Download Practice Midterm Key

Genome 261, Spring 2007
Practice Midterm
Multiple True/False – CIRCLE ALL ANSWERS THAT ARE TRUE!!!!
1. A gene …
a. is a unit of information coding for a single protein (usually).
b. is composed of DNA.
2. Bt toxin…
b. is a protein.
3. A chromosome…
b. contains many different genes.
d. contains two antiparallel strands of DNA.
4. The human genome…
a. shares the same set of genes with chimpanzees.
c. has genes that are similar to ones found in flies or bacteria.
d. is one of many animal genomes that have been fully sequenced.
5. Use the letters A-C corresponding to each image to answer the following questions. Some
questions will have multiple answers and letters can be used more than once.
A
a. Which are considered nucleotides? A, B, C
B
b. Which can be found in a cell? B, C
C
c. Which are found with U as a base? B
d. Which are parts of a template for DNA sequencing? C
6. For each of the following substances, fill in the blank with one of the 4 main types of molecules
that best describes that substance (e.g. carbohydrate, nucleic acid, etc.).
i. virulence gene: Nucleic Acid
iii. histone: Protein
ii. flour: Carbohydrate
iv. olive oil: Lipid
1
Genome 261, Spring 2007
Practice Midterm
7. You are a genome scientist from the early 1990’s. You study a gene involved in breast cancer. A
patient comes to you and wants to know if she has a common mutation found in the BRCA1 gene.
A portion of your sequencing gel looks like the following:
Fragments ending in:
A C G T
a. What is the DNA sequence represented by the gel?
5’ GCGTAA 3’
b. What was the DNA sequence of the template strand
corresponding to this region?
5’ TTACGC 3’
When you sequence the beginning of the BRCA1 gene, you find 2 mutations in the patient’s DNA
compared to wild-type.
promoter
5’ AAGCTATAGTTGGGCCATGTTAGTTAACGGG... 3’
3’ TTCGATATCAACCCGGTACAATCAATTGCCC... 5’
WILD-TYPE
5’ AAGCTATAGTTGCGCCATGTTAGTAACGGG... 3’
3’ TTCGATATCAACGCGGTACAATCATTGCCC... 5’
PATIENT
a = base pair change
b= base pair deletion
c. What is the sequence of the RNA transcribed from the wild-type allele? (Be sure to label your 5’
and 3’ ends.)
5’ GUUGGGCCAUGUUAGUUAACGGG … 3’
d. What is the sequence of the protein that is coded for by this segment of the wild-type RNA?
Met – Leu – Val – Asn - Gly
e. Which one of the mutations (a or b) is more likely to cause breast cancer? Explain
Mutation b is more likely to have an effect, since mutation ‘a’ is before the region that
codes for protein (not changing the protein at all) and mutation b changes the protein significantly
(it’s a frame shift.)
f. Describe one way that these mutations could arise in the absence of environmental mutagens.
A mistake by DNA polymerase during replication (copying) of the chromosomes.
2
Genome 261, Spring 2007
Practice Midterm
8. The Odwalla® bar I bought the other day has the following statement on the back:
“GMOs Go Home! GMOs – genetically modified organisms – are techniques that alter organisms by
means that are not possible under natural conditions.”
a. In fact, genetic engineering of plants does require a “natural genetic engineer”.
i. What is the name of this organism? Agrobacterium tumefaciens
ii. What does this organism do naturally that bioengineers desire to do when they make
GMO’s?
Agrobacterium can insert genes into a plant cell using the proteins coded for by genes on the Ti
plasmid. In addition, the t-DNA (the part that is inserted into the cell) is also integrated into the
host cell genome.
b. The Odwalla® statement is partially correct. What part of GMO technology is not possible under
natural conditions? Describe briefly.
It is not possible to naturally get a specific gene of interest into the Ti plasmid. This must be done
in the lab using restriction enzymes and other molecular techniques.
9. a. What are two aspects of the creation of Golden Rice, one technological and one social, that were
novel in the field of genetic engineering?
Technological: the scientists engineered a multi-step pathway in the rice that would make
carotene.
Social/Economical: it was created with the intention to give the rice out free to those in need.
b. Assuming Golden Rice was designed to help the problem of vitamin A deficiency, list two
arguments used to support the use and distribution of Golden Rice as a solution.
1. It is a sustainable solution
2. It is free to the people who need it
3. There is enough carotene to be effective
4. We’ve been altering the rice genome for yers with no new dangers through selective breeding.
10. Read the statement below carefully (taken from a real source on the web). Then explain in 1-2
sentences what is incorrect or unreasonable about the statement.
“The purpose of doing IVF, for me, isn't just to get pregnant. I get pregnant very easily. It's to find a
good egg through PGD.” (From: http://missedconceptions.typepad.com/km/ivf_with_pgd/)
Preimplantation genetic diagnosis is not used to test eggs, but to test embryos (after fertilization).
3
Genome 261, Spring 2007
Practice Midterm
11. What are two reasons that someone may have for justifying the cloning a non-human mammal?
1. improve livestock
2. save an endangered species
3. bring back a beloved pet
4. help learn more about human cloning
12. In the diagram below, fill in the blanks with the appropriate term or process:
a. enucleated egg
b. implantation (into surrogate mother)
c. somatic cell
d. cloned zygote
13. Each of the following statements is FALSE. For each one, describe why they are false in 1-2
sentences.
a. “Once larvae become resistant to the toxin produced from the Cry1a gene, biotechnology will not
be able to generate an insect-resistant plant.”
There are many other Cry genes or other toxin genes that kill insects that biotechnology companies
can engineer into plants.
b. “Since the human genome has roughly 25,000 genes, all organisms who have more genes have
more total DNA.”
Some organisms, like plants, have less DNA but more genes. This is because their DNA has less
“junk” or non-coding DNA.
14. a. During the process of sperm sorting, on what basis are X-bearing sperm distinguished from Ybearing sperm?
Total DNA content as measured by fluorescence.
b. Your best friend tells you he thinks that sperm sorting is ethical, but pre-implantation genetic
diagnosis (PGD) is not. Describe a difference between sperm sorting and PGD that could lead to your
friend’s opinion.
Sperm sorting occurs prior to fertilization, whereas PGD occurs afterward. If his opinion is
that an embryo has the same moral status as a fully-grown human, then he may think that
discarding unwanted embryos was akin to murder or at least was immoral. Since in sperm sorting
you are discarding sperm that have an unwanted chromosome, there is a difference.
c. Describe a situation in which PGD can be used by parents to increase the chances of a specific
genotype in a child, but in which sperm sorting would NOT help those parents.
To get rid of sickle cell anemia for example – any disease on an autosome (non-sex
chromosome) you cannot use sperm sorting, since you won’t be able to tell the types of alleles on
the chromosomes. (Only overall DNA content).
4