recorded in electronic impact mode at 70 eV in a mass/charge ratio from 15 to 300 m/z. Data analysis was performed using the software program MSDCHEMSTATION (Version E.02.02.1431, Agilent Technologies). Identification of compounds was based on comparison with a mass spectral database (Nist 1.0.0.23). One characteristic quantifier ion and two to three qualifier ions were selected for each compound. The peak area of the quantifier ion was used for quantification. Results Comparison of flavour production between A. gossypii and S. cerevisiae The amino acid catabolism of branched-chain amino acids (Leu, Val, Ile) and phenylalanine via the Ehrlich pathway generates a-keto acid and fusel aldehyde intermediates that are converted to fusel alcohol, which can be esterified into fusel acetates (Fig. 1). Ashbya gossypii produces a FEMS Yeast Res && (2014) 1–12 5 Ehrlich pathway in Ashbya gossypii characteristic highly fruity flavour when grown either on plates or in liquid culture. For a comparison of flavour profiles via GC/FID measurements of volatile compounds we used A. gossypii grown in AFM for 5 days, the S. cerevisiae strain CEN.PK2, and the Weihenstephan lager yeast production strain grown in YPD (15% glucose; Fig. 2). All strains were incubated up to 5 days in either oxidative (A. gossypii) or fermentative conditions (yeast strains). To increase the volatile production the sugar content of the media was increased to 15% glucose. Since the growth of A. gossypii was significantly reduced in media with sugar content higher than 2% we incubated this stain in standard AFM medium. This showed that A. gossypii was superior in 2-phenylethanol production compared to these yeast strains. Comparison of flavour production between Eremothecium species Volatile compound formation has not been analysed so far in Eremothecium species. To monitor any change in VOCs formation over time we measured the volatiles produced by liquid cultures at day three, four, and five representing medium to late stages of growth in both Eremothecium species (Tables 4 and 5). Within this comparison between A. gossypii and E. cymbalariae we identified only a marginal production of 2-phenylethanol production in E. cymbalariae. In contrast E. cymbalariae had low levels of isobutylacetate which were absent in A. gossypii (Fig. 3a). Both species showed a strong production of isoamyl alcohol (Fig. 3b). Production of both isoamyl alcohol and 2-phenylethanol in A. gossypii increased over the assayed period and were 500 50 WS34/70 450 CEN.PK2 Ag 45 40 350 35 300 30 250 25 200 20 150 15 100 10 50 5 mg L–1 mg L–1 400 0 0 Iso butanol Isoamyl alcohol 2-phenyl ethanol Isoamyl acetate 2-phenyl ethyl acetate Fig. 2. Comparison of flavor compounds between Ashbya gossypii (Ag) and yeast strains. Gas chromatography was employed to measure the indicated fusel alcohols or esters. Strains: Weihenstephan lager yeast (WS34/70) and Saccharomyces cerevisiae laboratory strain CEN.PK2. For culture and growth conditions see ‘Materials and methods’. FEMS Yeast Res && (2014) 1–12 highest at day 5. Eremothecium cymbalariae, on the other hand, produced isoamyl acetate and 2-phenyl acetate but only in the initial period of growth and these compounds were significantly reduced at day 4 and 5. Thus our analysis indicates that A. gossypii produces strong notes of banana and rose flavour, that is flavour alcohols, while E. cymbalariae produces higher amounts of esters. Specifically, E. cymbalariae generated high amounts of ethyl acetate and ethyl propionate, which at moderate concentration impart pear and pineapple like flavours, respectively (Table 5). Components of the Ehrlich pathway in A. gossypii We noted previously that E. cymbalariae lacks most components of the Ehrlich pathway which are, however, present in A. gossypii (Wendland & Walther, 2011). Here we provide a more detailed analysis of the Ehrlich pathway gene set in comparison to other yeasts and the compiled yeast ancestral genome prior to the whole genome duplication (Gordon et al., 2009). In contrast to S. cerevisiae and the yeast ancestor pre-duplication yeast species may harbour two ARO8 paralogs, here termed ARO8a and ARO8b for A. gossypii, Kluyveromyces lactis and Lachancea waltii (Table 6). The E. cymbalariae genome encodes ARO8a but lacks ARO8b, ARO9, ARO10, as well as the transcriptional regulator ARO80. Comparison of Aroproteins indicated that the transaminases Aro8a, Aro8b and Aro9 are sufficiently divergent to cluster into separate groups (Fig. 4). Interestingly, the amino acid sequence identity between Aro8a and Aro8b paralogs of one species is lower (in the three species evaluated on average 48.1%) than that of Aro8a or Aro8b proteins of different species: on average Aro8a proteins show about 55% amino acid sequence identity, Aro8b proteins about 61.0%. Eremothecium species are distinguished from other yeasts by their lack of ARO9. Deletion of AgARO-genes does not confer growth phenotypes Via PCR-based gene targeting we generated A. gossypii single deletion mutants lacking either ARO8a, ARO8b, ARO10, or ARO80 as well as a double mutant with deletions of ARO8a and ARO8b. Growth comparisons of these mutants with the parental strain showed no radial growth delay (Fig. 5). VOC analysis of A. gossypii Ehrlich pathway mutants The A. gossypii ARO-mutant strains with deletions in Ehrlich pathway components were analysed for their ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 6 D. Ravasio et al. Table 4. Ashbya gossypii VOCs produced over 3 days 3rd day, ppm Alcohols 1 Butanol 2 Phenylethanol Benzylalcohol Isoamyl alcohol Isobutanol Propanol Esters 2 Phenylacetate Ethyl acetate Ethyl phenylacetate Isoamylacetate S-methylthioacetate Aldehydes 2-Methyl-2 butenal (E-E) 2,4-Hexadienal 2-Butenal Acetaldehyde 3-Methyl benzaldehyde Benzaldehyde Benzeneacetaldehyde Butanal 2-Methyl-1 butanal 2-Methyl-1 propanal 3-Methyl-1 butanal 5 Methyl-2-phenyl hexanal Ketons 2 Pentanone 2-Butanone c-Decalactone Acids Acetic acid Ethyl benzoate Ethyl butanoate Ethyl caproate Ethyl isobutyrate Ethyl propionate Valeric acid Aromatic compounds 2,5-Dymethyl-pyrazine 2-Ethyl-5 methyl-pyrazyne 2-Ethyl-6-methyl-pyrazyne 3-Ethyl-2,5-dimethyl-pyrazine 3-Phenylfuran 3-Phenylpentane 1-3-Bis-1,1-dymethylethyl-benzene Others E-1-Hydroxy-1,3butadiene Hexane 5th day, ppm 4.46 4.00 0.11 459.53 36.52 10.87 (0.27) (0.56) (0.08) (11.27) (2.47) (0.66) 6.05 32.86 0.16 754.01 74.16 5.79 (0.49) (6.85) (0.03) (23.27) (4.50) (0.59) 0.36 90.82 0.16 850.24 51.63 / (0.10) (12.42) (0.04) (37.03) (2.95) 0.03 173.46 0.07 0.41 3.32 (0.00) (13.02) (0.01) (0.04) (0.37) 0.39 194.17 0.12 3.85 0.26 (0.13) (2.59) (0.01) (1.46) (0.02) 1.99 70.45 0.18 2.57 0.22 (0.30) (2.39) (0.01) (1.04) (0.02) 3.50 0.15 73.01 0.71 (0.05) (0.17) (2.40) (0.30) 0.50 (0.23) / 3.02 0.69 0.57 0.53 1.89 / 0.22 1.90 0.34 49.09 4.31 71.29 (0.03) (1.28) (0.09) (8.19) (0.57) (5.21) / (1.91) (0.06) (0.06) (0.02) (0.19) / 0.43 (0.07) / / 0.69 (0.05) / 1.00 (0.13) 7.68 (1.10) / 38.40 (5.25) 3.26 (1.03) 24.09 (0.41) 55.31 3.31 57.37 0.13 / 0.73 (0.02) 5.47 (0.36) 2.09 (1.51) 0.15 0.23 2.23 0.26 0.38 4.47 2.36 (0.05) (0.05) (0.04) (0.00) (0.37) (0.54) (1.94) 2.42 0.12 0.10 0.16 0.09 (0.13) (0.08) (0.03) (0.02) (0.01) 1.17 (0.07) 4.69 (0.35) 2.72 (0.73) / (0.45) (0.44) (2.30) (0.06) / / 0.22 (0.01) 7.78 (0.13) 1.22 (0.63) 0.12 (0.09) 0.89 (0.14) 0.79 (0.49) 0.31 (0.27) 0.68 (0.38) / 1.00 (0.04) 3.24 (0.37) 14.23 (1.09) 0.24 (0.02) 2.16 (0.14) 2.47 0.20 0.63 0.25 0.08 0.86 0.08 aroma alcohol profile using GC/FID (Fig. 6a). We found a striking effect of deletions of ARO8b, ARO10, and ARO80 in the severe reduction in 2-phenylethanol formation in A. gossypii. Additionally, the amount of isoamly alcohol was decreased in these strains to about 80% of the wild type level. Deletion of Agaro8a did not result in ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 4th day, ppm (0.08) (0.01) (0.09) (0.02) 0.00 (0.05) (0.06) 0.11 (0.12) 0.66 (0.18) / / 3.11 (0.64) 7.29 (0.85) 2.52 0.22 0.94 0.21 0.05 (0.01) (0.01) (0.15) (0.01) (0.01) / 0.06 (0.02) / 0.37 (0.10) reduction of isoamyl ethanol or 2-phenylethanol production and the aro8a/aro8b double mutant exhibited the aro8b phenotype with respect to these flavours. Thus we conclude that the Ehrlich pathway in A. gossypii plays a major role in 2-phenylethanol production and also contributes to isoamyl alcohol formation. FEMS Yeast Res && (2014) 1–12 7 Ehrlich pathway in Ashbya gossypii Table 5. Eremothecium cymbalariae VOCs produced over 3 days 3rd day, ppm Alcohols 1-Butanol 1-Propanol 2 Phenylethanol 3-Methyl-3-Buten-1-ol Benzylalcohol Citronellol Ethanol Isoamyl alcohol Isobutanol Phenol Esters 2 Phenylacetate 2-Furanmethanol acetate Amylacetate Isoamylacetate Isobutylacetate Ethyl acetate Heptyl acetate Propylacetate Benzylacetate Aldehydes 2-Butenal 2-ethyl-trans-2-butenal 2-Methyl propanal 2-Methyl-2-butenal 2-Methyl-butanal 2-Mehtyl-benzaldehyde 3-Methyl-butanal Acetaldehyde Benzaldehyde Butanal Caproaldehyde Ketons 2 Butanone 2,3-Butanedione Acetophenone c-Decalactone 3-Hydroxy-2-butanone Acids Amyl-propionate Ethyl Butyrate Ethyl Isobutyrate Ethyl propionate Propyl propionate Valeric acid Acetic acid Aromatic compounds 2,5-Dihydro-furan 3-Ethyl-2,5-dimethyl-pyrazyne 2,5-Dymethyl-pyrazine 2-Ethyl-5-methyl-pyrazyne 3-Phenylfuran Benzonitrile FEMS Yeast Res && (2014) 1–12 2.50 (0.02) / 0.26 (0.06) / 0.04 (0.00) / 0.22 275.51 8.32 0.09 (0.03) (2.28) (0.92) (0.01) 6.78 0.11 0.13 367.37 2.37 941.94 0.09 13.63 1.49 (0.11) (0.01) (0.00) (8.69) (0.09) (41.37) (0.02) (1.08) (0.06) 4th day, ppm 7.31 0.83 0.29 0.30 0.04 0.06 0.22 468.72 22.15 0.10 (0.36) (0.15) (0.01) (0.02) (0.00) (0.00) (0.07) (8.72) (2.00) (0.00) 31.60 (1.75) / 42.15 (2.37) 0.75 (0.03) 0.21 (0.01) (2.41) (0.38) (11.86) 0.01 (0.01) (0.58) (0.00) (28.03) (1.35) (0.04) (0.06) (0.25) (0.92) (0.01) (0.90) (0.05) (0.01) (0.07) 0.00 (0.00) 108.03 2.94 1.20 13.18 10.58 0.04 35.93 0.76 0.53 0.87 / (0.30) (3.42) (0.07) (0.11) (0.19) (4.66) (0.01) (4.59) (0.04) (0.04) / (0.00) (0.17) (0.35) (0.01) (1.60) (1.32) 3.31 4.11 0.16 9.41 14.56 (0.63) (0.48) (0.03) (2.74) (0.59) 5.61 4.00 0.13 11.26 11.77 (2.03) (0.43) (0.00) (0.67) (0.83) 5.69 (0.67) 1.05 (0.03) (1.94) (0.01) (0.04) (0.02) 4.20 2.70 0.64 119.46 0.00 7.87 0.31 (0.45) (0.12) (0.08) (3.26) (0.00) (1.70) (0.03) 1.42 0.76 0.19 66.70 (0.02) (0.01) (0.01) (0.25) (0.04) (0.00) (0.00) (0.04) 1.63 0.17 2.28 0.14 0.06 0.08 (0.04) (0.04) (0.17) (0.02) (0.01) (0.02) 1.30 14.24 0.12 5.19 11.94 (0.64) (0.13) (0.05) (0.01) (0.00) (0.00) (0.02) (19.73) (2.39) (0.01) 7.13 0.47 507.13 / 2.12 / 49.04 0.63 1.14 7.80 47.71 0.12 93.29 0.75 0.58 0.34 (0.12) / / 15.23 1.68 720.65 / 2.73 / / 0.05 (0.00) 16.34 2.68 0.31 0.35 0.04 0.05 0.17 526.42 42.60 0.06 0.05 (0.02) / / / / / 5th day, ppm / 65.65 0.31 2.49 0.25 / / 2.44 0.16 0.06 0.08 / 1.23 (0.06) 0.19 (0.03) 4.00 0.15 2.40 0.15 0.04 0.05 (0.07) (0.01) (0.06) (0.00) (0.00) (0.00) ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 8 D. Ravasio et al. Table 5. Continued 3rd day, ppm Others (E)1-Hydroxy-1,3-butadiene 2,4,5-trimethyl-3-oxazoline 2-Isopropylbut-2-enal Hexane 4th day, ppm / / / 0.70 1.04 0.40 0.22 0.22 (0.01) (0.09) (0.03) (0.03) (0.03) 5th day, ppm 0.53 1.24 0.33 0.49 (0.09) (0.05) (0.01) (0.09) ppm expressed as I.S (a) 10 100 8 80 6 60 4 40 2 20 0 10 4 5 E. cymbalariae 5 0 3 Ashbya 0 3 4 day 3 5 4 2-Methylpropanal Isobutanol Isobutyl acetate Phe 2-Phenylethanal 2-Phenylethanol 2-Phenylacetate ppm expressed as I.S Val 100 10 80 8 60 6 40 4 20 2 5 0 0 3 4 5 3 4 5 day ppm expressed as I.S (b) 100 Ashbya 60 40 20 0 3 ppm expressed as I.S E. cymbalariae 80 4 day 5 Ile 2-Methylbutanal 2-Methylbutanol Ethyl pentanoate Leu 3-Methylbutanal Isoamyl alcohol Isoamyl acetate 100 1000 1000 800 600 400 200 0 80 60 40 20 0 3 4 5 800 600 400 200 0 3 4 day 5 3 4 5 Fig. 3. Time course analysis of flavor production in Ashbya gossypii and Eremothecium cymbalariae. Strains were cultured for 5 days and samples were analyzed between days 3–5. Volatile compounds were analyzed via GC/MS. Ehrlich pathway products for the amino acids valine, phenylalanine, isoleucine and leucine were quantified. Compounds written in grey are intermediates of the respective amino acid degradation but were not detected. Table 6. ARO-gene content in different fungal species Transaminase Species* ARO8a ARO8b ARO9 Decarboxylase ARO10 Transcription factor ARO80 Ancestor S. cerevisiae K. lactis L. waltii A. gossypii E. cymbalariae Absent Absent A04906 17462 AGR167W Ecym_7228 Anc_3.511 YGL202W F10021 18982 AFR548C Absent Anc_2.102 YHR137w D11088 14582 Absent Absent Anc_5.456 YDR380W E02707 Absent ACR211W Absent Anc_5.525 YDR421W A01804 Absent ADR199C Absent *Species depicted were: Saccharomyces cerevisiae, Kluyveromyces lactis, Lachancea waltii, Ashbya gossypii, Eremothecium cymbalariae. ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved FEMS Yeast Res && (2014) 1–12 9 Ehrlich pathway in Ashbya gossypii EcymAro8a AgAro8a LwAro8a KlAro8a KlAro8b LwAro8b ScAro8b AgAro8b LwAro9 KlAro9 ScAro9 KlAro80 AgAro80 ScAro80 AgAro10 KlAro10 ScAro10 Fig. 4. Phylogenetic tree of transaminase and decarboxylase genes. Aro-proteins of Ashbya gossypii (Ag), Eremothecium cymbalariae (Ecym), Lachancea waltii (Lw), and Kluyveromyces lactis (Kl) were analyzed using DNASTAR MEGALIGN software. Overexpression of AgARO80 enhances flavour production in A. gossypii Since the deletion of ARO80 showed a clear negative effect on flavour production we went on to analyse if overexpression of ARO80 could further increase flavour levels. To this end the chromosomal AgARO80 gene was placed under the control of the strong constitutive TEF1 promoter from S. cerevisiae (see ‘Materials and methods’). Resulting transformants were compared to the parental wild type strain analysed under the same conditions as Fig. 5. Functional analysis of Ashbya gossypii ARO-genes. Radial colony growth of the indicated strains inoculated at the center of each petri plate was monitored over 8 days. Growth was either at either 30 °C or 37 °C. Mycelia were grown on AFM plates and photographs were taken at the end of the growth period. FEMS Yeast Res && (2014) 1–12 Ag aro8a before (Fig. 6b). It became apparent that ARO80 overexpression resulted in a 2.5 fold increase of isoamyl alcohol and isobutanol levels derived from branched-chain amino acid catabolism, whereas the levels of 2-phenylethanol were basically unchanged, which could be attributable to the limited uptake of phenylalanine from the medium. Discussion Non-conventional yeasts (NCY) harbour a great potential as novel production strains, for example the production of L-lactic acid by Candida sonorensis, or the production of another highly useful chemical building block, Dxylonic acid, by Pichia kudriavzevii, for the production of virus like particles in Kluyveromyces lactis or for the production of all-natural flavours by a wide variety of NCYs (Goretti et al., 2013; Ilmen et al., 2013; Toivari et al., 2013). The scope of this biodiversity within the Saccharomycetaceae has but just begun to be exploited and will provide a rich source for biotechnological research in the future (Domizio et al., 2011). This group of yeasts is very attractive based on their ease of cultivation and molecular genetic tractability combined with small genome sizes allowing for rapid determination of draft genome sequences and the functional analysis of target genes. In this study we have analysed the flavour profile of two closely related Eremothecium species, which are both filamentous fungi belonging to clade 12 of the Saccharomycetes (Kurtzman & Robnett, 2003). Both species differ on the genomic level and morphologically, for example regarding extensive aerial mycelium formation in E. cymbalariae compared to synnemata formation in A. gossypii and also in the shape of their spores (Wendland & Ag aro8b Ag aro8a/b Ag aro10 Ag aro80 Ag wt ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 10 D. Ravasio et al. wt aro8a aro8b aro8a-b aro10 aro80 (a) 600 ppm (mg L–1) 500 400 300 200 100 0 Isobutanol Isoamyl alcohol wt (b) 600 2-Phenyl ethanol TEF1p-ARO80 ppm (mg L–1) 500 400 300 200 100 0 Isobutanol Isoamyl alcohol 2-Phenyl Ethanol Fig. 6. Volatile compound formation in Ashbya gossypii aro-mutants. (a) the indicated mutant strains were grown as described in ‘Materials and methods’ and fusel alcohols of the valine, isoleucine, and phenylalanine were assayed via GC/FID. (b) Overexpressionof the ARO80 transcription factor enhances isoamyl formation in A. gossypii. Walther, 2005). The purpose of this study was to determine differences in flavour production between these Eremothecium species and relate these to the different genetic makeup of ARO-genes. Our flavor profiling results revealed a preference regarding flavour alcohol production in A. gossypii vs. ester production in E. cymbalariae. Higher ester production in E. cymbalariae resembles that found in lager yeast strains fermenting high gravity wort with high concentrations of sugar (Verstrepen et al., 2003). Considering the slow growth of E. cymbalariae even the relatively low amounts of 2% glucose in our experiments may have triggered an excess amount of pyruvate formation resulting in increased acetate ester formation. In line with this we have observed larger amounts of ethyl acetate and other acetate esters in E. cymbalariae compared to the faster growing A. gossypii (see Tables 4 and 5). Ashbya gossypii formed very large amounts of both isoamyl alcohol and 2-phenylethanol. From S. cerevisiae it is known that 2-phenylethanol formation is restricted to the growth phase (Stark et al., ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 2002). Ashbya gossypii generated the highest amounts of 2-phenylethanol among the species we tested in our experiments, which makes it a very efficient natural producer of this flavour. Our deletion analyses showed that Ehrlich pathway genes are of central importance for the production 2-phenylethanol. The microbial production of 2-phenylethanol has recently received considerable attention as an all-natural flavour in the food and cosmetics industry. Due to the toxic effect of large amounts of 2-phenylethanol (>2.5 g L1) in situ removal strategies using organic solvents have been developed to avoid a decrease in growth rate (Stark et al., 2003; Eshkol et al., 2009; Achmon et al., 2011; Hua & Xu, 2011). The production of more fruity notes in beverages could benefit from for example co-fermentations using S. cerevisiae and another non-conventional yeast strain. Such co-fermentations have gained increased popularity in the wine industry (Ciani et al., 2010). Using a lacZ-based assay system we recently evaluated the flavour profiles of S. cerevisiae and its closely related species (Ravasio et al., 2014). In this study we could show that overexpression of ARO80 has a profound impact on flavour production. Thus a more broadly applicable assay for non-conventional yeasts could help linking the expression level of Ehrlich pathway genes to the flavour production capabilities of a previously uncharacterized isolate. Ashbya gossyppi is well-known for its riboflavin overproduction. Recent studies hypothesized that flavindependent detoxification of plant compounds may open new niches for insects (Sehlmeyer et al., 2010; Dietrich et al., 2013). Involving Ashbya in such a plant-insect system required adaptation to an insect environment to sustain viability in milkweed bugs (e.g. during hibernation periods) and overproduction of riboflavin to detoxify toxic alkaloids produced for example by oleander. These environmental stresses may have resulted in alteration and streamlining of the Ashbya genome compared to E. cymbalariae. On the other hand, with such a niche found, reinforcing the relationship of Ashbya with certain insects used for spreading of Ashbya could have occurred by using volatile compounds such as 2-phenylethanol as attractant. Our study opens new aspects of linking genome evolution to both biotic and abiotic environmental challenges. Acknowledgements This research was supported in part by the European Union Marie Curie Initial Training Network Cornucopia. Sequence data for Ashbya gossypii was obtained from the Ashbya Genome Database website at http://agd.vital-it.ch/ index.html. We thank Dr Mikael Agerlin Petersen, University of Copenhagen for help with VOC measurements. FEMS Yeast Res && (2014) 1–12 Ehrlich pathway in Ashbya gossypii References Achmon Y, Goldshtein J, Margel S & Fishman A (2011) Hydrophobic microspheres for in situ removal of 2-phenylethanol from yeast fermentation. J Microencapsul 28: 628–638. Ciani M, Comitini F, Mannazzu I & Domizio P (2010) Controlled mixed culture fermentation: a new perspective on the use of non-Saccharomyces yeasts in winemaking. FEMS Yeast Res 10: 123–133. Dickinson JR, Salgado LE & Hewlins MJ (2003) The catabolism of amino acids to long chain and complex alcohols in Saccharomyces cerevisiae. J Biol Chem 278: 8028– 8034. Dietrich FS, Voegeli S, Brachat S et al. (2004) The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces cerevisiae genome. Science 304: 304–307. Dietrich FS, Voegeli S, Kuo S & Philippsen P (2013) Genomes of Ashbya fungi isolated from insects reveal four mating-type loci, numerous translocations, lack of transposons, and distinct gene duplications. G3 (Bethesda) 3: 1225–1239. Domizio P, Romani C, Lencioni L, Comitini F, Gobbi M, Mannazzu I & Ciani M (2011) Outlining a future for non-Saccharomyces yeasts: selection of putative spoilage wine strains to be used in association with Saccharomyces cerevisiae for grape juice fermentation. Int J Food Microbiol 147: 170–180. € Ehrlich F (1907) Uber die Bedingungen der Fusel€ olbildung €ber ihren Zusammenhang mit dem Eiweissaufbau der und u Hefe. Ber Dtsch Chem Ges 40: 1027–1047. Eshkol N, Sendovski M, Bahalul M, Katz-Ezov T, Kashi Y & Fishman A (2009) Production of 2-phenylethanol from L-phenylalanine by a stress tolerant Saccharomyces cerevisiae strain. J Appl Microbiol 106: 534–542. Gobbi M, Comitini F, Domizio P, Romani C, Lencioni L, Mannazzu I & Ciani M (2013) Lachancea thermotolerans and Saccharomyces cerevisiae in simultaneous and sequential co-fermentation: a strategy to enhance acidity and improve the overall quality of wine. Food Microbiol 33: 271–281. Gordon JL, Byrne KP & Wolfe KH (2009) Additions, losses, and rearrangements on the evolutionary route from a reconstructed ancestor to the modern Saccharomyces cerevisiae genome. PLoS Genet 5: e1000485. Goretti M, Turchetti B, Cramarossa MR, Forti L & Buzzini P (2013) Production of flavours and fragrances via bioreduction of (4R)-()-carvone and (1R)-()-myrtenal by non-conventional yeast whole-cells. Molecules 18: 5736– 5748. Hazelwood LA, Daran JM, van Maris AJ, Pronk JT & Dickinson JR (2008) The Ehrlich pathway for fusel alcohol production: a century of research on Saccharomyces cerevisiae metabolism. Appl Environ Microbiol 74: 2259– 2266. Hua D & Xu P (2011) Recent advances in biotechnological production of 2-phenylethanol. Biotechnol Adv 29: 654–660. FEMS Yeast Res && (2014) 1–12 11 Ilmen M, Koivuranta K, Ruohonen L, Rajgarhia V, Suominen P & Penttila M (2013) Production of L-lactic acid by the yeast Candida sonorensis expressing heterologous bacterial and fungal lactate dehydrogenases. Microb Cell Fact 12: 53. Iraqui I, Vissers S, Cartiaux M & Urrestarazu A (1998) Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferases I and II reveals a new aminotransferase subfamily. Mol Gen Genet 257: 238–248. Jimenez A, Santos MA & Revuelta JL (2008) Phosphoribosyl pyrophosphate synthetase activity affects growth and riboflavin production in Ashbya gossypii. BMC Biotechnol 8: 67. Kitagaki H & Kitamoto K (2013) Breeding research on sake yeasts in Japan: history, recent technological advances, and future perspectives. Annu Rev Food Sci Technol 4: 215–235. Kurtzman CP & Robnett CJ (2003) Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res 3: 417– 432. Lilly M, Bauer FF, Lambrechts MG, Swiegers JH, Cozzolino D & Pretorius IS (2006) The effect of increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles of wine and distillates. Yeast 23: 641–659. Park EY, Ito Y, Nariyama M, Sugimoto T, Lies D & Kato T (2011) The improvement of riboflavin production in Ashbya gossypii via disparity mutagenesis and DNA microarray analysis. Appl Microbiol Biotechnol 91: 1315–1326. Ravasio D, Walther A, Trost K, Vrhovsek U & Wendland J (2014) An indirect assay for volatile compound production in yeast strains. Sci Rep 4: 3707. Saerens SM, Verbelen PJ, Vanbeneden N, Thevelein JM & Delvaux FR (2008) Monitoring the influence of high-gravity brewing and fermentation temperature on flavour formation by analysis of gene expression levels in brewing yeast. Appl Microbiol Biotechnol 80: 1039–1051. Schaub Y, Dunkler A, Walther A & Wendland J (2006) New pFA-cassettes for PCR-based gene manipulation in Candida albicans. J Basic Microbiol 46: 416–429. Schmitz HP & Philippsen P (2011) Evolution of multinucleated Ashbya gossypii hyphae from a budding yeast-like ancestor. Fungal Biol 115: 557–568. Sehlmeyer S, Wang L, Langel D, Heckel DG, Mohagheghi H, Petschenka G & Ober D (2010) Flavin-dependent monooxygenases as a detoxification mechanism in insects: new insights from the arctiids (lepidoptera). PLoS ONE 5: e10435. Stahmann KP, Revuelta JL & Seulberger H (2000) Three biotechnical processes using Ashbya gossypii, Candida famata, or Bacillus subtilis compete with chemical riboflavin production. Appl Microbiol Biotechnol 53: 509–516. Stark D, Munch T, Sonnleitner B, Marison IW & von Stockar U (2002) Extractive bioconversion of 2-phenylethanol from L-phenylalanine by Saccharomyces cerevisiae. Biotechnol Prog 18: 514–523. ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 12 Stark D, Kornmann H, Munch T, Sonnleitner B, Marison IW & von Stockar U (2003) Novel type of in situ extraction: use of solvent containing microcapsules for the bioconversion of 2-phenylethanol from L-phenylalanine by Saccharomyces cerevisiae. Biotechnol Bioeng 83: 376–385. Toivari M, Vehkomaki ML, Nygard Y, Penttila M, Ruohonen L & Wiebe MG (2013) Low pH D-xylonate production with Pichia kudriavzevii. Bioresour Technol 133: 555–562. Valero E, Millan C & Ortega JM (2001) Influence of oxygen addition during growth phase on the biosynthesis of lipids in Saccharomyces cerevisiae (M(3)30-9) in enological fermentations. J Biosci Bioeng 92: 33–38. Verstrepen KJ, Van Laere SD, Vanderhaegen BM et al. (2003) Expression levels of the yeast alcohol acetyltransferase genes ATF1, Lg-ATF1, and ATF2 control the formation of a broad range of volatile esters. Appl Environ Microbiol 69: 5228–5237. Viana F, Gil JV, Genoves S, Valles S & Manzanares P (2008) Rational selection of non-Saccharomyces wine yeasts for ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved D. Ravasio et al. mixed starters based on ester formation and enological traits. Food Microbiol 25: 778–785. Vuralhan Z, Luttik MA, Tai SL et al. (2005) Physiological characterization of the ARO10-dependent, broad-substrate-specificity 2-oxo acid decarboxylase activity of Saccharomyces cerevisiae. Appl Environ Microbiol 71: 3276–3284. Wendland J & Walther A (2005) Ashbya gossypii: a model for fungal developmental biology. Nat Rev Microbiol 3: 421– 429. Wendland J & Walther A (2011) Genome evolution in the eremothecium clade of the Saccharomyces complex revealed by comparative genomics. G3 (Bethesda) 1: 539–548. Wendland J, Ayad-Durieux Y, Knechtle P, Rebischung C & Philippsen P (2000) PCR-based gene targeting in the filamentous fungus Ashbya gossypii. Gene 242: 381–391. FEMS Yeast Res && (2014) 1–12 Paper 3 Paper 3 Non-conventional yeasts (NCY) constitute a rich and accessible resource for new traits that can find applications for new biotechnological processes. In this manuscript we investigated a selection of 18 NCYs, encompassing species that represent the entire Saccharomyces clade. The strains have been tested in fermentation condition and fermentation parameters were collected. In addition the strains have been evaluated under stress condition (i.e. osmotic and oxidative stress) and for the production of off-flavours by several plate assays. Even though each species displayed unique characteristic, the volatile profile analysis highlighted four extreme flavour producers: W. anomalus, P. kluyveri and Z. melli showed very high ester production; in contrast D. subglobosus produced high levels of fruity ketones and aldehydes. 66 third group of five strains produced higher A survey of flavor production among non-conventional yeasts ethanol concentrations than the reference strain and the fourth group consisting of two strains is characterized by either highest or no ketone production. We present a comprehensive overview of these strains identifying those specialized for volatile alcohol and ester formation or ethanol Davide Ravasio, Silvia Carlin, Teun Boekhout, Urska Vrhovsek, Jürgen Wendland and Andrea Walther production, respectively. Introduction Beer is one of the most widely consumed alcoholic beverages in the world. In 2003 the Abstract worldwide beer production reached around Fungi produce a variety of volatile organic 1.82 billion hectoliters and increased to a compounds (VOCs) during their primary and volume of 1.97 billion hectoliters in 2013 (© secondary metabolism. In particular, in the Statista 2014). beverage industry these volatiles contribute to the flavor and aroma profile of the final product. Herein, we evaluated the fermentation ability and aroma profiles of non-conventional yeasts (NCY) that have been isolated from various food sources. A total of 60 strains have been analyzed with regard to their fermentation and flavor profile. After representative a primary strains were screen 18 selected for further strain characterizations based on principal component analysis as well as their fermentation performances. Beer production is divided into two main beer styles: Ale and Lager beers. Generally, ale is produced by top fermenting yeasts and typically at higher temperatures of 15-30 °C. This normally results in faster fermentation. Ales are known for their fruity aromas which are regarded as a distinctive character of top fermenting beers. The word “Lager” actually derives from the German word “lagern”, which means “to store”. Lager beers are produced by bottom fermenting yeasts typically at temperatures below 15 °C. The aroma of lager beers is more These 18 strains have been further divided neutral compared to Ale type beers since they into four groups: Group 1 consists of six contain lower amounts of fruity flavors. strains with exceptionally high flavor production, while group 2 includes five strains with very low flavor production. A Top fermenting and bottom fermenting yeasts are two distinct Saccharomyces species. Top fermenting yeasts typically belong to the species S. cerevisiae. At the end contribute to the beer by a solvent-like aroma of fermentation these yeasts rise to the which gives a warm mouth feel. The latter two surface of the fermenter creating a thick cell are prevalent for their sweet/rose and layer. Bottom fermenting yeasts are called fruity/banana like aroma, respectively [3]. S. carlsbergensis or S. pastorianus. These yeasts are different interspecies parental hybrids strains that of can two be subdivided into two subgroups namely Saaz type strains and Frohberg type strains, which derived from 2 independent hybridization events [1]. Esters that fermentation are produced contribute during mainly to beer the fruitiness of the product. They can be divided into two main groups. The first group of acetate esters consists of fruity esters such as ethyl acetate (solvent like, fruity), isoamyl acetate (banana) and 2-phenyl acetate (rose). spontaneous Ethyl or medium-chain fatty acid esters such fermentation of wort is typical for Belgian as ethyl hexanoate, ethyl octanoate and ethyl Lambic sour beers. Here, the fermentation decanoate belong to the second group of process is not initiated through inoculation esters. They give a fruity apple or wine like with specific yeasts. The wort is filled in a flavor to the beer [4]. Beer production by shallow open vessel that allows microbial intrusion of bacteria and wild yeasts [2] The main aldehyde present in beer is acetaldehyde. It can be formed of ethanol Beer is a very complex product consisting of when oxygen is present [5]. Other aldehydes both volatile and non-volatile components that contribute to the beer aroma are divided that form the final aroma. The contribution of into yeasts to the final flavor bouquet is dependent aldehydes of Maillard reaction and aldehydes on the beer style. In ale beers the contribution of fatty acid oxidation. Strecker aldehydes of the yeast strain to the final aroma is derive from the degradation of leucine, considered to be around 30 % whereas in isoleucine and phenylalanine during wort lager beers the contribution is only 15 %. The boiling and aging. Maillard aldehydes consist volatile compounds produced by the yeast of various heterocyclic compounds which strain belong to different chemical groups. develop due to the reaction of sugars and The most prominent and dominating flavor amino acids. The most abundant Maillard compounds aldehyde in beer is furfural [6]. One of the are higher alcohols, esters, aldehydes, ketones and organic acids. Among the higher alcohols n-propanol, isobutanol, 2-phenylethanol and isoamyl alcohol are the most abundant alcohols. They three groups: Strecker aldehydes, predominant aldehydes of the fatty acid oxidation is trans-2-nonenal (T2N). It creates a stale papery taste that is generally released during storage of beer. Further, ketones contribute an important recent years SPME has been widely used as a aroma to the beer. In particular, diacetyl (2,3- solvent-free buanedione) can influence the flavor of beer. analysis of volatiles in beverages. In brewing process it is considered undesirable due to its unpleasant buttery flavor and its low taste threshold. Diacetyl can be produced during the biosynthesis pathway of valine and isoleucine. Acetolactate, an intermediate of the valine biosynthesis pathway can be oxidized to diacetyl preferably under high fermentation temperatures. At the end of fermentation and during beer maturation diacetyl can be reabsorbed by the yeast cells and converted to 2,3-butanediol via the intermediate acetoin. Both acetoin and 2,3-butanediol have a much higher taste threshold than diacetyl [7]. Short-chain organic acids can extraction method for the Lately, non-conventional yeasts (NCY) or non-Saccharomyces yeasts importance fermented for have gained alcoholic beverages. They produce various mixtures of volatile compounds and therewith contribute to the aroma profile of beverages. [8]. However, these strains have not been characterized in great detail. A vast number of non-conventional yeast strains has been isolated from various food sources and collected in a strain collection database such as CBS (Centraalbureau voor Schimmelcultures, Utrecht, Netherlands). In this study we aimed at covering a broad spectrum of greatly species isolated from different substrates like influence the final beer flavor. They can berries, fruits, cheese, fruit flies or even soil reduce the pH during fermentation and and spanning a broad evolutionary distance therewith give a sour taste to the beer. within the Saccharomycetes. Medium-chain fatty acids such as caproic, caprylic and capric acid can add a rancid Material and Methods goaty flavour to the beer. Since they can Strains and media influence the foam stability of the beer they Strains used in this study are shown in Table are undesirable compounds. 1. Prior to spotting assays yeast strains were Given the low concentration and volatile nature of these aroma compounds gas chromatography coupled to mass spectrometry (GC–MS) offers an optimal technique to analyze the flavor profile of beer. Coupled to this, several sampling methods such as solid-phase micro extraction (SPME), steam distillation extraction (SD) and liquidliquid extraction have been developed. In the grown in YPD (1 % yeast extract, 2 % peptone, 2 % glucose) at room temperature o/n. Then, the cells were harvested by centrifugation, washed in sterile deionized water and finally diluted to an OD600 of 0.1. Dilution series in steps of 1:10 were then spotted onto the plates. For growth tests on granmalt medium (150 g/l malt granules, 5 g/l yeast extract, 2% agar), plates were incubated for 2 days at room temperature prior to photography. YPD Analytical methods GC/MS plates were incubated at 10, 20 and 37°C for Volatile up to 4 days to assess the strains’ thermo analyzed by using a Thermo Scientific TSQ tolerance. SD based medium (20 g/L glucose, Quantum GC Triple Quadropole GC-MS. 2- 6.7 g/l YNB w/o amino acids but with octanol was added as an internal standard to ammonium with each sample. The standard was chosen as a addition of cinnamic acid (100 µg/l) was used compound known not to be present in the to test the strains ability to produce phenolic fermentation samples. 2.5 ml of sample were off-flavors. BiGGY agar plates (Bismuth prepared in a 20 ml vial added with Glucose Glycine Yeast Agar, 1 g/l yeast appropriate amounts of sodium chloride, extract, 10 g/l glycine, 10 g/l glucose, 13 g/l 50µl NaN3 0,1%, 25 µl of the internal agar, 3 g/l sodium sulphite, 5 g/l bismuth standard and ascorbic acid. All samples were ammonium citrate) were prepared according incubated for 10 min at 50°C. The volatile to the manufacturer’s instructions (Fluka). compounds were collected and separated on a These plates were then incubated at 20°C for Divinylbenzene/Carboxen/Polydimethylsilox up to 4 days. ane fiber (DVB-CAR-PDMS) for an extraction sulphate, 20 g/l agar) compounds were detected and time of 40 min. A Solgel-wax column, 30 Fermentation conditions Fermentation was performed in 50 ml tubes filled with 40 ml YPD (16°Plato) at 20°C. m/I.D 0.25 mm/Film 0.25 μm, was used for all analyses. Each fermentation was started with a strain The oven was kept at 40 °C for 4 min then density of OD600 = 0.2. The stirring was set at increased by 6 °C/min to 250 °C and kept at 300 rpm using a triangular magnetic stirrer. the final temperature for 5 min. The injector Fermentation performance was monitored up and interface temperatures were kept at 250 to 14 days by daily measurement of the CO2 °C as well. Helium was used as the carrier gas release. The sugar content was measured by a with a flow rate of 1.2 ml/min. The time for DMA 35 Anton Paar densitometer (medium thermal desorption of analytes was 4 min. gravity in °P). The Plato measurements were The MS detector was operated in full scan taken at the beginning and at the end of each mode at 70 eV with a scan range from 35 to fermentation process. The fermentation was 350 m/z. defined as finished when the CO2 loss was not increasing anymore and the Plato value did not reduce further for 2 days. A supernatant of 35 ml was then used for GC-MS analysis. All fermentations biological duplicates. were carried out in Data analysis was performed using the software ThermoXcalibur (Version 2.2 SP1.48, Thermo scientific). Identification of compounds was based on comparison with a mass spectral database (NIST version 2.0). One characteristic quantifier ion and two to three qualifier ions were selected for each compared to a set of brewing and wine yeast compound. The peak area of the quantifier strains. Each selected strain was assigned to a ion code based on its coordinates on a 96 well was used for quantification. The concentration of each volatile was expressed as µg/l 2-octanol I.S. plate. As was expected, most strains harbored good Multivariate data analysis fermentation properties and produced final Multivariate data analysis was performed ethanol concentrations above 5% v/v (see using StatSoft, Inc. STATISTICA version 8.0 below). Only 12 strains produced ethanol (data analysis software system, 2007). A PCA below 5 % v/v. Eight out of these 12 strains model data have been unable to grow in fermentative interpretation. The matrix contained the conditions and were therefore repeated in initial 60 strains considered in this study and oxidative conditions. However, these strains the average of the relative 62 VOCs detected. have been discarded from our strain selection The data were standardized to the mean of 0 due to their inability to grow under anaerobic and unit standard deviation was scaled. conditions. Three of the four strains that have Eigenvalues and eigenvectors of the matrix produced low ethanol concentrations in were calculated and the relative plot was fermentation created. Wickerhamomyces anomalus, the fourth was employed to simplify Results and Discussion strains is are an isolates isolate of of Pichia membranifaciens. Out of this group of strains Strain selection and identification of with a low ethanol production we have representative isolates chosen strain F10, a Wickerhamomyces Via collaboration of the EU-ITN Cornucopia, anomalus strain as representative for our focusing on non-conventional yeasts, with the subset of strains. CBS Fungal Strain Collection we selected 53 different species of the Saccharomyces clade (Table 1). We prioritized strains with a proven background from fermented liquids, fruits, vegetables, or meat. These strains, therefore, may have evolved superior features in fermenting different sugars and thereby producing ethanol or have been recognized as contributing flavor to the samples. All strains were fermented in 16 °Plato YPD. Then flavor profiles were analyzed using GC-MS and Overall we determined 62 different headspace volatiles in the fermentation samples of the 60 yeast strains tested. Key volatile classes that were detected include esters, alcohols aldehydes, ketones and acids. However, the number and amount of VOCs detected varied considerably among the different species. The complete list of identified volatiles for each species is shown in Table 2. Each volatile was grouped into the respective chemical class. Esters were the most prominent group of volatiles. In total 22 the 2 dimensional projection of our data. The different esters could be identified and within first principal component (PC1) explained this group ethyl-esters were particularly 22.44 % of the total variability between the dominating such as ethyl hexanoate and ethyl fermentation acetate, a fruity wine or apple like flavor and associated with parameters like small ethyl sweet pear drop flavor, respectively. esters. PC2 explained 13.40 % of the total Alcohols comprised chemical group the second produced during major these fermentations. Besides ethanol we found 14 different alcohols. Yet, only two compounds, 2-phenylalcohol, known for its rose aroma, and isoamyl alcohol, a banana like flavor, were produced by all the strains we analyzed. results. PC1 was mainly variability. It was more associated with aldehydes and ketones. Both principal components together explained 35.84 % of the variability between the 60 fermentations. The array of species populated all four quadrants of the PCA plot showing the large diversity amongst these yeasts. However, within the dataset different species were well- Fermentations were conducted in tall tube segregated according to the respective genus. cylinders with no aeration. Therefore, oxygen For example, Wickerhamomyces and Pichia depletion these sp. occupied the bottom right quadrant and conditions. Formation of aroma alcohols is separate clearly from the other species based favored under oxygen limited conditions over on their production of small fruity esters the production of aroma acids. Thus only six particularly ethyl acetate, ethyl hexanoate, acids were identified in our VOC profiling isoamyl including acetic acid, butyric acid, decanoic Zygosaccharomyces, acid, hexanoic acid, isovaleric acid and Debaryomyces sp. were found in the upper octanoic acid. Of these acids acetic acid and quadrants. These species had the highest butyric acids were produced by almost all scores for aldehydes, acids and ketones which strains clearly separated them from the other occurs and were rapidly the under most abundant compounds in this chemical class. To provide an overview of the yeast VOC profiles, multivariate data analysis (PCA, principal component analysis) was applied as a statistical technique to allow visualization and grouping of the yeast strains based on the acetate and phenethyl acetate. Saccharomyces and species. The genera Candida, Lachancea, Kazachstania, Hanseniaspora Meyerozyma species were and found to produce similar volatile profiles as lager yeast strains based on those PCA. Therefore, these species grouped closely together. class and amount of volatiles. This PCA was The loading plot (PC1 vs. PC2) represented in based on data derived from biological Figure 1B interprets the relationship between duplicates of all 60 strains. Figure 1A shows the biochemical variables (VOCs). Small esters are well separated by the PC1. Saccharomyces cerevisiae (E11) isolated from Aldehydes, acids and ketones, on the other Spanish sherry produced very high amounts hand, cluster together as they are significantly of fruity alcohols (isoamyl alcohol and 2- present in Zygosaccharomyces, Saccharo- phenyl ethanol) and acids (acetic acid and myces and Debaryomyces species. This butyric acid). Zygosaccharomyces mellis analysis allowed the grouping of our strains (G4) isolated from wine grapes showed an in their overall increased production of volatiles such production of either esters and alcohols or as fruity alcohols and esters as well as acids, aldehydes and ketones. aldehydes and ketones. In contrast, five two major classes based on Based on our results of the PC analysis we continued our experiments with a subset of 18 strains. The selection of these strains was done by considering the results of the multivariate analysis of the VOCs as well as other factors obtained during and after the fermentation such as ethanol production, fermentation speed or efficient sugar conversion. As a reference for the evaluation of strains we used the fermentation results of the strain Weihenstephan WS34/70 (G10). strains, namely Geotrichum candidum (C3), Kazachstania servazii (C9), Kluyveromyces dobzhanskii (D4), Meyerozyma guilliermondii (D11) and Nakaseomyces bacillisporus (E2) showed an overall reduced volatile production Weihenstephan (G10). in comparison However, to Kazach- stania servazii (C9) produced the highest ethanol concentration among the stains tested. Another five strains were selected due to their higher ethanol concentrations compared to the reference strain namely Six strains were selected based on their Clavispora extraordinary volatile profile: In Candida fermentati (D6), Saccharomyces cerevisiae diversa (B4) and Clavispora lusitaniae (B8) (F2), Saccharomycodes ludwigii (F3) and fermentations Schwanniomyces we measured very high lusitaniae (B8), occidentalis Lachancea (F4). The amounts of furfural. Candida diversa was latter is interesting and important for its further recognized for its high production of amylolytic system. This fungus can degrade ethyl hexanoate, a wine or apple like flavor, numerous different starches completely such and butyric acid. Pichia kluyveri (E7) and as potato, barley or wheat starch [9]. Wickerhamomyces anomalus (F10) produced exceptionally high amounts of fruity alcohols and their respective esters such as isoamyl alcohol, 2-phenylethanol and isoamyl acetate and 2-phenyl acetate as well as ethyl hexanoate. Further these strains produced very high amounts of acetic acids. The remaining two strains were chosen according to a unique trait found in their volatile profiles: Hanseniaspora vineae (C7) has been chosen since this strain produced the highest acetoin concentration during fermentation. Acetoin is an intermediate in the conversion of diacetyl to 2,3-butanediol. equal amounts of CO2 every day. During the During fermentation yeast produces diacetyl fermentation of this strain we observed a that is considered a buttery off-flavor. During water-insoluble layer and a biofilm of cells maturation the diacetyl can be taken up and appearing on the fermentation cylinder. This consumed enzymatic suggests that this layer may have reduced the conversion to acetoin and subsequently to evaporation of CO2 and therewith caused the 2,3-butanediol and therewith remove the off- constant and continuous CO2 release. In fact, flavor from the liquid [10]. In contrast, the fermentation liquid of Wickerhamomyces Torulaspora microellipsoides (F7) was the anomalus showed the lowest pH measured only strain of our selection that did not among all stains suggesting that the dissolved produce any ketones in the fermentation CO2 was contributing to the acidification of experiment. the liquid. The formation of such a film has by yeast Fermentation by results an and strain characterization These 18 strains have been processed further through strain characterization tests on various growth conditions and for the production of common off-flavors that are present in lager beer, namely H2S and phenolic off-flavors. The results are shown in Table 3. The table values are represented as a heat map. density prior to fermentation start to allow the tracking of the fermentation speed of each strain. stored wines. The residual amount of oxygen in the headspace of the fermenters then triggers the formation of the biofilm. It has been shown that this bio-layer produced mainly acetic acid, acetaldehyde and acetate esters, volatiles that have been identified in high concentrations in W. anomalus fermentation [11]. The most rapid fermentation as represented All strains were adjusted to the same optical single been reported as a typical phenomenon in Fermentation rates were followed by measuring the CO2 release per day (Figure 2A). As prerequisite we only selected strains that were able to ferment the medium within seven days. As only exception we selected Wickerhamomyces anomalus (F10) due to its exceptional volatile profile. Different to the other 17 strains that showed a sigmoidal CO2 release W. anomalus had almost a linear fermentation curve releasing by fast CO2 loss was observed with the beer production strains WS34/70 (G10). However, this strain did not cause the highest CO2 release. Pichia kluyveri (E7) finished fermentations after four days with the highest CO2 release. The lowest CO2 release occurred in the fermentation of Debaryomyces subglobosus (B11). Fermentation was finished after four days, although only about two thirds of the average CO2 release occurred. Surprisingly, the remaining sugar content of this fermentation was rather low with 3.45 °P and the ethanol produced was high with Growth on other carbon sources and 7.44 %. temperatures Since we conducted the fermentation using glucose based medium we did not expect drastic changes in the pH of the final liquid due to the buffering capacity of the medium itself. Nevertheless, we observed the lowest pH after fermentation with Wickerhamomyces anomalus (F10; pH 4.79). Apart from the suggested dissolution of CO2 in the fermented liquid this strain additionally produced the highest amounts of acids which explain this low pH of the final liquid. In contrast, Clavispora lusitaniae (B8) produced the lowest amount of acids and therewith resulted in the highest pH of 6.07. For most of the strains we could observe a correlation of the sugar consumption and the produced ethanol (Figure 2B). The highest production low or high temperatures such as 10 °C and 37°C we setup dilution series on plates and observed their growth after four and two days respectively (Table 3). We found that 60 % of the strains were able to grow on high temperature whereas none of the strains was showing full growth at the low temperature of 10 °C. Further we tested the ability of the strains to grow on an alternative carbon source such as maltose. Only two strains of our selection showed full growth on maltose plates namely Candida diversa (B4) and Clavispora lusitaniae (B8). Off-flavor formation Ethanol production ethanol In order to test the strains ability to grow on was observed for Kazachstania servazii (C9) with 9.2 % v/v. Wickerhamomyces anomalus (F10), on the We focused our attention on the production of off-flavors that are important factors for the selection of strains in brewing industry such as diacetyl, phenolic compounds like 4vinylguaiacol and hydrogen sulfide (Tables 2 and 3). other hand, produced the lowest amount of Diacetyl (butanedione or butane-2,3-dione), a ethanol highest buttery like flavor, can be detected by GC-MS. remaining sugar content. Hanseniaspora Within our selected strains we found four vineae (E7) strains where we could detect diacetyl. Since produced a lower ethanol yield than the diacetyl can be converted to 2,3-butanediol estimation due to the sugar consumption through would imply. This could be connected to the compared the acetoin production of the increased production of acetic acids in both strains as well. Both acetoin and 2,3- strains. butanediol can diffuse out of the cell, but correlating (C7) and with Pichia Additionally, the kluyveri Pichia kluyveri produced vast amounts of ethyl acetate. the intermediate acetoin we neither of them contributes to the undesired buttery flavor [7]. Hanseniaspora vineae (C7) produced the highest amounts of acetoin but did not show detectable amounts of diacetyl. a high sulfite reductase activity and produce a [12]. detectable amount of H2S while white Phenolic compounds such as 4-vinylguaiacol are produced by enzymatic decarboxylation of ferulic acid. When found in beers they are responsible for a pungent clove-like aroma. Key enzymes for the ferulic acid conversion are PAD1 and FDC1. In our screening we used cinnamic acid as a substrate to identify POF+ and POF- strains. POF+ strains express the genes PAD1 and FDC1 and can therewith decarboxylate cinnamic acid to styrene to circumvent the inhibitory effects of cinnamic acid [13]. Of the 18 strains in our study only two showed very high production of phenolic flavors, namely Debaryomyces subglobosus (B11) and Meyerozyma guilliermondii (D11). colonies produced no detectable sulfide [15]. However, this assay does not give absolute quantitative measurements but a tendency of sulfite reductase activity. We found three strains with apparent low sulfite reductase activity, namely Nakaseomyces bacillisporus (E2), Saccharomycodes ludwigii (F3) and Torulaspora measure microellipsoides the H2S (F4). formation To during fermentation the lead acetate method can be used. Here, hydrogen sulfide interacts with the lead in the lead acetate matrix to form a dark precipitate. This allows an estimate of the volatile H2S in the headspace of the fermentation [16]. However, the production of 4-vinylguaiacol Complexity of flavor production could not be detected by GC-MS since our Within our selection of strains we observed fermentation was based on YPD where ferulic different complexities in flavor production acid is not expected. Typically, ferulic acid (Figure 3). The highest complexity of 47 derives from barley germination where it is volatile compounds resulting in the largest released from the aleurone layers as ester- number of different flavors was produced by linked Debaryomyces feruloyl arabinoxylans. During subglobosus (B11). D. mashing and wort boiling it is released from subglobosus, also known as Candida famata its bound form and found in significant var. flareri, is a natural overproducer of concentrations in the wort [14]. riboflavin and D-Arabitol depending on the Hydrogen sulfide is a rotten egg flavour that is undesired in fermented beverages. Hydrogen sulfide is produced by yeast during fermentation and during the maturation phase. On BiGGY-agar the sulfite reductase activity of a strain can be estimates since color of colonies can be correlated with levels of H2S production. Brown color colonies have iron concentration of the media [17] Strain optimization and development have reached a riboflavin production up to 20 g/l with this species [18] [19]. Interestingly, this strain was also identified as the one with the lowest CO2 release during fermentation. Fermentation was delayed but, nevertheless, finished already after four days. Further, this strain was standing out for its high production of and Z. mellis produced detectable amounts of pyranone and furfural. Pyranone was recently 3-methyl butanal as well as other compounds identified as signaling molecules in bacterial derived from Strecker degradation, such as 5- communications similar to quorum sensing. hydroxymethylfurfural, [20]. Fruit ketones such as pyranone are methylfurfural (Figure 4). Furfural is a known to be important for processes like colorless oily liquid with the odor of almonds. cheese ripening [21]. In contrast, we found It is further known as one of the components very low levels of fruity esters in our GC-MS found in vanilla. Although both strains have analysis fermentation. been isolated from fruits they might have a Already in 2000 Van den Tempel and possible application in meat processing. Z. Jacobsen identified high esterase activity in mellis is already known to be involved in various isolates of D. hansenii which may vinegar fermentation. Together with other cause the low concentration of esters in species of this genus such as Z. bailii, Z. D. subglobosus [22]. bisporus and Z. rouxii, Z. mellis belongs to a of D. subglobosus Branched-chained aldehydes are favorable furfural, 5- group of osmotolerant yeasts [9]. components for the maturation of meat The lowest flavor complexity was found for a products, giving nutty, cheesy and salty notes strain of Saccharomyces cerevisiae (E11) to the food products [23] Usually these isolated from Spanish sherry (Figure 3). aldehydes Despite are by Strecker heat-induced process compounds this strain was exceptionally high converting α-amino acids into an aldehydes. in its higher alcohol production namely in Small amounts of these aldehydes are butanol and isoamyl alcohol. Additionally, produced food high amounts of acetic acid and butyric acid set as well as acetaldehyde were produced degradation, produced a enzymatically fermentation. D. subglobosus during Within our strain (B11) showed the most abundant production of aldehydes (Figure 4). One other prominent aldehyde was 3-methyl butanal. This compound is an intermediate of the leucine degradation pathway. It was also found in high concentrations in Zygosaccharomyces mellis (G4). 3-methyl butanal is a known flavor component aldehyde associated with the production of cured-hams by lactic acid bacteria and Micrococcaceae [24] Both, D. subglobosus the low number of 31 flavor (Figure 4). With 36 different flavors Wickerhamomyces anomalus (F10) is among the strains with intermediate flavor complexity (Figure 3). However, this strain was noticed as a prominent producer of high amounts of esters such as butyl acetate, ethyl acetate, isoamyl acetate and 2-phenyl acetate. Within the group of higher alcohols Wickerhamomyces anomalus produced the highest amount of 2-phenyl ethanol. Moreover, the highest yields of acetic acids Conclusion and acetaldehyde were found in this species In our study we present a comprehensive (Figure 4). As mentioned above W. anomalus overview of the volatile compound formation formed a water insoluble layer on top of the potential of a set of 18 strains that were fermentation consisting of a film that could chosen produce acetic acid, acetaldehyde and acetate conventional esters. generalists that produce a broad variety of from a selection yeasts. of We 60 non- found both organic volatiles but also specialist that had a In earlier studies W. anomalus has been isolated from a range of cereal based sources. It has been reported from sourdoughs and was found as the dominating yeast in sourdough microbial ecosystems next to S. cerevisiae. The prevalence of the fungus was associated with its osmotolerance and increased acid tolerance in comparison to S. cerevisiae [25]. Further, it was shown that W. anomalus can outgrow other yeasts and become the dominant fungal species most likely due to its ability to assimilate lactate produced by lactic acid bacteria [26]. low complexity of different volatile but produced vast compounds. strains amounts Furthermore, produced of a certain number higher of ethanol concentrations than the reference strain. Among the generalists in our selection we identified Debaryomyces subglobosus (B11). This strain produced the highest complexity of volatiles (a total of 47) but low concentrations of esters when compared to the reference strain Weihenstephan WS34/70 (G10). However it produced high amounts of aldehydes and ketones. Pichia kluyveri (E7) produced a total of 41 volatiles during our fermentations. It was recognized by its high production of volatile esters that reach up to fivefold concentrations found in the reference strain (Figure 4). Pichia kluyveri is found in 'wild ferments' of Zygosaccharomyces mellis (G4) produced with 44 volatiles almost as many volatiles as D. subglobosus. However the concentration of fruity esters and alcohols was significantly increased when compared to the reference strain. wine. Chr. Hansen A/S has selected P. kluyveri for its ability to boost fruit flavours Wickerhamomyces and launched products such as Frootzen™ Pichia kluyveri (E7) were noticed because of that can be used in sequential inoculation their enormous production of volatile esters with standard wine yeast. In a recent study P. but low ethanol production. In contrast, kluyveri Kazachstania servazii (C9) was identified as marxianus starter together with were presented yeasts fermentation [27]. for Kluyveromyces as controlled potential cocoa anomalus (F10) and strain with the highest ethanol production but with a reduced production of volatiles. The yeast biodiversity holds a plethora of strains that show useful characteristics such as ethanol production and flavor formation. This requires a detailed evaluation of the initially identified favorable strains under different conditions to ascertain their properties and potentially promote these strains in specific fermentation regimes. Figures and Tables Table 1: Strains used in this study. Each selected strain was assigned to a code based on its coordinates on a 96 well plate. Pos. CBS number Taxon name Substrate of isolation Origin B2 B3 B4 B5 B6 B7 B8 B9 B10 B11 C2 C3 CBS 10151 CBS 12367 CBS 4074 CBS 8058 CBS 1760 CBS 2649 CBS 6936 CBS 4373 CBS 767 CBS 2659 CBS 8139 CBS 615.84 Cured ham Brie Régalou cheese Grape must Berries of Vitis coignetiae Pickling vat with 22% brine Grape juice Citrus essence Dry white wine Norway Apple Italy Netherlands France C4 CBS 95 C5 CBS 6783 C6 CBS 2585 Candida alimentaria Candida alimentaria Candida diversa Candida kofuensis Candida versatilis Candida stellate Clavispora lusitaniae Debaryomyces fabryi Debaryomyces hansenii Debaryomyces subglobosus Dekkera anomala Geotrichum candidum Hanseniaspora guilliermondii Hanseniaspora occidentalis var. citrica Hanseniaspora uvarum C7 CBS 2568 C8 C9 C10 C11 D2 D3 D4 D5 D6 CBS 2352 CBS 4311 CBS 3019 CBS 2186 CBS 398 CBS 7775 CBS 8530 CBS 1557 CBS 7005 D7 CBS 3082 D8 CBS 7703 D9 CBS 5833 D10 CBS 2030 Meyerozyma guilliermondii D11 CBS 8417 Meyerozyma guilliermondii Brie cheese Fermenting bottled tomatoes Orange juice Sour dough Drosophila persimilis (fruit Hanseniaspora vineae fly) Hyphopichia burtonii Pollen, carried by wild bees Kazachstania servazii Soil Kazachstania spencerorum Soil Kazachstania transvaalensis Soil Kazachstania unispora Kluyveromyces aestuarii Neotredo reynei (shipworm) Kluyveromyces dobzhanskii Drosophila sp. Kluyveromyces marxianus Stracchino cheese Lachancea fermentati Alpechín Drosophila pinicola (fruit Lachancea kluyveri fly) Either fruit or leaf of fruit Lachancea waltii tree Berries of Vitis labrusca Metschnikowia pulcherrima (Concord grapes) Insect frass on Ulmus americana (elm tree) Brine bath in cheese factory Japan Japan USA France Israel South Africa Netherlands Italy Portugal Finland South Africa South Africa Brazil Canada Italy Spain USA USA Netherlands Pos. CBS number Taxon name Substrate of isolation E2 CBS 7720 Nakaseomyces bacillisporus E3 E4 CBS 2170 CBS 8255 Nakaseomyces delphensis Pichia Exudate of Quercus emoryi (Emory oak) Sugary deposit on dried figs Kefyr E5 CBS 2020 Pichia farinosa Fermenting cacao E6 E7 E8 E9 CBS 2057 CBS 188 CBS 5147 CBS 191 Pichia fermentans Pichia kluyveri Pichia kudriavzevii Pichia membranifaciens E10 CBS 429 Saccharomyces cerevisiae E11 F2 F3 CBS 1250 CBS 1782 CBS 820 F4 CBS 2863 F5 CBS 6741 F6 F7 CBS 133 CBS 427 F8 CBS 248 F9 CBS 249 F10 CBS 261 F11 CBS 262 G2 CBS 4689 G3 CBS 1082 G4 G5 G6 G7 CBS 726 C1030 C1039 C746 G8 CBS 1513 G9 G10 G11 C482 WS34/70 C598 Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomycodes ludwigii Schwanniomyces occidentalis Schwanniomyces polymorphus var. africanus Torulaspora delbrueckii Torulaspora microellipsoides Wickerhamomyces anomalus Wickerhamomyces anomalus Wickerhamomyces anomalus Wickerhamomyces anomalus Zygosaccharomyces bailii var. bailii Zygosaccharomyces bisporus Zygosaccharomyces mellis Saccharomyces pastorianus Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces carlsbergensis Saccharomyces cerevisiae Saccharomyces pastorianus Saccharomyces cerevisiae Brewers yeast Olives Fruit juice Wine Fermenting must of champagne grapes Sherry Super-attenuated beer Grape must Origin USA South Africa Trinidad and Tobago Italy Spain Germany Soil of vineyard Spain Soil South Africa Ragi Apple juice Indonesia Germany Red currants Netherlands Berries Ragi Indonesia Beer Grape must Italy Tea-beer fungus Indonesia Wine grapes Brewers' yeast Wine yeast Brewers' yeast Germany Brewers' yeast Brewers' yeast Brewers' yeast Laboratory strain Table 2: Complete list of volatiles detected by the total list of 60 strains B2 Stdev B3 Stdev B4 Stdev B5 Stdev B6 Stdev B7 Stdev B8 Stdev B9 Stdev B10 Stdev B11 Stdev C2 Stdev C3 Stdev C4 Stdev C5 Stdev C6 Stdev C7 Stdev C8 Stdev C9 Stdev C10 Stdev C11 Stdev D2 Stdev D3 Stdev D4 Stdev D5 Stdev D6 Stdev D7 Stdev D8 Stdev D9 Stdev D10 Stdev D11 Stdev Alcohols Benzyl alcohol Butanol Dodecanol Fenchyl alcohol Furaneol Isoamyl alcohol Propanol 2-Ethyl-1-hexanol 2-Furanmethanol 2-Methyl propanol 2-Nonanol 2-Phenyl ethanol 3 Ethoxy - 1 Propanol 3-(Methylthio)-1-propanol 1,1 0,0 8,5 2,5 0,0 50,0 0,0 0,0 0,0 0,0 0,0 239,2 0,0 1,2 0,1 1,4 0,1 0,0 0,0 0,0 0,0 0,0 0,0 301,2 63,3 452,6 0,7 13,2 5,0 13,2 2,1 14,9 0,6 2,1 0,1 0,0 0,0 0,0 0,0 0,0 0,0 11,1 6,4 0,0 11,8 20,1 8,6 342,6 26,0 706,6 0,0 0,0 0,0 0,0 0,0 15,4 0,0 3,3 1,9 4,7 0,4 7,0 0,0 0,0 0,0 52,6 8,5 0,0 0,0 0,0 0,0 6,0 1,7 42,4 0,0 0,0 0,0 0,0 0,0 0,0 25,0 317,5 103,7 445,0 108,5 373,8 0,0 0,0 0,0 0,0 0,0 0,0 0,1 0,0 0,0 48,3 3,4 28,3 0,0 0,0 27,7 69,0 6,8 8,1 0,0 0,0 0,0 0,0 62,0 206,7 3,1 0,0 0,6 4,7 0,0 0,0 2,5 0,8 0,0 0,0 66,3 154,5 0,0 0,0 1,1 0,0 0,0 13,3 1,8 0,0 0,0 1,4 0,0 0,0 0,0 0,0 0,0 15,5 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 2,1 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 110,9 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,3 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 24,5 3,5 0,0 0,0 0,8 3,1 0,0 4,2 0,6 0,0 23,9 0,0 0,0 3,4 0,0 0,0 14,2 0,7 1,8 0,2 8,7 4,5 0,0 51,2 227,2 0,0 0,0 193,1 0,0 9,4 225,6 78,8 709,2 126,6 296,5 40,5 375,8 188,7 328,6 99,3 138,4 0,0 0,0 0,0 14,0 1,0 30,7 0,0 0,0 0,0 141,1 44,7 121,4 9,7 249,2 36,9 52,5 9,8 0,0 0,0 0,0 0,0 96,1 19,0 103,7 45,6 40,1 16,5 255,4 6,3 0,0 21,0 0,0 0,0 147,9 26,7 0,0 11,4 7,0 0,0 0,0 6,3 0,0 0,1 9,7 0,5 11,7 0,5 258,8 15,1 91,2 0,4 0,0 0,0 0,0 28,8 171,9 0,0 0,0 0,0 0,0 0,0 0,0 0,2 3,9 11,0 0,6 0,1 0,1 2,7 0,0 3,1 20,3 0,0 0,0 4,9 594,4 29,5 434,7 23,8 6,4 8,4 0,0 0,0 0,0 29,2 0,8 6,5 729,5 271,4 579,8 0,0 0,0 12,4 5,3 1,8 4,6 164,7 14,0 49,6 44,1 17,4 31,1 2,9 0,3 2,3 577,4 15,5 425,0 0,0 0,0 0,0 55,4 5,4 127,5 0,5 0,0 19,2 243,1 3,4 7,4 0,0 2,5 0,1 12,1 19,5 244,8 1,1 31,6 0,0 5,3 4,1 81,4 2,4 17,8 0,3 0,0 7,9 73,7 0,0 0,0 20,6 0,0 0,0 71,6 1,3 0,2 1,7 13,6 2,4 0,4 6,1 3,5 0,0 5,2 0,0 0,0 3,5 361,0 11,2 0,0 26,3 499,2 5,7 5,4 139,9 26,2 2,2 302,6 0,0 30,8 0,1 78,9 1,7 0,0 1,1 61,6 0,2 0,3 6,7 1,2 0,2 20,1 0,0 9,6 4,1 412,9 14,0 0,0 37,2 589,9 4,5 4,9 159,4 24,4 1,9 365,9 0,0 36,8 1,1 0,0 41,3 146,2 5,8 2,9 0,0 1,6 2,6 0,0 34,8 523,1 0,7 11,5 0,5 3,7 11,2 14,4 3,9 25,0 0,1 0,0 12,9 202,9 0,0 0,0 7,8 63,9 0,0 1,6 24,0 134,1 0,4 3,0 0,2 0,0 0,0 0,0 50,1 580,8 1,5 3,3 0,9 3,6 6,7 0,0 2,5 29,7 0,0 1,2 11,8 333,7 0,0 0,0 4,7 18,1 0,4 4,9 83,7 349,7 2,0 9,2 0,0 0,0 0,0 0,0 86,3 533,5 0,9 11,5 0,2 6,0 0,0 0,0 7,4 17,9 0,4 0,0 29,9 415,2 0,0 0,0 4,6 30,8 0,2 0,0 28,1 192,2 0,3 6,0 0,0 0,0 0,0 0,0 95,3 414,8 2,4 6,9 1,6 5,5 0,0 0,0 1,1 14,6 0,0 8,5 10,0 348,0 0,0 0,0 4,7 54,4 0,0 0,0 53,5 364,6 4,9 5,2 0,0 0,0 0,0 0,0 13,2 455,2 0,5 10,2 2,0 4,4 0,0 0,0 3,0 11,5 0,9 3,1 46,7 329,7 0,0 0,0 7,5 29,6 0,0 20,3 0,0 0,0 0,0 37,4 0,7 0,4 0,0 1,3 1,4 55,5 0,0 2,5 0,0 505,8 14,5 0,0 0,0 767,1 29,0 7,2 0,0 12,5 2,0 608,6 2,6 352,6 0,0 0,0 16,0 172,6 1,3 2,2 0,0 0,0 0,0 0,0 11,8 527,3 8,7 16,1 0,6 3,8 0,0 0,0 2,9 19,3 0,1 0,0 52,0 215,2 0,8 0,0 55,2 33,2 0,2 70,6 0,0 0,0 0,7 0,0 0,0 867,7 28,3 18,4 0,0 0,0 0,0 11,8 0,0 0,9 7,6 10,5 11,0 34,9 0,0 0,0 0,0 0,0 25,6 63,0 0,0 0,0 8,7 0,0 0,0 94,9 0,6 0,0 0,2 2,0 0,1 0,2 0,0 69,0 0,0 12,2 0,0 24,8 7,1 0,0 0,0 58,6 6,3 0,0 7,0 0,0 0,9 3,4 0,0 0,0 7,4 0,0 0,0 6,3 0,0 0,8 0,0 27,3 0,2 0,4 2,1 0,0 0,0 0,0 1,6 0,0 1,1 0,0 0,2 0,0 0,0 0,0 0,0 0,0 0,9 1,9 0,1 0,5 0,2 0,0 0,0 11,5 3,7 30,0 0,9 198,2 80,8 124,0 58,6 39,7 77,0 133,7 18,8 0,0 244,4 0,0 31,4 8,8 13,8 1,4 1,5 0,0 0,0 30,0 0,2 3,0 1,9 0,0 0,1 0,6 0,4 177,0 10,0 47,8 18,4 62,9 15,4 46,8 2,1 11,6 1,3 23,0 43,6 38,4 1,2 13,3 0,0 0,0 16,8 110,4 0,0 0,0 0,8 15,6 0,4 11,2 1,8 5,0 0,1 1,8 0,2 0,9 0,0 0,0 0,0 0,0 0,4 24,2 2,0 34,8 0,0 0,0 0,1 0,0 30,7 471,4 10,4 22,2 28,2 0,0 19,8 5,9 5,3 0,2 18,6 5,1 6,2 0,7 0,6 0,0 0,0 0,0 56,4 2,3 0,0 54,3 6,5 0,0 9,1 116,9 3,2 4,2 1,3 2,5 0,4 0,5 0,0 0,0 0,0 0,0 4,7 10,4 0,2 7,4 0,0 0,0 0,0 5,4 36,3 303,1 0,1 69,4 0,0 0,0 2,2 4,7 0,2 0,7 0,6 24,5 0,2 18,3 0,0 76,2 0,0 4,9 0,2 29,8 2,2 38,3 0,0 4,9 1,1 75,2 0,3 17,3 0,1 14,6 0,0 2,9 0,0 32,0 0,0 0,0 1,4 79,0 4,2 49,2 0,0 0,0 1,4 0,3 74,6 662,8 15,6 19,2 0,0 93,8 2,1 163,0 0,4 6,9 19,5 11,7 15,8 56,2 21,7 0,0 0,1 0,0 28,2 185,7 6,8 26,3 2,8 15,3 16,5 90,5 7,1 2,0 4,9 3,1 0,3 0,2 11,7 0,0 0,0 2,1 11,4 28,4 5,5 1,3 0,0 0,0 0,0 9,7 21,1 143,7 0,0 94,7 1,6 51,5 29,5 13,1 0,7 6,4 1,4 26,3 4,6 27,7 0,0 91,4 0,0 9,6 33,8 0,0 2,1 0,0 4,6 18,6 3,8 4,7 0,1 0,0 0,2 0,9 0,0 0,6 0,0 0,0 0,2 1,7 2,6 79,5 0,1 0,0 3,5 9,7 0,7 14,7 0,4 1,2 9,4 8,4 2,5 3,3 0,0 0,0 2,6 0,1 0,0 0,2 0,0 0,0 0,4 20,6 6,1 0,0 0,0 39,5 5,1 6,6 12,6 0,5 3,3 12,7 0,0 0,0 72,5 7,7 6,9 9,9 0,0 1,9 0,0 8,4 0,0 2,2 47,1 2,0 3,4 244,9 36,3 0,0 0,0 0,0 0,0 985,2 111,3 168,8 94,6 6,5 56,6 348,0 46,9 0,0 123,1 19,5 9,2 0,0 0,0 9,8 0,0 0,0 24,2 92,1 19,7 26,4 0,0 0,0 0,0 0,0 0,0 0,0 244,3 22,9 30,9 0,0 0,0 0,0 0,0 0,0 13,8 321,6 54,2 49,8 0,0 0,0 14,3 6,0 1,1 1,2 0,0 0,0 0,9 0,0 0,0 86,3 0,6 0,0 0,0 50,6 19,7 23,4 511,2 199,9 59,4 151,6 0,0 128,9 82,9 66,1 3,2 31,5 0,0 4,7 323,9 132,4 16,9 174,6 0,0 144,3 33,2 347,3 9,1 172,7 8,7 0,0 4,6 0,0 0,0 0,0 16,4 3,9 82,3 491,4 24,3 175,9 0,0 0,0 0,0 120,6 0,0 0,0 1,1 65,8 24,1 608,1 13,0 147,4 0,0 0,0 13,5 112,6 0,0 0,0 7,4 69,0 27,5 165,1 18,1 129,2 0,0 0,0 10,7 0,0 0,0 0,0 6,3 0,0 26,0 547,4 110,9 736,7 8,8 155,2 6,6 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 133,9 0,0 0,0 0,0 0,0 0,0 0,0 0,0 90,4 64,0 362,2 0,0 192,6 0,0 0,0 31,7 85,1 0,0 0,0 16,6 44,5 16,5 610,4 127,2 1115,2 71,9 176,2 35,2 0,0 0,0 0,0 0,0 0,0 26,6 82,0 6,0 169,7 0,0 0,0 0,0 0,0 10,0 0,0 0,0 142,0 13,3 42,5 395,1 43,5 5,6 1,6 176,5 0,0 153,3 554,1 1,1 12,2 12,6 29,8 13,3 147,5 4,8 0,0 1,5 3,2 0,7 1,9 16,8 31,0 0,0 15,5 10,7 36,5 4,1 252,9 0,7 6,9 1,1 10,6 2,0 168,9 0,0 22,5 1,8 3,9 0,7 1,1 0,8 65,0 0,2 11,5 0,9 65,0 4,9 188,7 0,6 3,1 0,2 5,2 2,4 0,1 8,7 1,2 3,7 25,0 1,0 32,2 0,4 7,6 4,3 0,0 14,8 0,4 1,8 7,7 12,3 11,9 2,0 4,2 54,1 54,6 6,1 15,8 1,4 0,6 0,5 0,6 33,3 0,0 0,0 0,0 7,9 21,9 70,2 109,7 0,5 0,5 21,1 2,6 0,7 0,1 0,0 0,0 6,9 47,0 8,4 19,4 22,2 0,0 2,5 1,0 8,9 6,8 8,3 0,0 1,4 12,6 1,8 24,8 25,9 53,5 0,0 73,9 0,7 0,0 0,1 0,0 1,3 307,6 0,4 7,3 8,7 68,3 0,0 29,9 1,6 1,3 1,1 5,8 0,0 0,0 33,9 2,3 6,2 1,8 25,6 28,6 9,2 0,0 0,0 0,0 0,0 0,0 0,0 5,5 8,6 1,9 0,2 0,0 0,0 0,0 0,0 0,0 0,0 0,0 10,6 34,9 9,6 0,0 1,3 0,7 0,0 0,0 11,9 0,0 20,0 27,2 0,0 0,0 97,9 163,0 0,0 0,0 8,2 0,0 0,0 0,0 0,3 0,9 0,0 0,0 3,9 26,7 0,0 0,0 7,5 170,4 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,4 0,0 0,0 9,2 29,8 0,0 0,0 20,9 266,2 0,0 0,0 0,0 0,0 0,0 0,0 0,0 5,8 0,0 0,0 34,6 0,0 26,3 0,0 29,2 0,0 1,6 0,0 7,6 0,0 34,3 0,0 0,0 0,0 0,6 0,0 1,4 0,0 18,1 0,0 0,0 0,0 0,4 0,0 5,1 0,0 0,0 0,0 0,0 0,0 1,0 0,0 2,6 53,8 0,0 0,0 0,0 190,6 0,0 0,0 0,0 0,0 0,0 0,0 0,1 0,5 0,0 0,0 9,8 0,0 24,4 0,0 0,0 0,0 0,2 0,0 14,4 12,4 0,0 0,0 0,0 0,0 10,8 2,2 7,5 1,5 0,0 0,0 0,0 0,0 3,3 0,0 43,1 0,0 0,0 0,0 11,3 0,0 0,0 0,0 0,7 4,4 0,4 4,2 0,0 0,2 3,8 12,2 0,2 5,8 8,1 22,6 0,4 1,6 5,2 14,2 0,0 0,0 37,9 322,1 1,6 10,0 0,0 0,0 0,0 0,0 40,4 544,3 4,5 10,3 0,4 4,4 0,0 0,0 6,6 12,8 0,0 1,6 85,3 416,5 0,0 1,1 0,9 31,3 0,0 0,0 53,2 331,7 11,0 5,6 0,0 0,0 0,0 0,0 53,9 491,1 0,6 7,8 0,2 3,8 0,0 0,0 3,6 7,2 0,0 2,7 32,7 314,6 0,5 0,0 18,4 0,0 0,0 0,0 58,3 299,3 4,0 6,1 0,0 0,0 0,0 0,0 33,1 406,7 1,3 14,6 0,2 2,9 0,0 0,0 0,3 10,3 0,5 23,1 28,5 314,2 0,0 0,0 0,0 0,0 0,0 3,4 14,4 504,4 6,6 4,4 0,0 0,0 0,0 0,0 52,2 523,9 8,7 20,6 1,2 6,4 0,0 0,0 1,6 9,7 20,9 3,9 15,8 400,2 0,0 0,0 0,0 28,3 0,6 0,0 10,7 416,7 0,3 8,5 0,0 0,0 0,0 0,0 93,6 589,6 6,0 31,7 1,7 4,9 0,0 0,0 3,6 18,8 0,6 21,5 50,7 430,8 0,0 0,0 7,4 38,4 0,0 0,0 16,7 337,5 2,4 6,5 0,0 0,0 0,0 0,0 23,7 695,7 9,1 15,4 0,2 4,6 0,0 0,0 3,1 35,9 4,5 1,4 18,9 373,1 0,0 0,0 10,7 8,0 0,0 68,4 0,2 0,0 0,0 0,3 0,1 0,5 0,0 3,1 0,0 36,8 0,0 2,6 0,0 0,0 2,4 521,2 65,8 268,2 9,8 4,4 4,9 0,0 0,0 0,0 0,0 0,0 0,0 830,0 101,6 658,9 19,6 2,9 11,4 8,0 5,2 3,7 0,0 0,0 0,0 36,5 3,2 30,4 1,2 0,1 1,0 448,5 89,4 382,1 0,0 0,0 0,0 132,7 50,4 11,8 0,2 0,0 0,0 2,6 38,1 385,0 132,0 380,4 1,5 5,5 0,9 5,2 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 66,6 597,4 2,4 581,0 1,7 13,6 1,9 21,4 0,7 2,7 0,2 4,4 0,0 0,0 0,0 0,0 3,9 13,8 3,9 23,5 0,1 1,2 0,2 1,9 8,2 533,7 25,4 431,0 0,0 0,0 0,0 0,0 5,3 45,8 15,6 12,6 0,1 2,3 87,8 303,7 1,0 5,0 0,0 0,0 0,0 0,0 19,5 449,1 2,4 7,9 0,3 4,7 0,0 0,0 1,2 13,8 0,0 16,1 8,7 329,5 0,0 0,0 0,9 0,0 0,3 3,0 14,3 288,4 1,9 5,1 0,0 0,0 0,0 0,0 28,0 477,3 0,5 12,0 0,3 4,0 0,0 0,0 1,3 11,1 2,1 10,4 1,3 312,3 0,0 0,0 0,0 19,9 0,5 4,5 40,4 385,6 2,2 11,7 0,0 0,0 0,0 0,0 23,6 502,1 0,1 12,7 0,2 7,0 0,0 0,0 0,5 11,9 1,2 2,1 27,6 383,8 0,0 0,0 2,1 40,8 1,2 86,9 4,3 0,0 0,0 64,1 1,7 3,2 0,0 2,0 0,4 59,4 0,0 7,6 1,1 0,0 0,0 2,0 8,0 0,0 1,8 1,2 2,7 7,2 0,0 0,0 5,7 0,0 1,0 10,9 1,0 0,5 0,2 3,2 0,0 3,8 4,0 7,7 0,0 19,0 9,3 3,8 8,9 2,3 7,7 6,5 0,0 0,0 38,1 0,0 0,7 15,1 0,9 3,7 0,0 0,0 0,3 4,9 7,0 13,2 9,5 0,0 0,2 0,0 11,5 102,2 6,0 35,2 27,4 0,0 1,9 0,0 3,5 10,1 6,6 5,6 14,9 94,8 0,0 0,0 0,0 0,0 23,9 246,6 0,0 0,0 0,5 12,8 22,4 40,1 0,6 6,4 0,6 0,7 0,0 0,0 0,0 0,0 0,0 0,0 6,6 31,7 1,2 0,0 0,0 37,0 17,2 0,0 0,0 1,1 1,7 2,6 0,0 0,0 31,9 0,0 1,2 8,1 5,8 0,2 0,0 0,0 0,0 6,9 8,7 0,0 0,0 2,8 5,1 44,5 22,8 1,3 0,8 8,6 0,0 0,0 32,8 0,0 12,4 3,0 1,0 1,3 0,1 36,6 0,0 3,5 14,4 5,8 0,0 0,0 0,0 0,0 25,9 181,5 31,6 36,9 0,0 0,0 36,2 6,9 0,5 2,0 4,8 0,0 7,9 40,2 0,0 0,0 0,0 0,0 80,7 89,5 0,0 0,0 0,0 0,0 62,4 23,7 0,0 6,6 1,9 3,3 0,0 0,5 31,4 20,2 0,5 3,7 2,5 64,2 1,1 0,0 0,0 32,7 6,7 0,0 0,8 0,0 0,0 10,8 0,0 0,0 7,5 0,0 0,0 0,0 1,9 1,0 0,0 0,3 1,9 9,0 52,5 0,0 0,0 497,0 36,5 0,0 34,5 1,8 0,0 44,6 0,0 0,0 181,9 0,0 0,0 299,2 0,0 9,0 0,4 451,4 2,5 66,2 0,0 5,4 0,0 0,0 0,0 0,0 44,6 183,9 1,6 29,4 0,0 0,0 5,1 4,4 0,1 2,2 0,0 0,0 4,9 70,0 0,0 0,0 0,0 0,0 27,9 90,4 0,0 0,0 0,0 0,0 19,9 24,1 0,0 7,2 0,8 2,9 0,0 0,5 91,1 19,6 0,4 3,5 18,3 49,0 0,4 0,0 0,0 9,5 1,2 0,0 0,4 0,3 0,0 61,9 0,0 0,0 12,4 0,0 0,0 1,0 0,5 0,2 0,2 2,6 0,2 13,8 1,9 0,1 0,0 15,9 4,8 0,0 0,8 0,1 0,0 7,7 0,0 0,0 1,4 0,0 0,0 8,4 0,2 0,7 0,0 4,6 0,1 1,3 4,0 6,4 0,7 57,3 2,1 83,4 8,5 4,3 1,8 28,0 12,2 0,0 34,7 0,0 4,0 12,9 1,8 1,2 0,0 1,8 0,0 2,7 53,1 13,5 0,6 562,4 88,4 117,1 133,6 5,7 26,1 70,5 5,4 0,0 210,5 0,0 105,1 127,5 7,0 12,3 0,5 48,4 0,0 23,3 4,6 12,4 1,0 17,4 0,4 0,0 67,1 116,5 2,1 17,0 14,7 70,5 19,7 63,9 0,8 2,7 6,0 24,2 17,0 45,4 4,8 0,0 0,0 0,0 21,4 134,4 0,0 0,0 10,2 105,7 29,4 46,5 3,1 0,0 3,8 1,6 0,2 0,1 8,3 97,7 0,0 0,0 3,0 17,6 3,1 3,9 0,0 34,8 3,9 13,4 9,8 0,5 5,1 23,4 0,0 0,0 15,1 0,0 29,2 9,6 0,0 0,6 0,2 2,8 0,0 3,7 24,6 874,8 12,5 133,2 0,0 0,0 7,2 99,1 0,0 0,0 0,0 109,4 70,0 225,3 8,1 109,4 0,0 0,0 35,2 37,5 0,0 0,0 34,5 0,0 5,7 375,8 35,8 0,0 0,0 0,0 5,3 54,9 0,0 0,0 0,0 57,1 30,1 1014,2 47,8 260,3 0,0 0,0 9,3 73,1 0,0 0,0 0,0 0,0 5,6 958,6 13,1 176,5 0,0 0,0 8,6 72,9 0,0 0,0 0,0 0,0 10,4 42,1 0,0 16,3 0,0 0,0 Esters Butyl acetate Ethyl (4E)-4-decenoate Ethyl 2-methylbutyrate Ethyl acetate Ethyl butanoate Ethyl decanoate Ethyl dodecanoate Ethyl heptanoate Ethyl hexadecanoate Ethyl hexanoate Ethyl isobutyrate Ethyl isovalerate Ethyl octanoate Ethyl propanoate Ethyl tetradecanoate Isoamyl acetate Isoamyl butyrate Isobutyl acetate Isobutyl butanoate Phenethyl acetate S-methyl thioacetate 2-Methyl propanoate 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 15,8 0,0 1,8 148,7 159,7 0,0 53,5 37,2 13,7 294,5 0,0 0,0 337,0 0,0 21,5 68,0 5,7 0,0 0,9 175,9 0,6 27,5 8,6 5,9 0,0 0,0 0,4 0,0 47,0 124,0 80,4 23,3 0,0 0,0 9,4 24,9 13,9 1,5 0,9 0,0 41,3 69,4 0,0 0,0 0,0 0,0 28,6 89,7 0,0 0,0 4,1 0,0 4,4 21,2 2,0 2,5 0,0 3,3 0,4 0,4 7,5 23,1 0,1 8,9 4,6 0,0 0,1 0,0 0,7 0,0 10,9 0,0 0,0 0,9 0,0 0,0 0,0 2,3 1,3 0,0 0,0 0,4 2,4 0,0 0,2 0,0 0,0 42,0 0,0 3,3 0,0 0,0 0,1 0,5 0,0 0,0 1,1 87,8 0,0 0,0 0,0 0,0 0,1 1,8 0,0 11,9 0,0 102,7 0,0 0,0 0,6 0,0 0,1 96,9 0,0 0,0 0,0 12,1 0,0 8,1 0,2 3,9 0,0 1,5 0,0 1,2 0,0 0,0 0,0 0,0 3,2 0,0 3,5 0,0 0,0 0,0 32,3 0,0 7,5 0,0 7,4 0,0 0,0 0,0 4,0 0,0 6,6 3,9 3,7 1,1 1,4 0,0 0,0 30,4 134,3 0,0 0,0 1130,9 25,1 154,5 89,4 3,1 14,6 55,2 0,0 0,0 210,7 85,0 23,6 165,3 1,3 16,6 0,0 205,1 0,0 25,7 49,4 173,9 0,0 625,0 17,5 254,4 275,4 5,4 12,1 58,5 0,0 0,0 263,5 0,0 21,9 157,5 2,6 4,4 0,0 0,0 0,2 21,1 9,5 198,6 0,4 321,1 34,2 330,3 253,4 19,2 10,1 71,2 0,0 0,0 259,8 0,0 29,6 43,7 9,0 1,6 0,6 0,0 0,0 15,5 13,3 0,0 0,0 112,3 12,3 158,1 103,1 3,2 14,4 49,8 0,0 0,0 168,5 0,0 94,8 57,0 1,8 2,2 0,1 192,7 0,0 25,5 60,9 0,0 0,0 524,5 137,8 0,0 36,5 2,3 5,7 69,3 0,0 0,0 191,8 0,0 0,0 252,7 4,2 5,9 0,5 618,5 1,1 22,5 74,1 159,7 0,0 688,8 55,0 334,5 71,8 2,6 9,7 78,7 0,0 0,0 274,7 0,0 15,7 145,9 6,4 5,0 0,4 315,1 0,4 34,0 4,2 13,3 0,0 94,1 10,6 38,4 7,6 0,7 9,7 18,6 0,0 0,0 10,4 0,0 1,8 58,7 1,4 2,9 0,2 73,5 0,2 3,6 22,1 10,7 0,0 326,5 43,9 0,0 6,2 1,6 0,0 24,4 0,0 0,0 131,5 0,0 0,0 109,9 2,5 9,0 0,3 320,0 0,4 24,4 19,0 101,5 2,7 619,2 138,4 382,1 85,1 11,5 35,8 103,1 63,3 0,0 358,6 0,0 39,8 47,6 9,1 7,3 1,0 22,8 0,0 53,4 Acids Acetic acid Butyric acid Decanoic acid Hexanoic acid Isovaleric acid Octanoic acid 39,1 359,1 0,0 186,1 0,0 0,0 55,6 0,0 0,0 0,0 36,1 0,0 1,4 511,0 14,8 133,0 0,0 0,0 0,0 86,9 0,0 0,0 0,0 0,0 1,7 596,4 181,9 454,6 22,6 162,3 75,7 126,8 0,0 0,0 0,0 0,0 10,5 82,5 31,0 0,0 0,0 0,0 0,0 0,0 0,0 48,3 18,4 0,0 28,8 1038,2 1,2 0,0 0,0 0,0 0,0 107,0 0,0 0,0 0,0 0,0 85,4 976,2 292,8 317,0 0,0 355,4 78,3 178,3 0,0 0,0 0,0 0,0 4,3 109,0 35,3 69,6 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 11,3 232,8 0,0 170,4 0,0 0,0 8,4 51,4 0,0 0,0 19,8 77,8 6,3 817,1 1,7 326,1 0,0 0,0 1,7 48,3 0,0 0,0 6,0 0,0 Aldehydes Acetaldehyde Benzaldehyde Furfural Phenyl acetaldehyde 1 -Decanal 1-Nonanal 3-Methyl butanal 4-Methyl benzaldehyde 5 Methyl furfural 5-Hydroxymethylfurfural 0,5 14,0 2,3 79,4 1,1 0,0 83,2 0,0 0,0 0,0 13,1 18,9 5,1 0,0 64,5 192,7 15,5 0,0 0,0 5,7 0,0 0,0 39,7 65,3 0,0 0,0 0,0 78,0 0,0 283,5 4,9 21,8 0,0 8,7 10,9 138,8 0,0 0,0 0,0 6,4 0,0 1,1 5,7 0,0 0,0 0,0 6,7 46,0 11,4 195,5 14,2 2,7 29,8 0,0 1,3 0,0 0,0 0,0 38,3 31,7 1,9 28,5 12,8 9,3 1,3 1,0 19,9 0,0 5,4 20,7 0,0 2,3 0,0 0,0 0,0 175,4 0,0 0,0 3,7 23,4 0,0 21,3 0,0 1,3 0,0 0,0 0,1 2,8 0,0 0,0 48,8 133,2 0,0 0,0 18,9 0,0 2,4 0,0 0,3 2,7 0,0 0,0 0,6 0,0 15,9 0,0 0,0 0,0 0,3 0,0 4,1 0,0 0,0 0,0 14,6 0,0 0,6 0,0 0,3 47,3 0,0 0,0 0,0 460,3 0,0 0,0 2,0 61,2 0,0 0,0 0,1 4,2 0,0 0,0 0,7 2,5 6,4 34,7 0,3 0,2 14,8 60,7 282,8 51,6 6,3 0,0 161,5 18,1 136,4 287,5 17,0 31,0 358,2 56,0 4,7 1,7 218,0 0,0 187,5 317,9 1,7 2,2 1,7 0,0 0,3 0,2 0,0 0,0 1,0 0,0 11,4 26,6 12,4 0,0 0,0 0,0 0,0 0,0 0,0 0,0 4,9 3,3 1,4 0,0 0,0 0,0 0,0 0,0 0,0 0,0 66,9 5,5 6,4 0,0 3,7 1,8 0,0 0,0 6,3 0,0 3,9 0,8 1,0 0,0 0,6 0,4 0,0 0,0 0,8 0,0 19,2 34,1 6,9 0,0 2,5 1,1 0,0 0,0 6,1 0,0 1,9 8,3 0,6 0,0 0,6 0,3 0,0 0,0 2,0 0,0 49,7 27,9 5,1 0,0 3,2 1,5 0,0 0,0 4,9 0,0 3,9 2,0 2,5 0,0 1,9 0,7 0,0 0,0 0,5 0,0 13,7 21,8 5,0 0,0 3,3 1,7 0,0 0,0 0,0 0,0 2,1 2,2 3,0 0,0 0,6 0,1 0,0 0,0 0,0 0,0 9,5 22,9 5,5 0,0 0,0 0,0 0,0 9,3 6,7 0,0 0,1 4,1 0,5 0,0 0,0 0,0 0,0 1,5 0,3 0,0 22,1 19,6 6,3 0,0 3,2 1,3 0,0 0,0 6,5 0,0 9,7 3,2 1,7 0,0 0,1 0,3 0,0 0,0 1,4 0,0 26,3 6,5 4,6 0,0 4,6 0,0 0,0 0,0 3,9 0,0 2,1 2,2 0,6 0,0 1,6 0,0 0,0 0,0 1,6 0,0 16,2 27,7 5,1 0,0 0,0 0,0 0,0 0,0 6,3 0,0 1,2 1,5 0,8 0,0 0,0 0,0 0,0 0,0 0,9 0,0 23,0 8,4 4,3 0,0 2,4 0,0 0,0 0,0 3,5 0,0 4,9 1,5 1,1 0,0 1,2 0,0 0,0 0,0 0,0 0,0 12,5 31,3 4,3 0,0 0,0 0,0 0,0 10,5 4,5 0,0 0,9 5,1 0,3 0,0 0,0 0,0 0,0 0,8 0,5 0,0 13,9 31,9 4,4 0,0 0,0 1,8 0,0 7,0 3,8 0,0 1,6 1,9 0,2 0,0 0,0 2,0 0,0 0,2 0,1 0,0 17,9 37,3 3,9 0,0 4,5 2,4 0,0 8,7 3,3 0,0 1,9 6,0 0,8 0,0 0,8 0,4 0,0 0,6 0,2 0,0 20,9 32,1 4,2 0,0 3,4 1,7 0,0 6,9 2,9 0,0 4,6 3,8 0,1 0,0 1,1 0,1 0,0 0,6 0,1 0,0 26,5 32,7 4,0 0,0 0,0 2,4 0,0 8,2 2,8 0,0 15,8 8,8 0,2 0,0 0,0 1,0 0,0 1,1 0,5 0,0 18,8 203,0 0,0 0,0 0,0 0,0 0,0 0,0 0,6 25,4 0,0 0,0 0,0 2,2 0,0 0,9 8,0 0,0 0,0 0,0 1,9 0,0 0,5 0,2 17,9 0,0 0,0 0,0 8,5 0,0 5,4 1,5 2,7 0,0 0,0 0,0 1,7 0,0 0,2 0,0 94,6 0,0 0,0 0,0 60,5 0,0 2,7 1,8 2,1 0,0 0,0 0,0 6,5 0,0 1,3 1,0 14,5 3,1 0,0 0,0 30,8 0,0 1,6 1,0 3,1 1,0 0,0 0,0 33,8 0,0 0,1 0,3 3,7 29,2 0,0 0,0 0,0 0,0 16,2 1,4 2,8 5,1 0,0 0,0 0,0 0,0 2,4 1,1 2,8 8,0 0,0 0,0 0,0 0,0 11,3 1,7 0,7 3,5 0,0 0,0 0,0 0,0 3,7 0,7 5,6 17,6 0,0 0,0 0,0 0,0 14,8 0,7 3,4 4,1 0,0 0,0 0,0 0,0 1,8 0,0 2,3 5,2 0,0 0,0 13,8 0,0 2,5 0,4 0,4 1,1 0,0 0,0 7,9 0,0 0,2 0,1 2,7 28,2 0,0 0,0 0,0 0,0 0,0 0,5 0,4 4,7 0,0 0,0 0,0 0,0 0,0 0,1 1,8 7,3 0,0 0,0 8,4 0,0 2,1 0,3 0,1 0,4 0,0 0,0 0,2 0,0 0,1 0,0 1,0 14,7 0,0 0,0 0,0 0,0 1,2 0,3 0,0 3,0 0,0 0,0 0,0 0,0 0,1 0,0 0,9 13,6 0,0 0,0 0,0 0,0 6,2 1,9 0,1 0,6 0,0 0,0 0,0 0,0 1,7 0,2 2,8 32,2 0,0 0,0 0,0 0,0 10,8 2,9 0,2 1,3 0,0 0,0 0,0 0,0 0,4 1,0 2,9 19,1 0,0 0,0 0,0 0,0 26,8 3,5 0,9 2,6 0,0 0,0 0,0 0,0 2,6 0,2 5,4 14,8 0,0 0,0 0,0 0,0 3,4 1,4 0,9 5,3 0,0 0,0 0,0 0,0 0,3 0,1 0,6 3,7 0,2 2,9 0,0 0,4 6,8 14,6 1,0 0,4 5,6 20,9 0,3 0,4 4,0 9,5 0,4 0,8 4,3 18,6 0,4 3,1 6,6 13,7 0,4 4,0 5,7 15,1 0,4 0,5 6,6 18,8 0,7 1,5 4,9 14,3 0,5 0,6 6,2 15,4 0,2 1,5 5,8 14,7 0,1 1,4 5,9 16,1 0,6 0,2 4,8 17,4 0,6 0,6 5,3 20,2 0,8 4,4 Ketones Acetoin 0,0 Diacetyl 0,0 Pyranone 0,0 2-Cyclopentene-1,4-dione 0,0 2-Dodecanone 12,3 2-Methyltetrahydrothiophen-3-one 0,0 2-Nonanone 4,8 2-Undecanone 0,0 0,0 0,0 0,0 0,0 0,9 0,0 0,1 0,0 0,0 0,0 0,0 0,0 21,8 0,0 0,0 0,0 0,1 0,2 0,0 2,7 4,2 42,0 0,0 0,0 5,3 319,2 0,0 0,0 0,0 40,6 0,0 0,0 0,6 6,2 0,0 0,0 Pyrazine 2,5-Dimethyl-3-ethylpyrazine 2,6-Dimethylpyrazine 0,4 4,5 0,0 0,2 8,2 29,0 1,0 0,4 6,2 20,4 7,6 20,1 0,8 3,7 8,8 21,0 0,3 0,7 0,5 4,2 0,1 0,4 9,7 23,2 0,8 1,8 8,1 21,4 1,3 3,0 6,9 34,6 0,6 0,8 5,4 16,5 E2 Stdev E3 Stdev E4 Stdev E5 Stdev E6 Stdev E7 Stdev E8 Stdev E9 Stdev E10 Stdev E11 Stdev F2 Stdev F3 Stdev F4 Stdev F5 Stdev F6 Stdev F7 Stdev F8 Stdev F9 Stdev F10 Stdev F11 Stdev G2 Stdev G3 Stdev G4 Stdev G5 Stdev G6 Stdev G7 Stdev G8 Stdev G9 Stdev G10 Stdev G11 Stdev Alcohols Benzyl alcohol Butanol Dodecanol Fenchyl alcohol Furaneol Isoamyl alcohol Propanol 2-Ethyl-1-hexanol 2-Furanmethanol 2-Methyl propanol 2-Nonanol 2-Phenyl ethanol 3 Ethoxy - 1 Propanol 3-(Methylthio)-1-propanol 1,6 360,1 4,5 0,0 0,0 457,9 15,2 4,5 0,0 9,8 0,8 263,6 0,0 38,0 0,3 16,0 0,1 0,0 0,0 16,0 1,6 0,9 0,0 0,9 0,0 24,8 0,0 21,8 0,0 372,6 3,7 0,0 0,0 424,2 16,3 4,2 0,0 5,1 1,3 298,7 0,0 141,9 0,0 0,0 6,8 369,5 1,1 2,3 0,0 0,0 0,0 0,0 3,2 375,5 0,5 6,3 0,1 5,3 0,0 0,0 0,1 16,7 0,2 0,5 18,7 212,8 0,0 0,0 30,5 20,9 0,0 0,0 0,0 0,0 12,6 449,4 115,4 199,0 0,0 2,5 0,9 1,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 4,6 728,7 138,0 603,8 5,5 13,5 2,6 5,6 2,8 6,6 2,5 3,1 0,0 0,0 0,0 0,0 2,3 39,6 7,7 22,0 0,2 0,5 0,1 370,1 2,8 425,8 8,5 342,8 0,0 0,0 0,0 0,0 3,0 39,8 7,1 0,0 0,0 0,0 0,0 0,0 76,1 698,6 37,9 91,6 0,1 6,8 4,6 1,6 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 1,8 870,6 42,4 502,9 1,3 31,6 7,4 2,3 0,2 8,7 4,4 2,7 0,0 0,0 0,0 0,0 1,4 26,3 4,2 10,5 62,0 3,3 0,3 278,3 47,0 1178,3 645,5 328,2 0,0 0,0 0,0 0,0 0,0 0,0 0,0 32,0 8,9 26,2 0,6 281,1 56,7 0,0 12,9 1,2 4,3 44,0 0,0 0,0 98,0 0,0 8,6 43,4 2,9 1,2 0,4 26,5 1,2 12,8 2,8 1,6 0,5 24,4 8,3 0,0 4,7 0,1 1,8 5,1 0,0 0,0 4,1 0,0 0,6 15,2 0,0 0,3 0,0 4,0 0,3 2,8 21,1 109,2 0,2 281,1 84,5 0,0 22,8 5,4 4,7 102,9 0,0 0,0 229,9 0,0 15,6 102,6 8,1 0,8 0,3 322,5 1,1 12,6 4,9 56,7 20,8 3,9 0,0 0,6 45,4 106,0 15,7 21,9 0,0 0,0 3,5 27,5 0,5 0,0 0,5 0,0 0,9 32,7 0,0 0,0 0,0 0,6 11,4 44,7 0,0 0,0 3,2 0,0 35,7 20,1 1,0 2,9 0,2 1,9 0,0 0,4 11,9 15,7 0,3 4,7 2,7 24,6 9,5 6,8 1,2 6,0 0,5 1,5 17,4 262,8 3,4 65,3 0,0 0,0 9,2 34,2 0,0 1,6 0,0 10,7 4,1 66,2 0,0 0,0 0,1 4,8 4,2 66,0 0,0 0,0 0,0 10,1 2,9 45,0 0,1 5,8 2,1 4,8 0,2 0,9 1,8 25,7 0,7 5,4 0,8 33,9 1,5 4,5 0,6 47,6 10,1 0,0 6,6 0,5 1,7 13,1 0,0 1,9 26,4 0,0 2,6 5,9 1,2 1,1 0,2 5,5 1,1 5,4 0,6 0,0 1,6 5,3 0,5 0,0 0,1 0,5 1,5 1,9 0,0 0,3 7,0 0,0 0,1 3,2 0,8 0,4 0,1 1,8 0,0 12,9 257,4 121,0 0,0 34,6 0,0 0,0 4,0 308,1 24,2 136,7 0,0 0,0 9,6 33,6 0,0 0,0 0,0 0,0 43,2 299,9 23,5 125,4 0,0 0,0 14,6 77,4 0,0 0,0 0,0 0,0 11,2 466,7 35,4 170,0 0,0 0,0 22,9 73,2 0,0 0,0 0,0 0,0 61,9 194,6 26,4 120,4 0,0 0,0 14,8 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 31,4 719,3 6,2 494,1 0,6 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 54,0 22,9 1840,0 151,4 819,3 0,1 0,0 0,0 3,9 0,5 3,0 0,7 3,3 0,0 0,0 0,0 0,0 2,6 76,5 2,3 40,5 70,6 0,8 0,5 0,9 0,3 869,2 77,4 413,2 0,0 0,0 0,0 0,0 13,6 51,4 30,4 0,0 0,0 88,7 0,0 0,0 7,4 75,1 0,1 0,1 0,0 3,5 0,0 21,1 0,0 0,0 0,0 1660,4 0,0 0,0 29,1 3702,4 66,4 5,1 0,0 192,8 0,7 562,3 0,0 66,8 0,0 0,0 14,9 383,2 0,0 1,3 0,0 0,0 3,6 0,0 46,1 565,3 7,5 0,0 0,4 4,1 0,0 0,0 28,4 20,8 0,2 2,1 41,2 222,3 0,0 0,0 7,3 38,1 0,0 1,8 78,4 397,1 0,3 0,0 0,0 0,0 0,0 0,0 95,8 645,8 0,0 26,4 2,0 3,3 0,0 0,0 0,1 16,7 0,6 20,5 29,8 456,9 0,0 0,0 10,6 39,2 0,5 0,0 21,0 596,8 0,0 7,2 0,0 0,0 0,0 0,0 21,8 444,8 5,4 15,0 0,2 5,5 0,0 0,0 1,7 2,5 2,9 5,1 72,4 561,1 0,0 0,0 14,8 0,0 0,0 0,0 0,0 0,0 48,8 437,2 67,6 461,4 3,9 2,2 0,9 1,6 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 25,1 740,0 103,4 539,0 2,3 39,2 15,4 15,7 2,0 4,5 3,9 2,8 0,0 0,0 0,0 0,0 0,9 26,8 13,3 20,9 2,0 16,1 1,1 0,0 95,9 290,7 166,2 424,7 0,0 0,0 0,0 0,0 0,0 35,8 28,3 0,0 1,2 3,0 0,1 84,6 18,8 15,1 0,9 0,1 0,1 2,4 0,0 0,0 23,4 0,0 0,0 1,7 0,0 0,6 0,1 5,6 0,3 21,3 8,2 63,7 0,1 7,3 8,5 79,8 52,4 2,5 2,5 20,4 0,0 0,0 92,7 0,0 1,1 19,8 0,0 0,2 0,1 39,9 0,0 0,2 0,0 0,0 27,2 734,0 0,1 2,1 0,0 0,0 0,0 0,0 64,1 615,5 2,2 19,8 1,0 4,5 0,0 0,0 3,0 20,6 0,0 0,0 72,4 434,5 0,0 0,0 0,0 53,9 0,0 0,0 12,0 668,4 0,1 3,2 0,0 0,0 0,0 0,0 49,5 632,2 2,8 16,8 1,6 2,6 0,0 0,0 2,6 22,4 0,0 0,0 88,1 854,3 0,0 0,0 11,7 0,0 0,0 0,0 49,1 565,9 2,1 3,1 0,0 0,0 0,0 0,0 55,3 632,8 3,6 17,7 1,7 6,8 0,0 0,0 17,8 30,6 0,0 0,0 8,4 963,7 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 2,6 76,7 755,4 167,8 1290,6 145,1 518,6 1,2 6,4 0,5 4,7 3,3 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 6,1 99,7 1081,6 52,4 2363,5 256,6 409,1 5,6 26,0 9,8 18,2 3,0 13,5 5,3 0,0 0,0 0,0 0,0 4,3 0,0 0,0 0,0 0,0 0,0 0,0 2,6 48,9 30,5 61,9 9,4 26,7 0,0 0,0 0,0 0,0 0,0 10,0 13,4 1908,8 48,1 1693,3 322,7 289,5 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 11,6 0,0 0,0 0,0 5,0 0,4 0,0 0,0 0,0 0,0 0,0 7,7 1826,7 152,2 1189,7 129,3 396,5 14,3 822,7 373,3 476,6 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 1,5 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 1,6 56,3 31,7 33,4 7,0 10,7 6,2 0,0 0,0 0,0 34,9 1798,2 77,3 1973,2 461,9 709,7 267,2 511,7 641,5 781,6 3,4 34,0 23,1 36,8 1,6 16,9 6,9 49,7 34,9 25,3 0,1 2,8 0,8 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 56,1 35,2 37,8 8,7 0,0 0,0 0,0 0,0 0,0 4,2 59,0 38,6 76,7 32,2 16,0 0,0 35,2 20,8 27,9 2,8 0,0 0,0 12,4 3,8 0,0 0,0 0,0 0,0 0,0 13,1 787,3 82,6 771,3 13,9 328,4 18,5 503,2 239,8 248,5 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 4,5 0,0 0,0 83,5 42,0 0,0 0,0 273,4 94,2 30,8 0,0 0,0 55,8 458,4 0,2 2,0 0,0 0,0 0,0 10,9 39,2 748,2 1,5 10,8 0,0 0,0 0,0 12,3 0,7 15,3 0,0 0,0 3,2 416,9 0,0 0,0 6,9 31,3 0,0 0,0 1,5 398,8 0,4 2,0 0,0 0,0 1,3 8,7 76,1 800,6 1,2 13,7 0,0 0,0 0,2 10,2 1,8 8,3 0,0 0,0 80,5 486,1 0,0 0,0 2,4 35,7 0,0 0,0 24,0 399,7 0,2 0,0 0,0 0,0 3,5 16,1 19,9 965,7 2,5 15,5 0,0 0,0 2,5 18,0 1,2 21,2 0,0 0,0 24,0 397,2 0,0 0,0 11,9 28,0 0,0 53,4 0,0 0,0 1,5 39,5 0,2 0,0 2,8 3,6 0,0 14,0 0,0 3,6 0,0 0,0 801,4 123,8 0,0 0,0 0,0 0,0 24,7 14,0 726,8 15,9 44,5 13,1 0,0 0,0 31,7 8,8 6,2 2,8 0,0 0,0 681,3 12,8 0,0 0,0 187,6 23,8 17,8 12,1 0,0 29,9 3,7 19,1 44,4 0,3 0,0 9,8 0,0 0,0 24,3 0,0 0,0 9,2 0,0 2,0 0,0 37,4 1,5 3,2 155,4 119,1 0,5 392,8 58,6 563,1 299,7 0,9 0,0 94,2 0,0 1,3 419,2 0,0 0,0 440,9 0,0 11,1 0,3 422,9 4,1 21,5 76,7 48,6 0,2 61,8 27,4 27,6 9,0 0,5 0,0 42,8 0,0 0,6 76,4 0,0 0,0 66,1 0,0 5,4 0,2 17,0 2,3 2,2 164,8 83,1 118,3 4,8 198,5 31,8 285,5 57,8 377,1 33,2 290,4 5,8 0,5 0,2 0,3 0,1 0,3 0,0 384,8 56,8 461,7 11,4 501,5 17,1 80,8 12,5 57,3 9,5 148,8 20,2 514,4 356,3 235,7 21,9 1222,9 34,5 250,7 83,0 73,5 9,0 545,2 24,8 1,5 0,6 2,4 0,1 1,3 0,1 6,6 1,2 8,2 0,1 21,6 0,9 71,6 33,3 46,9 0,0 177,5 22,2 0,0 0,0 0,0 0,0 0,0 0,0 1,0 0,2 0,7 0,2 0,9 0,0 416,6 53,5 754,1 33,3 1146,6 42,7 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 561,5 194,5 610,1 112,9 676,4 116,3 0,0 0,0 0,0 0,0 0,0 0,0 7,8 4,9 12,7 3,9 9,5 1,7 0,1 0,1 0,4 0,0 0,3 0,0 350,4 46,1 424,0 21,1 485,9 88,3 2,1 0,9 7,8 2,1 0,0 0,0 22,9 2,5 33,0 2,8 0,0 0,0 8,5 0,0 6,2 65,9 0,0 81,2 590,9 0,0 180,2 199,4 0,0 451,8 21,4 0,0 13,0 6,7 0,0 18,3 700,4 126,2 719,7 0,0 0,0 118,4 132,9 17,0 28,2 130,8 1,2 210,6 0,0 0,0 0,0 330,9 26,5 420,9 Esters Butyl acetate Ethyl (4E)-4-decenoate Ethyl 2-methylbutyrate Ethyl acetate Ethyl butanoate Ethyl decanoate Ethyl dodecanoate Ethyl heptanoate Ethyl hexadecanoate Ethyl hexanoate Ethyl isobutyrate Ethyl isovalerate Ethyl octanoate Ethyl propanoate Ethyl tetradecanoate Isoamyl acetate Isoamyl butyrate Isobutyl acetate Isobutyl butanoate Phenethyl acetate S-methyl thioacetate 2-Methyl propanoate 1,9 0,0 3,3 73,7 32,4 0,0 2,4 1,0 6,7 16,4 0,0 1,2 60,0 0,0 2,8 27,6 9,7 1,6 0,9 19,0 0,8 39,2 1085,5 76,9 12,9 14,2 63,0 5,7 39,3 3,7 12,6 0,3 5,2 2,8 7329,9 645,1 571,8 491,1 458,6 24,9 27,6 23,2 487,4 32,4 64,5 40,2 190,7 80,6 4,0 1,9 17,0 5,1 0,0 0,0 131,1 8,4 0,0 0,0 238,1 73,8 10,3 1,1 0,0 0,0 8,6 2,1 22,8 5,6 1,5 0,7 1197,4 63,3 129,9 0,5 0,0 0,0 0,0 0,0 79,4 9,1 2,0 0,0 1955,4 136,5 155,6 148,2 95,2 4,4 10,1 7,3 314,9 38,1 11,5 14,5 11,5 4,7 0,7 0,5 1144,1 711,6 146,9 121,1 0,0 0,0 0,0 0,0 38,2 4,7 30,3 1,9 13,3 0,0 18,1 671,0 307,4 96,8 96,2 3,2 90,4 175,1 0,0 36,1 347,3 0,0 77,4 88,2 0,0 11,9 6,8 68,6 15,7 32,7 1,5 0,0 9,9 42,2 12,0 6,5 49,7 0,3 9,8 11,5 0,0 3,4 14,9 0,0 3,1 4,9 0,0 2,2 6,6 60,4 4,5 9,6 37,4 0,0 9,2 524,7 155,6 76,6 34,9 5,0 26,7 90,7 0,0 17,1 246,4 0,0 22,0 163,9 0,0 24,1 5,4 53,6 0,0 48,8 2,9 21,9 19,7 61,6 9,1 7,8 0,0 0,0 0,0 233,1 11,3 38,3 1,0 0,0 0,0 0,1 0,0 0,5 40,2 1121,9 121,4 245,1 11,1 515,1 32,0 158,7 54,8 10,9 2,8 90,1 28,7 0,0 0,0 858,3 26,1 218,1 7,6 0,0 0,0 399,3 45,1 32,5 0,6 0,0 0,0 1,5 0,1 2,4 1,6 23,1 3,9 8,0 1,2 3,6 6,2 77,9 3,7 61,1 1,1 40,3 0,0 0,0 0,0 0,0 0,0 0,0 7,9 0,0 0,0 0,0 0,0 0,0 17,6 84,7 22,2 528,5 151,8 411,8 0,0 0,0 0,0 0,0 0,0 0,0 5,8 0,0 0,0 12,3 5,4 0,0 22,7 101,2 7,4 224,8 14,4 20,1 0,0 0,0 0,0 0,0 0,0 0,0 14,9 21,1 2,3 6,7 4,8 2,1 1,2 1,9 0,4 0,2 0,1 0,6 6,0 0,0 0,0 341,2 9,2 37,9 0,0 33,0 1,6 0,0 0,0 1,2 2,2 85,1 8,3 21,1 2,4 66,3 20,8 1170,5 0,2 156,1 27,9 1191,2 487,7 7,4 11,3 120,1 0,0 0,0 682,7 0,0 60,4 52,9 0,0 0,5 0,2 382,4 0,0 14,4 7,2 3,4 421,1 22,4 100,1 65,8 25,9 4,7 5,9 2,6 3,7 1,4 595,6 82,3 2631,8 55,9 221,5 10,5 155,2 5,4 1033,7 595,4 169,7 16,9 382,3 294,8 71,8 81,4 8,2 9,8 6,9 2,8 13,1 10,2 19,3 6,0 128,5 30,7 127,9 0,4 40,7 30,3 0,0 0,0 9,3 4,2 7,2 1,4 881,0 190,6 417,0 127,8 0,0 0,0 0,0 0,0 50,1 54,8 23,7 12,1 44,5 9,6 602,5 26,8 0,0 0,0 0,0 0,0 4,5 0,5 126,6 37,4 1,3 0,3 5,3 3,8 0,0 0,0 384,5 102,4 0,0 0,0 0,0 0,0 48,7 3,6 14,6 3,3 13,5 497,5 0,2 498,3 71,9 1546,7 418,1 3,3 0,0 73,0 0,0 0,0 433,4 0,0 0,0 20,5 0,0 1,3 0,7 34,5 0,8 29,7 1,1 2,5 0,0 11,9 14,1 49,0 71,6 0,9 0,0 22,6 0,0 0,0 87,7 0,0 0,0 3,6 0,0 0,3 0,2 17,5 0,4 1,2 1387,1 16,7 1035,9 15,5 1,0 0,0 13,7 1,8 21,8 4627,3 32,6 6045,5 616,5 46,7 531,2 106,5 11,4 108,3 105,8 5,8 64,6 4,3 0,8 7,7 67,2 4,6 74,4 350,8 22,7 323,7 0,0 0,0 0,0 10,1 3,4 9,7 239,1 73,8 447,4 0,0 0,0 0,0 86,4 34,6 41,2 1888,9 163,1 1779,0 83,0 32,0 102,1 338,8 53,2 518,8 20,4 14,4 34,7 1227,5 97,4 1134,8 0,0 0,0 0,0 15,2 2,1 37,2 53,0 0,0 17,5 4,4 17,5 54,3 0,3 5,5 6,3 17,9 0,0 1,5 40,7 0,0 6,1 25,6 25,9 34,3 26,4 88,4 0,0 11,0 2796,6 0,0 17,8 ##### 950,9 32,4 66,9 2,9 99,6 339,3 0,0 7,9 420,0 573,8 63,0 5710,3 192,5 1950,3 81,6 2493,0 0,0 29,3 70,0 0,0 9,1 153,5 230,4 7,0 1,0 0,1 6,7 152,4 0,0 1,4 56,7 18,7 5,6 56,5 1,1 31,1 13,3 195,0 0,0 1,2 1992,1 0,0 128,8 ##### 1543,5 0,0 0,0 5,3 111,3 605,0 0,0 81,1 192,8 301,0 88,7 3562,4 0,0 759,8 65,3 1727,3 0,0 0,0 160,2 38,4 4,3 454,3 61,2 157,8 28,4 270,0 18,9 224,4 109,7 207,3 0,0 0,0 0,0 211,1 13,3 105,5 7,6 422,1 31,6 658,8 263,8 459,3 12,2 2,2 0,3 1,0 0,3 3,4 1,4 1,1 0,9 0,3 0,1 0,2 101,3 1390,4 271,1 4023,9 352,8 1940,9 407,2 616,1 239,4 674,7 34,1 504,7 158,6 211,2 51,3 147,9 82,8 88,1 9,7 70,0 10,3 60,7 32,9 34,5 0,0 0,0 0,0 629,4 66,9 414,8 82,0 916,5 24,9 217,0 35,4 339,1 0,0 0,0 0,0 197,9 44,4 67,0 4,7 195,6 64,4 69,6 51,7 225,0 3,4 3,7 0,6 3,8 2,5 0,8 0,2 4,6 0,1 1,8 0,0 2,0 5,9 27,1 5,1 89,9 5,0 50,5 10,5 44,5 5,2 0,0 0,0 0,0 57,7 57,6 17,1 203,3 9,9 202,6 26,4 125,6 18,5 130,2 46,6 80,1 0,0 28,0 0,7 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 14,6 2,8 0,7 0,0 0,0 4,4 1,4 0,8 0,2 0,5 0,2 0,2 14,5 184,1 37,8 480,5 22,3 447,8 137,3 996,5 62,3 725,5 279,5 498,2 90,6 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 13,9 14,2 4,7 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 59,1 79,2 10,2 773,6 39,8 488,2 179,6 777,8 5,7 914,0 462,1 556,1 0,0 13,7 6,3 0,0 0,0 0,0 0,0 5,0 2,0 0,0 0,0 0,0 84,8 13,1 1,1 86,1 49,9 53,3 3,0 37,8 16,3 21,0 13,8 28,4 3,6 4,0 0,7 4,2 2,2 1,3 0,7 0,5 0,2 0,4 0,2 0,4 113,9 31,2 4,8 188,2 17,0 262,3 8,9 484,0 16,3 529,0 187,7 400,1 0,0 0,0 0,0 1,7 0,9 0,0 0,0 4,8 1,9 0,0 0,0 2,1 0,0 74,0 10,9 0,0 0,0 0,0 0,0 23,8 5,2 49,2 32,0 16,6 Acids Acetic acid Butyric acid Decanoic acid Hexanoic acid Isovaleric acid Octanoic acid 5,9 1561,5 6,8 0,0 0,0 0,0 0,0 56,7 0,0 0,0 0,0 132,8 99,0 226,6 0,0 180,1 0,0 0,0 17,9 26,8 0,0 0,0 1,1 48,3 75,9 495,9 27,0 349,6 0,0 0,0 1,4 147,1 0,0 0,0 3,3 51,2 44,3 928,3 126,8 2445,9 25,2 263,6 1,6 483,0 0,0 0,0 0,0 0,0 14,3 78,9 10,7 76,0 0,0 0,0 0,0 0,0 4,2 46,9 3,5 0,0 25,0 461,2 49,4 0,0 0,0 350,1 26,3 0,0 0,0 0,0 0,0 375,2 67,8 565,6 0,0 303,8 83,0 0,0 0,0 64,2 0,0 0,0 88,7 74,9 57,9 867,3 58,1 0,0 0,0 127,5 27,1 0,0 0,0 0,0 30,5 218,9 41,6 794,6 34,4 1069,5 190,7 562,1 0,0 0,0 0,0 0,0 0,0 0,0 6,4 366,6 116,2 0,0 0,0 406,3 0,0 59,2 19,6 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 35,1 404,7 146,3 60,0 30,0 64,8 13,6 2264,4 0,0 62,6 75,6 0,0 0,0 0,0 0,0 0,0 6,1 0,0 87,9 2465,7 224,2 4941,9 7,0 183,2 30,1 135,1 0,0 0,0 0,0 0,0 0,0 63,2 7,9 0,0 0,0 0,0 0,0 0,0 0,0 34,6 48,8 103,7 57,7 3801,5 552,2 1283,7 358,8 2812,8 10,0 460,2 54,0 349,9 51,7 642,3 0,0 0,0 0,0 0,0 0,0 82,2 0,0 0,0 0,0 63,6 2,4 214,6 0,0 0,0 0,0 0,0 0,0 0,0 6,3 0,0 0,0 29,2 2,5 145,3 62,2 50,2 42,8 29,5 0,0 8,9 1425,9 264,7 537,3 233,6 16,5 0,0 105,7 9,0 152,0 153,1 13,3 0,0 0,0 0,0 0,0 217,0 9,9 377,7 79,0 1019,8 482,2 469,6 0,0 0,0 0,0 0,0 76,0 36,7 16,4 62,6 0,0 271,4 95,6 164,5 0,0 0,0 0,0 0,0 20,5 697,5 298,5 418,0 41,7 3,3 5,6 26,2 0,0 35,5 1809,9 95,5 543,9 45,9 754,8 22,4 0,0 0,0 139,5 1,2 1026,0 184,5 14,5 138,4 1,1 38,1 3,2 18,3 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 7,7 0,0 1,3 6,6 0,0 0,0 20,9 40,7 63,6 109,1 0,0 0,0 666,8 0,0 142,5 200,0 5,8 62,2 0,5 32,4 8,9 90,1 6,9 69,9 0,0 0,0 0,0 0,0 35,1 425,8 0,0 0,0 6,2 158,2 12,2 186,0 20,2 4,7 4,2 17,1 0,0 0,0 95,5 0,0 5,5 5,0 19,0 13,5 28,5 0,0 0,0 0,0 0,0 0,0 50,8 69,1 1,8 1,3 10,2 0,0 0,0 0,0 0,0 0,0 2,0 4,3 11,3 15,1 14,9 0,0 0,0 0,0 0,0 0,0 28,7 7,7 4,2 6,8 8,1 0,0 0,0 0,0 0,0 0,0 16,9 4,7 7,5 9,6 7,4 0,0 0,0 0,0 0,0 0,0 10,8 0,0 0,8 20,7 0,6 12,1 1,3 32,7 0,0 29,6 0,0 0,0 0,0 0,0 0,0 154,6 0,0 4,8 1,0 39,3 0,0 76,7 3,1 2,3 2,2 0,5 0,0 0,0 17,9 0,6 2,3 1,5 11,3 11,6 27,1 20,2 0,0 0,0 95,3 0,0 39,3 38,5 0,2 8,6 0,7 14,8 5,9 48,0 7,0 34,0 0,0 0,0 0,0 0,0 53,0 171,0 0,0 0,0 13,7 68,5 5,5 127,9 0,4 6,9 0,1 28,3 4,5 84,1 3,0 55,2 0,0 0,0 0,0 0,0 1,5 238,3 0,0 0,0 6,1 123,2 5,0 213,7 1,4 3,6 26,8 16,1 0,0 0,0 24,0 0,0 33,6 8,8 0,0 23,3 0,0 0,0 66,2 1105,9 0,8 134,1 0,0 0,0 0,0 0,0 5,1 0,0 0,0 0,0 4,2 33,1 0,0 0,0 65,1 689,7 5,9 102,4 0,0 0,0 0,0 0,0 0,0 19,1 0,0 0,0 4,9 2,8 0,0 0,0 61,7 150,8 22,8 39,5 0,0 0,0 0,0 0,0 7,2 0,0 0,0 0,0 1,8 0,0 13,4 6,3 0,0 0,0 0,0 0,0 0,0 0,0 4,4 15,8 0,0 0,0 3,4 0,0 0,0 0,0 2,6 7,1 0,0 0,0 0,1 0,0 2,0 0,0 2,4 5,6 0,0 0,0 0,0 0,0 1,1 3,5 0,0 0,0 1,9 282,5 0,5 31,4 0,0 0,0 0,0 0,0 0,0 3,1 0,0 0,0 0,3 0,0 0,0 0,0 24,1 213,8 1,0 27,2 0,0 0,0 0,0 0,0 0,7 0,0 0,0 0,0 0,0 0,0 0,0 0,0 7,6 306,4 8,9 44,1 0,0 0,0 0,0 0,0 0,0 25,3 0,0 0,0 0,0 0,0 0,0 0,0 11,1 465,5 3,7 76,2 0,0 0,0 0,0 0,0 2,9 6,1 0,0 0,0 0,0 0,0 13,5 12,4 0,0 0,0 1,2 0,0 0,8 0,2 3,4 10,3 1,4 1,6 2,5 11,1 Aldehydes Acetaldehyde Benzaldehyde Furfural Phenyl acetaldehyde 1 -Decanal 1-Nonanal 3-Methyl butanal 4-Methyl benzaldehyde 5 Methyl furfural 5-Hydroxymethylfurfural 8,1 28,9 3,2 0,0 0,0 1,0 0,0 5,1 2,2 0,0 0,3 1,0 0,4 0,0 0,0 0,1 0,0 0,1 0,6 0,0 15,9 24,5 3,1 0,0 4,0 1,4 0,0 4,1 1,4 0,0 0,9 2,2 0,1 0,0 0,1 0,1 0,0 1,3 0,4 0,0 14,8 7,7 2,8 0,0 1,9 1,6 0,0 0,0 1,3 0,0 14,2 4,7 0,6 0,0 1,1 0,8 0,0 0,0 0,6 0,0 22,7 5,0 3,9 0,0 0,0 1,4 0,0 0,0 1,7 0,0 0,1 7,9 0,0 0,0 0,0 0,0 0,1 0,1 4,1 24,0 0,0 0,0 0,0 0,0 1,4 0,3 0,2 1,7 0,0 0,0 0,0 0,0 0,0 0,0 6,2 5,6 0,0 0,0 0,0 0,0 1,4 0,5 0,3 1,8 0,0 0,0 0,0 0,0 0,4 0,1 2,3 3,3 0,0 0,0 0,0 0,0 1,5 0,6 0,1 0,2 4,3 11,3 0,1 0,5 4,5 16,3 0,7 4,6 4,0 15,0 3,7 1,2 0,3 0,0 0,0 0,9 0,0 0,0 0,3 0,0 10,8 0,0 2,1 0,0 0,0 0,0 0,0 3,7 1,2 0,0 0,9 0,0 0,5 0,0 0,0 0,0 0,0 0,2 0,2 0,0 38,9 35,3 7,5 0,0 12,6 0,0 0,0 0,0 4,1 0,0 0,5 0,0 0,4 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,2 314,5 0,2 64,3 0,0 0,0 0,0 0,0 0,0 0,0 17,1 3,5 5,5 0,0 0,0 0,0 0,0 0,0 3,9 2,1 0,1 0,6 9,7 12,7 6,3 5,1 3,8 0,0 3,9 0,0 0,0 0,0 2,5 0,0 12,8 0,0 1,8 0,0 0,9 0,0 0,0 3,9 0,8 0,0 9,6 0,0 0,3 0,0 1,2 0,0 0,0 0,0 0,0 0,0 56,2 6,3 3,6 0,0 0,0 0,0 0,0 0,0 2,2 0,0 1,9 1,0 0,9 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 1,0 320,8 100,7 1,0 43,0 35,6 1,1 0,0 0,0 0,0 0,0 0,0 3,2 0,0 4,7 36,4 8,7 103,8 4,3 10,4 0,7 16,6 0,3 36,1 12,4 14,9 0,0 82,6 16,2 33,6 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 480,9 211,4 0,0 0,0 0,0 0,0 0,0 1,9 74,0 9,2 94,1 0,0 0,0 0,0 0,0 11,7 15,4 19,0 12,4 0,0 0,0 0,0 0,0 5,6 0,0 14,7 12,4 5,6 0,0 5,2 0,0 0,0 3,9 11,4 0,0 4,9 0,6 2,1 0,0 1,9 0,0 0,0 1,2 5,9 0,0 23,4 22,9 6,7 0,0 0,0 0,0 0,0 0,0 11,9 0,0 4,1 0,1 0,8 0,0 0,0 0,0 0,0 0,0 2,8 0,0 18,7 31,8 7,9 0,0 0,0 0,0 0,0 0,0 6,4 0,0 4,8 3,3 3,7 0,0 0,0 0,0 0,0 0,0 1,5 0,0 13,0 16,4 2,9 0,0 0,0 0,0 0,0 0,0 8,2 0,0 7,1 7,3 3,3 0,0 0,0 0,0 0,0 0,0 2,8 0,0 27,4 12,0 6,0 0,0 0,0 0,0 0,0 6,5 5,0 0,0 18,6 1,5 0,3 0,0 0,0 0,0 0,0 1,6 1,0 0,0 11,1 26,4 7,1 0,0 4,6 0,0 0,0 0,0 6,7 0,0 0,0 3,4 0,1 0,0 1,7 0,0 0,0 0,0 0,8 0,0 66,4 21,5 5,6 0,0 0,0 0,0 0,0 0,0 3,4 0,0 21,5 7,1 0,5 0,0 0,0 0,0 0,0 0,0 0,5 0,0 28,4 31,4 11,9 0,0 0,0 0,0 0,0 19,2 14,6 0,0 1,5 135,4 4,4 29,8 2,5 6,1 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 1,0 5,6 0,4 3,7 0,0 0,0 0,3 0,0 0,0 0,0 0,0 432,3 0,0 61,8 0,0 0,0 0,0 0,0 1,4 4,9 0,0 0,0 18,6 24,4 5,2 0,0 0,0 0,0 0,0 0,0 0,2 0,0 18,6 23,5 15,9 19,4 0,0 0,0 82,8 0,0 17,4 13,4 0,6 1,6 1,3 0,5 0,0 0,0 15,9 0,0 2,8 0,8 Ketones Acetoin 0,7 Diacetyl 10,3 Pyranone 0,0 2-Cyclopentene-1,4-dione 0,0 2-Dodecanone 0,0 2-Methyltetrahydrothiophen-3-one 0,0 2-Nonanone 0,8 2-Undecanone 0,3 0,0 0,0 30,9 5,9 0,0 0,0 5,8 0,0 0,0 0,0 0,0 81,5 0,0 0,0 0,0 0,0 0,0 0,0 0,0 20,0 0,0 0,0 0,0 0,0 3,4 0,0 6,4 0,0 0,0 0,0 2,6 0,0 1,2 0,0 8,2 0,0 0,0 0,0 1,4 0,0 19,3 0,0 7,7 0,0 0,0 0,0 34,1 0,0 8,9 0,0 1,8 0,0 0,0 0,0 4,5 0,0 2,2 0,0 2,6 0,0 0,0 0,0 0,0 0,0 0,6 0,0 2,3 0,0 0,0 0,0 0,0 0,0 0,0 0,0 2,1 0,0 0,0 0,0 14,7 0,0 0,0 0,0 0,7 0,0 0,0 0,0 16,1 0,0 4,4 0,0 0,0 0,0 0,0 0,0 0,0 0,0 5,1 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 0,0 26,7 0,0 0,0 0,0 0,0 0,0 0,0 0,0 7,8 0,0 0,0 0,0 0,0 0,0 0,0 0,0 6,6 0,0 36,0 14,0 0,0 0,0 0,0 0,0 7,7 0,0 5,3 0,5 0,0 0,0 0,0 0,0 0,0 0,0 0,0 4,3 0,0 0,0 0,0 0,0 0,0 0,0 0,0 2,7 0,0 0,0 0,0 0,0 0,0 0,0 24,6 0,0 0,0 0,0 0,0 0,0 1,9 0,8 2,8 17,5 0,3 2,3 3,2 9,1 0,6 1,1 6,2 13,5 0,5 2,6 5,3 13,6 2,9 1,7 5,2 12,2 1,2 1,3 3,3 9,3 0,5 1,2 5,9 12,7 0,0 1,0 2,9 7,4 2,4 5,4 6,4 10,9 0,8 1,6 0,9 3,6 0,1 0,0 4,3 11,9 0,0 0,0 0,0 0,0 31,7 144,5 0,0 17,1 0,0 0,0 0,0 0,0 0,0 7,2 0,0 0,0 Pyrazine 2,5-Dimethyl-3-ethylpyrazine 3,7 2,6-Dimethylpyrazine 13,9 1,2 3,6 2,9 12,9 2,5 0,4 3,4 12,1 0,6 1,9 3,0 12,4 0,4 2,0 4,5 27,3 1,0 2,6 3,7 12,1 0,1 5,9 2,8 12,7 0,6 9,0 7,8 2,8 2,8 0,5 3,4 7,1 0,1 1,3 4,6 11,9 0,9 0,5 2,5 11,5 0,2 0,5 3,7 15,1 0,1 0,9 4,1 9,5 0,0 2,1 Table 2B: List of 62 volatiles that have been detected by GC-MS measurement Alcohols 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Benzyl alcohol Butanol Dodecanol Fenchyl alcohol Furaneol Isoamyl alcohol Propanol 2-Ethyl-1-hexanol 2-Furanmethanol 2-Methyl propanol 2-Nonanol 2-Phenyl ethanol 3 Ethoxy - 1 Propanol 3-(Methylthio)-1-propanol Esters 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Butyl acetate Ethyl (4E)-4-decenoate Ethyl 2-methylbutyrate Ethyl acetate Ethyl butanoate Ethyl decanoate Ethyl dodecanoate Ethyl heptanoate Ethyl hexadecanoate Ethyl hexanoate Ethyl isobutyrate Ethyl isovalerate Ethyl octanoate Ethyl propanoate Ethyl tetradecanoate Isoamyl acetate Isoamyl butyrate Isobutyl acetate Isobutyl butanoate Phenethyl acetate S-methyl thioacetate 2-Methyl propanoate Acids 37 38 39 40 41 42 Acetic acid Butyric acid Decanoic acid Hexanoic acid Isovaleric acid Octanoic acid Aldehydes 43 44 45 46 47 48 49 50 51 52 Acetaldehyde Benzaldehyde Furfural Phenyl acetaldehyde 1 -Decanal 1-Nonanal 3-Methyl butanal 4-Methyl benzaldehyde 5 Methyl furfural 5-Hydroxymethylfurfural Chetons 53 54 55 56 57 58 59 60 Acetoin Diacetyl Pyranone 2-Cyclopentene-1,4-dione 2-Dodecanone 2-Methyltetrahydrothiophen-3one 2-Nonanone 2-Undecanone Pyrazines 61 62 2,5-Dimethyl-3-ethylpyrazine 2,6-Dimethylpyrazine Table 3: Characterization of fermentation performance. . The table values are represented as a heat map with grey values. The legend shows the range for each grey value for the respective condition/test. Figure 1A: Principal component analysis of the set of strains and their chemical compounds. The matrix is based on the full set of 60 strains and the average of the 62 VOCs detected. Strains are presented with their assigned coordinates (see Table 1). Species belonging to the same genus are represented with the same color. A higher resolution of the central plot is shown as inset at the upper right corner. Figure 1B: Loading plot of the principal component analysis of all components. Components were grouped according to the chemical class, numbered and colored similarly. The complete list of volatiles is shown in table 2B. Figure 2A: Fermentation profile of the sub-set of 18 strains. The CO2 release was measured daily for each individual strain. Fermentation was followed for 11 days. Figure 2B: Final Sugar content and ethanol production of the subset of 18 strains. Sugar concentration was measured in °P after 11 days of fermentation. The ethanol concentration is shown as % ethanol (vol/vol). Figure 3: Volatile organic compounds produced during fermentation by the subset of 18 strains. The compounds were grouped, numbered and colored according to their chemical class. The complete list of compounds is shown in Table 2B. Figure 4: Concentration of selected volatiles in six strains that produced exceptionally high concentrations of organic volatiles Candida diversa (B4); Debaryomyces subglobosus (B11); Pichia kluyveri (E7); Saccharomyces cerevisiae (E11); Wickerhamomyces anomalus (F10); Zygosaccharomyces mellis (G4); Saccharomyces pastorianus (G10). References 11. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. Dunn, B. and G. Sherlock, Reconstruction of the genome origins and evolution of the hybrid lager yeast Saccharomyces pastorianus. Genome Res, 2008. 18(10): p. 1610-23. Spitaels, F., et al., The microbial diversity of traditional spontaneously fermented lambic beer. PLoS One, 2014. 9(4): p. e95384. Pires, E.J., et al., Yeast: the soul of beer's aroma--a review of flavour-active esters and higher alcohols produced by the brewing yeast. Appl Microbiol Biotechnol, 2014. 98(5): p. 1937-49. D. Šmogrovičová, Z.D., Beer volatile byproduct formation at different fermentation temperature using immobilised yeasts. Process Biochemistry, 1999. 34(8): p. 785-794. Bart Vanderhaegen, Filip Delvaux, Luk Daenen, Hubert Verachtert, Freddy R. Delvaux, Aging characteristics of different beer types. Food Chemistry, 2007. 103(2): p. 404-412. Vanderhaegen, B., et al., Evolution of chemical and sensory properties during aging of top-fermented beer. J Agric Food Chem, 2003. 51(23): p. 6782-90. Chiam Yu Ng, M.-y.J., Jinwon Lee and Min-Kyu Oh, Production of 2,3-butanediol in Saccharomyces cerevisiae by in silico aided metabolic engineering. Microbial Cell Factories, 2012. 11(68). Mauriello, G., et al., SPME-GC method as a tool to differentiate VOC profiles in Saccharomyces cerevisiae wine yeasts. Food Microbiol, 2009. 26(3): p. 246-52. Laluce, J.F.T.S.A.L.R.d.S.C., Nonconventional yeasts. Appl Microbiol Biotechnol, 2002. 58: p. 147-156. Krogerus, K. and B.R. Gibson, Influence of valine and other amino acids on total diacetyl and 2,3-pentanedione levels during fermentation of brewer's wort. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. Appl Microbiol Biotechnol, 2013. 97(15): p. 6919-30. Pretoriu, M.d.T.a.I.S., Microbial Spoilage and Preservation of Wine: Using Weapons from Nature's Own Arsenal- A Review S. Afr. J. Enol. Vitic., 2000. 21(Special Issue): p. 74-96. Viana, F., et al., Monitoring a mixed starter of Hanseniaspora vineaeSaccharomyces cerevisiae in natural must: impact on 2-phenylethyl acetate production. Int J Food Microbiol, 2011. 151(2): p. 235-40. Hope, C.F.A., Cinnamic acid as the basis of a medium for the detection of wild yeasts. Journal of the Institute of Brewing, 1987. 93(3): p. 213-215. Ian McMurrough, D.M.D.D., June Hurley, Ann-Marie Doyle, Gerard Hennigan and Niall McNllty, Control of ferulic acid and 4-vinyl guaiacol in brewing. J. Insl. Brew, 1996. 102: p. 327-332. E. Acree, E.P.S.a.D.F.S., Effect of Yeast Strain and Type of Sulfur Compound on Hydrogen Sulfide Production. Am. J. Enol. Vitic, 1972. 23(1): p. 6-9. Apostolos Spiropoulos, J.T., Ioannis Flerianos, and Linda F. Bisson, Characterization of hydrogen sulfide formation in commercial and natural wine isolates of Saccharomyces. Am. J. Enol. Vitic., 2000. 51: p. 223-248. Dmytruk, K.V. and A.A. Sibirny, Candida famata (Candida flareri). Yeast, 2012. 29(11): p. 453-8. Harris, F.B.A.a.G., The Production of Riboflavin and D-Arabitol by Debaryomyces subglobosu. J. gen. Microbiol, 1963. 33: p. 137-146. Seong Han Lim, J.S.C., and Enoch Y. Park, Microbial Production of Riboflavin Using Riboflavin Overproducers Ashbya gossypii, Bacillus subtilis, and Candida famate: An Overview. Biotechnol. Bioprocess Eng., 2001. 6: p. 75-88. Brachmann, A.O., et al., Pyrones as bacterial signaling molecules. Nat Chem Biol, 2013. 9(9): p. 573-8. Paul L.H. Mcsweeney, M.J.S., Biochemical pathways for the production of flavour 22. 23. 24. 25. 26. 27. compounds in cheeses during ripening: A review. Lait 80, 2000: p. 293–324. T van den Tempel, M.J., The technological characteristics of Debaryomyces hansenii and Yarrowia lipolytica and their potential as starter cultures for production of Danablu. International Dairy Journal, 2000. 2000(4): p. 263–270. Smit, B.A., W.J. Engels, and G. Smit, Branched chain aldehydes: production and breakdown pathways and relevance for flavour in foods. Appl Microbiol Biotechnol, 2009. 81(6): p. 987-99. M.-C. Montel, J.R., R. Talon, J.-L. Berdagué, S. Rousset-Akrim, Biochemical activities of Micrococcaceae and their effects on the aromatic profiles and odours of a dry sausage model. Food Microbiology, 1996. 13(6): p. 489–499. Daniel, H.M., et al., Wickerhamomyces anomalus in the sourdough microbial ecosystem. Antonie Van Leeuwenhoek, 2011. 99(1): p. 63-73. Hartman, H.R.B.A.P.A., Yeasts in Ensiled High-Moisture Corn. Applied Microbiology, 1966. 14(1): p. 35-38. Crafack, M., et al., Influencing cocoa flavour using Pichia kluyveri and Kluyveromyces marxianus in a defined mixed starter culture for cocoa fermentation. Int J Food Microbiol, 2013. 167(1): p. 103-16. Appendix PCA based disruption cassette were used to generate the A.gossypii deletion mutants as described by Wendland, J., et all., 2000 [65] The deletion cassettes were amplified from pFAGEN3 (C634) and pFA-SAT1(550) using S1- and S2- primers which contained 50 bp homologus flanks to the target gene. The amplified DNA product was precipitated, purified and transformed into A.gossypii by electroporation. Diagnostic PCR was used to verify the correct integration of the cassette into the target gene locus. G1(upstream) and G4(downstream) annealing primers of the marker integration site, and GEN3/SAT1 primers (G2 and G3) were used for the verification. I1/I2 primers were used to confirm the homokaryotic deletion(HOM) of the target gene in the A.gossypii genome. In Figure 1 there is a schematic view of the process. Figure 1. Schematic representation of the PCA-based target protocol used in A.gossypii. A first round of transformation was necessary to generate the heterokaryons mutants. Then the heterokarions were let sporulate in selective condition and the haploid spores macromanipulated s into selective media to generate homokaryons mutants. Two independent mutants were generated for each gene deletion. 67 68 69 70