Download Quiz 16 Name: 1. Why can a jellyfish gene be inserted into a cat and

Quiz 16
Name:______________________________
1. Why can a jellyfish gene be inserted into a cat and expressed just as it is in a jellyfish?
A) Cats and jellyfish are very closely related
B) Scientists engineered the cat’s cells to “think like jellyfish”
C) The “instructions” in genes are read and implemented in the same way in (nearly) all
organisms
D) Jellyfish genes are dominant to cat genes
2. We say the genetic code is redundant. Why?
A) most amino acids are chemically equivalent to each other
B) there are more kinds of tRNAs than codons
C) some amino acids are coded for by multiple codons
D) the first “letter” of a codon is frequently unimportant in determining which amino acid a codon
specifies
E) there is no redundancy because there are exactly 64 codons, 64 tRNAs, and 64 amino acids
3. Suppose a mutation in DNA caused a “stop codon” to appear prematurely in an mRNA transcript.
What effect would this have?
A) cause a shortened version of the protein to be produced (i.e., a version with fewer amino acids)
B) no effect
C) cause a different amino acid to appear in the protein at the location corresponding to this codon
D) cause a longer version of the protein to be produced (i.e., a version with more amino acids)
4. A mutation in DNA which causes a change in one letter of a codon could
A) have no effect
B) change one amino acid in a protein
C) cause a protein to have fewer amino acids than normal
D) cause a protein to have more amino acids than normal
E) all of the above
5. Which of the following is NOT a difference between DNA and RNA?
A) RNA nucleotides use a different phosphate than DNA nucleotides.
B) One of RNA’s nitrogenous bases is different than DNA’s.
C) DNA nucleotides contain a different sugar than RNA nucleotides.
D) DNA is a double helix, but RNA is usually single-stranded.
E) A and D are correct.
6. A particular triplet of bases in the template strand of DNA is 3' CAT 5'. The corresponding codon for
the mRNA transcribed is
A) 3' CUA 5'.
B) 5' GUA 3'.
C) 5' UTC 3'.
D) 3'GAU 5'.
E) 3’ CUU 5’.
7. Which of the following is TRUE?
A) RNA polymerase uses RNA as a template, and DNA polymerase uses a DNA
template.
B) RNA polymerase requires helicase to unzip the helix for it.
C) RNA polymerase reads 5’ to 3’, but DNA polymerase reads 3’ to 5’.
D) RNA polymerase can initiate RNA synthesis without a primer, but DNA
polymerase requires a primer.
E) RNA polymerase does not need to separate the two strands of DNA in order to
synthesize an RNA copy, whereas DNA polymerase must unwind the double
helix before it can replicate the DNA.
8. Which of the following is NOT true about splicing?
A) Splicing involves the removal of non-protein coding sequences
B) Splicing involves the fusion of protein-coding sequences
C) Splicing is done by the ribosome
D) Splicing can generate different mRNAs from the same gene
E) Splicing must occur before translation
9. Once a ribosome has found its reading frame, what amino acid sequence will be generated based on
the following mRNA codon sequence?
5' CCAGAUGUCUUCGUCCUUGAAC 3'
A) pro-met-ser-ser-leu-asn
B) pro-asp-val-phe-val-leu-glu
C) met-ser-leu-ser-leu-ser
D) met-ser-ser-ser-leu-asn
E) gin-val-pro-ala-ser-val-asp
10. A polypeptide has the sequence phe-pro-lys-gly-phe-pro. Which of the following sequences in the
template strand of the DNA could code for this polypeptide?
A) 3' AAA-GGG-TTT-CCC-AAA-GGG
B) 3' UUU-CCC-AAA-GGG-UUU-CCC
C) 3' TTT-CCC-AAA-GGG-TTT-CCC
D) 5' GGG-AAA-CCC-AAA-CCC-GGG
E) 5' AAA-TAC-CAT-AAA-CAT-TAC-UGA