Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
FEMS Yeast Research 5 (2005) 471–483 www.fems-microbiology.org Evolutionary relationships between the former species Saccharomyces uvarum and the hybrids Saccharomyces bayanus and Saccharomyces pastorianus; reinstatement of Saccharomyces uvarum (Beijerinck) as a distinct species Huu-Vang Nguyen *, Claude Gaillardin Laboratoire de Microbiologie et Génétique Moléculaire, Collection de Levures dÕIntérêt Biotechnologique, INRA UMR1238 – CNRS UMR2585, INA-PG, Centre Versailles-Grignon, BP 01, F-78850 Thiverval-Grignon, France Received 15 July 2004; received in revised form 3 December 2004; accepted 3 December 2004 First published online 1 January 2005 Abstract Analysis of the nucleotide sequence of the GDH1 homologues from Saccharomyces bayanus strain CBS 380T and S. pastorianus strains showed that they share an almost identical sequence, SuGDH1*, which is a diverged form of the SuGDH1 from the type strain of the former species S. uvarum, considered as synonym of S. bayanus. SuGDH1* is close to but differs from SuGDH1 by the accumulation of a high number of neutral substitutions designated as Multiple Neutral Mutations Accumulation (MNMA). Further analysis carried out with three other markers, BAP2, HO and MET2 showed that they have also diverged from their S. uvarum counterparts by MNMA. S. bayanus CBS 380T is placed between S. uvarum and S. pastorianus sharing MET2, CDC91 sequences with the former and BAP2, GDH1, HO sequences with the latter. S. bayanus CBS 380T has been proposed to be a S. uvarum/S. cerevisiae hybrid and this proposal is confirmed by the presence in its genome a S. cerevisiae SUC4 gene. Strain S. bayanus CBS 380T, with a composite genome, is genetically isolated from strains of the former S. uvarum species, thus justifying the reinstatement of S. uvarum as a distinct species. 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: Saccharomyces bayanus; Saccharomyces uvarum; Saccharomyces pastorianus; Taxonomy; GDH1; MET2; BAP2 1. Introduction Within the Saccharomyces sensu stricto species, the Saccharomyces pastorianus taxon includes strains isolated from beer and initially considered as distinct species, such as S. carlsbergensis, S. monacensis and all lager brewing strains. S. pastorianus strain CBS 1513 (S. carlsbergensis) was thought to be a hybrid between S. cerevisiae and either S. bayanus, based on DNA/ DNA relatedness [1], or strain CBS 1503 (S. monacen* Corresponding author. Tel.: +33 1 30815924; fax: +33 1 30815457. E-mail address: [email protected] (H.-V. Nguyen). sis), based on sequences of MET2 or ACB1 genes [2,3]. Later work has shown that strain CBS 1503 is itself a hybrid [4,5] and brought again S. bayanus close to S. pastorianus because they share common chromosomes or genes [6–8]. The S. bayanus taxon is complex and includes several synonym species [1]; molecular analyses [9,10] have divided S. bayanus strains into two subgroups: (1) a prevalent strain group encompassing strains similar to the former species S. uvarum Beijerinck, typified by strain CBS 395T [11]; (2) a minor group with strain S. bayanus CBS 380T and a few ancestral strains. We have previously proposed that S. bayanus CBS 380T should be 1567-1356/$22.00 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.femsyr.2004.12.004 472 H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 considered as a hybrid between S. uvarum and S. cerevisiae, because several chromosomes of CBS 380T are isomorphic with S. uvarum chromosomes and because this strain carries the S. cerevisiae YÕ sequence [10]. Further molecular analysis by AFLP (Amplified Fragment Length Polymorphism) [12] has confirmed this proposal. RAPD (Random Amplified Polymorphism DNA) whole-genome analysis has placed S. bayanus CBS 380T outside of the S. uvarum strain group [13]. The hybrid nature of S. bayanus CBS 380T is also supported by its physiological profile, intermediate between that of S. uvarum and S. cerevisiae [14]. If S. pastorianus had resulted from hybridisation events between S. bayanus and S. cerevisiae, and if S. bayanus was itself a S. uvarum/S. cerevisiae hybrid, S. uvarum-specific sequences might be found in S. pastorianus. However, genome exploration carried out on partial gene sequences of S. uvarum and S. pastorianus has indicated only around 93% of sequence homology [5]. Therefore, there is a need to align the entire sequences of several markers to determine whether S. pastorianus sequences diverge from their S. uvarum homologues as a consequence of long adaptation of S. pastorianus to brewing conditions in the past. In this work we address this issue by comparing sequences of genes GDH1, MET2, BAP2 and HO in the principal strains of the complex S. uvarum, S. bayanus and S. pastorianus. Table 1 List of yeast strains employed CBS No. 395 CLIB No. Species names 251 (a) S. uvarum subgroup Type strain 377 S. intermedius var. turicensis S. bayanus S. bayanus (exS. uvarum) S. bayanus (ex S. uvarum) S. bayanus S. tubiformis S. abuliensis 426 111 398 2946 431 7001(1) (623-6c) 393 401 533 380 181 395 424 425 1505 250 255 254 1546 252 8614 8615 1462 2156 620 621 477 792 795 1538 (3) 537 281 1513 1503 176 180 1171 227 112 338 Initial names (b) S. bayanus Type strain (c) Saccharomyces hybrids (S. bayanus x S. cerevisiae) (S. uvarum x S. cerevisiae) (2) (2) Year of isolation Remarks Grappes 1898 Considered as synonym of S. bayanus Pear wine 1934 Honey Wine ? 1986 Cider 1971 ? Fermented pear juice M. adopersus ? ? 1978 Beer 1895 Derivative of CBS 7001 S. globosus S. heterogenicus S. intermedius var. valdensis S. inusitatus Pear juice Fermented apple juice Beer 1924 1924 1904 B19-3C derived from CBS 380 Synonym Synonym Synonym Beer 1965 Synonym S. pastorianus S. bayanus/pastorianus Cider Cider Wine Beer Beer 1924 1949 CID1 natural S6U natural H1 constructed Natural Natural Beer Beer 1895 ? Beer Beer 1908 1908 (d) S. pastorianus Neotype strain S. carlsbergensis S. monacensis (e) S. cerevisiae Type strain YNN295 (4) S288c Sources from CBS NRRL Y-1551 from ARS 1883 1978 (1) Known also as MCYC 623. (2) Hybrid determined in this study. (3) Not similar to CBS 1538 as generally admitted. (4) Standard strain for chromosome size determination. CBS: Centraalbureau voor Schimmelculture. CLIB: Collection de Levures dÕIntérêt Biotechnologique. ARS: Agricultural Research Service. H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 473 2. Materials and methods 2.2. PCR amplification and sequence analyses 2.1. Yeast strains and molecular techniques Deposited sequences and primers designed for PCR amplification in this work are listed in Table 2. Conditions for PCR were as follows: 4 min at 94 C followed by 30 cycles with 30 s at 94 C, 30 s at 45 C, 2 min at 72 C and a final elongation for 5 min at 72. The mixture contained 5 pmoles of each primer, 10 nmol of dNTP, 1 unit ExTaq (TaKaRa Bio Inc., Otsu, Shiga, Japan) and 25 ng of DNA from yeast strains in a final volume of 25 ll. These conditions were used throughout, except with higher Tm in some markers (Table 2). Direct sequencing of PCR fragments was carried out (Genome Express, Meylan, France). Sequences obtained were analysed with the Staden package [22] and the GCG Wisconsin package (Genetics Computer Group, Madison, WI, USA); they are deposited in the EMBL sequence database (AJ sequences, Table 3). Existing sequence resources of Saccharomyces were retrieved from the databases: SGD (http://genome-www.stanford.edu), NCBI (http://www.ncbi.nlm.nih.gov/) and Génolevures (http://cbi.labri.u-bordeaux.fr/genolevures). Strains used in this study are listed in Table 1. S. uvarum reference strains are CBS 395T (CLIB 251) and CLIB 533 (623-6c), an ura 3-1 mutant [15] selected from a monosporic culture issued from strain MCYC 623 (also deposited as CBS 7001). MCYC 623 and 623-6c have been used in three sequencing projects from which sequences were labelled S. bayanus [16–18]. Natural hybrids CID1 [19] and S6U [20] were from Piškur, and constructed hybrid (S. uvarum/S. cerevisiae) H1 was from Rainieri and co-workers [21]. Strains CBS 377, CBS 426, CBS 1462 and CBS 2156 are from H. Fukuhara, they were employed in this study after re-identification as S. uvarum or hybrids by PCR/RFLP of the MET2 or NTS2 marker and by karyotyping, followed by Southern blotting and hybridisation with S. cerevisiae ScGDH1 (Fig. 1). All other molecular techniques were as previously described [10]. Fig. 1. Detection of GDH1 in Saccharomyces strains. Left panels: Electrophoretic karyotypes of yeast strains stained with ethidium bromide. Right panels: Southern-blot hybridisation with ScGDH1 probe. (a) Strains: Y: YNN 295; H1: hybrid S. cerevisiae · S. uvarum; Ci: CID1; S6: S6U; Su: S. uvarum CBS 395T; C21: CBS 2156; Sc: S. cerevisiae S288c; P1: S. pastorianus CBS 1538NT; P2: S. pastorianus NRRL Y-1551; Sb: S. bayanus CBS 380T. Arrows indicate chromosomes carrying GDH1 of S. cerevisae and S. uvarum. (b) Strains: Ca: S. carlsbergensis CBS 1513; gl: S. globosus CBS 424; it: S. intermedius CBS 1505; he: S. heterogenicus CBS 425; in: S. inusitatus CBS 1546; C4: S. uvarum CBS 426; C14: CBS 1462; Mo: S. monacensis CBS 1503; Mc: CLIB 533 (623-6c). 474 H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 Table 2 Primers developed for amplification and sequencing of markers Marker/primers Sequence (5 0 –3 0 ) ScGDH1 ScgdhU ScgdhL ACAGTTAGGAGACCAAAAAG TGAACTTTCCTCTTTTCTTTC ScMET2 ScmetU ScmetL ACGTAGTATAAAAGGAATGTC AGGTATGTGTGGTATCTATC ScSUC2 Suc2U Suc2L TCCTTTTCCTTTTGGCTG TTCCCTTACTTGGAACTTGTC ScSUC4 Suc4U Suc4L Suc4F1 Suc4R1 TTAATGCAATCAGTGAGC AATTCCAGGTAACTGGG CACTCAATTCAGAGATCC GATCAATTCAGTCTCTGG SuGDH1 ORF SugdhU SugdhL SugdhF1 SugdhR1 SbgdhF1 SbgdhR1 GTACTACTCTACTATACCCG ACATCACCTTGGTCGAAC TCAAGAACTCTTTGACCG CAAACTTCACACCTTGAG AACGGTAAGGAATCCTTC CGGAAATGTATTGGACTTTG SuGDH1Pro SugPrU SugPrL CCTCGATCTGCTTATCGC GAAGAGACAACTTCATCGTAA SuGDH1 IGS SugIgU SugIgL GCCAAGAAGTACACTAAGG CTGTCGATGCTTTACAAAACT SuMET2 SumetU SumetL TAGTCACAGGGTCCATC CTGGTTTATATATGGGTATG SuBAP2 TatIgs SubapL BapUre BapInt AAAGTTTTTCAAGAGAATGGC GTTCAACACCAGAAAAGG GAAATAACCGATAACCAATGC GTTACGGACCCAAATTC SuCDC91 SucdcU SucdcL AAATACACTTGTTATTGGCTG GATCTTGAAGAGTGCTTTTTC Tm (C) Origins/sequencing primers 55 YOR375c 48 YNL277w 45 YIL162w 45 X07572 Internal primer Internal primer 45 Internal primers for S. uvarum Internal primers for S. bayanus/pastorianus 45 AJ418037 45 AJ418037 48 L16688 45 AB049008 PORF 852 Internal primer Internal primer 48 2.2.1. GDH1 gene of S. uvarum, S. bayanus CBS 380T and S. pastorianus strains The Génolevures project [16] provided genomic data from strain S. uvarum CLIB 533 (623-6c). Clone AS0AA004C04DP1 contains partially the homologue (Accession No. AL397636) of the S. cerevisiae GDH1 (ScGDH1) gene, encoding an NADP-linked glutamate dehydrogenase. This clone was sequenced entirely on both strands and aligned with ScGDH1 to delimit the GDH1 homologue in S. uvarum (SuGDH1) and to design three primer pairs to amplify the coding sequence (CDS) of SuGDH1 (SugdhU/SugdhL) and its up/downstream intergenic sequences IGS (SugPrU/SugPrL and SugIgU/SugIgL, respectively). These primers were used AJ418037 PORF 17213 to amplify and to sequence the GDH1 homologues, CDS and its up/down IGS from S. uvarum CBS 395T, CLIB 111, S. bayanus CBS 380T and S. pastorianus CBS 1503 and CBS 1513. 2.2.2. MET2, BAP2 and CDC91 of S. uvarum These markers were amplified and sequenced with the primers designed from the MET2 sequence (Accession No. L16688) of S. pastorianus. The BAP2 gene of S. uvarum (SuBAP2) and its upstream IGS were amplified and sequenced with primers TatIgs/SubapL developed from the two contiguous genes TAT1 (PORF 852 MIT_Sbay_c110_852) and BAP2 (Accession No. AB049008). H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 475 Table 3 Sequences determined or used in this study Species Strain numbers S. cerevisiaeNT S. uvarumT S. uvarum S. uvarum S. bayanusT S. bayanus S. pastorianusNT S. pastorianus ex S. carlsbergensis ex S. monacensis S. pastorianus S. pastorianus CLIB 227 = CBS 1171 CLIB 251 = CBS 395 CLIB 533 = 623-6c CLIB 398 CLIB 181 = CBS 380 CLIB 395 = B19-3C CLIB 537 = CBS 1538 CLIB 281 = Y-1551 CLIB 176 = CBS 1513 CLIB 180 = CBS 1503 M204 Unknown Genes GDH1 MET2 BAP2 AJ627640 AJ418037 AJ627874 AJ627639 AJ627638 AJ627876 AY144803 HO CDC91 SUC4 AJ627632 AJ627641 AJ627642 AJ627875 AJ627635 AB049009 AJ630206 AB027451 AJ627636 AJ627637 (*) AJ630207 NA AJ630208 NA NA AJ628136 AJ628137 AJ627633 AJ627634 L16688 AB049008 AB027450 AJ numbers are from EMBL database; other numbers are from GenBank. (*) Identical to L16688. NA, not amplifiable. 2.2.3. GDH1, MET2, SUC2 and SUC4 of S. cerevisiae The above S. cerevisiae markers were amplified and sequenced with primers based on the sequences available in the SGD database (Table 2). The GDH1 PCR fragment from strain S288c and the SUC4 PCR fragment from strain CBS 1171NT were used as probes in Southern-hybridisation experiments. 2.2.4. D1/D2 and NTS2 of ribosomal DNA The D1/D2 and NTS2 (Non Transcribed Sequence) of rDNA of several strains were amplified and sequenced using the primer NL1/NL4 [23] and the up/lower primers described in [10], respectively. 2.3. Phylogenetic inference based on GDH1 and MET2 coding sequences GDH1 and MET2 CDS of S. uvarum CBS 395T, S. bayanus CBS 380T and S. pastorianus sequenced in this work were aligned with their homologues from S. cerevisiae, S. paradoxus and S. pastorianus in databases using the Schizosaccharomyces pombe genes as outgroups. The phylogenetic trees were generated from the softwares at TreeTop-Phylogenetic Tree Prediction Service (http://www.genebee.msu.su/services/phtree_ reduced.html). GDH1 and GDH2, respectively, are located (Fig. 1(a), lanes Y and Sc). On chromosome blots of S. uvarum strains and S. bayanus CBS 380T (Fig. 1(a) and (b), lanes Su, Sb, C4 and Mc), the ScGDH1 probe hybridised with two chromosomes, the first one corresponding to S. uvarum chromosome 16, which has the same size as S. cerevisiae chromosome IV, and the second one to chromosome 10 [10]. In the hybrids, H1, CID1 and S6U the probe was detected at three positions: one at chromosome XV specific to S. cerevisiae, one at chromosome 10 specific to S. uvarum and one at the position corresponding to both S. cerevisiae chromosome IV and S. uvarum chromosome 16 (Fig. 1(a), lanes H1, Ci, S6). Strains CBS 2156 and CBS 1462 (Fig. 1(a), lane C21; 1B, lane C14) showed a GDH1 hybridisation profile similar to that of the hybrids, but two signals were detected at the position of chromosome XV, suggesting the presence of two copies of ScGDH1. In S. pastorianus strains, the ScGDH1 probe revealed two types of profile: the S. uvarum profile in strains CBS 1538NT, NRRL Y-1551 (Fig. 1(a), lanes P1, P2), and the hybrid profile in strains CBS 1503 (S. monacensis) and CBS 1513 (S. carlsbergensis) with, in this latter case, a fourth signal detected near the position of chromosome IV (Fig. 1(b), lanes Ca and Mo). The S. uvarum profile was also observed in the synonyms of S. bayanus: S. globosus, S. intermedius, S. heterogenicus and S. inusitatus (Fig. 1(b), lanes gl, it, he and in). 3. Results and discussion 3.1. Detection of GDH1 markers in Saccharomyces strains 3.2. Sequence comparison of GDH1 from S. uvarum, S. bayanus and S. pastorianus. Evidence of multiple neutral mutations accumulation The ScGDH1 (YOR375c) probe was first hybridised to the chromosome blots of several strains. Fig. 1 shows that in S. cerevisiae strains YNN 295 and S288c this probe hybridised to chromosomes XV and IV, where By using specific primers, ScGDH1 and SuGDH1 could be amplified from S. cerevisiae or S. uvarum strains (Fig. 2 lanes Sc, Su and C111). In S. bayanus CBS 380T only SuGDH1 was amplified. On the other 476 H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 Fig. 2. PCR amplification of ScGDH1 (upper panel) and SuGDH1 (lower panel). Strains: Sc: S. cerevisiae S288c; Su: S. uvarum CBS 395T; C111: S. uvarum CLIB 111; Sb: S. bayanus CBS 380T; Ca: S. carlsbergensis CBS 1513; Mo: S. monacensis CBS 1503; C14: CBS 1462; C21: CBS 2156. hand, both markers could be amplified in strain CBS 1503 (S. monacensis) and the hybrids CBS 1462 and CBS 2156 (Fig. 2, lanes Sb, Mo, C14 and C21). In strain CBS 1513 (S. carlsbergensis) only SuGDH1 could be amplified; ScGDH1, although evidenced by Southern hybridisation (Fig. 1), could not be amplified. For the S. pastorianus strains CBS 1538NT and NRRL Y-1551, only SuGDH1 was amplified (data not shown). Since hybridisation and PCR experiments suggested the presence of an S. uvarum GDH1 (SuGDH1) homologue in S. bayanus and S. pastorianus, sequencing of SuGDH1 PCR fragments was carried out. Alignment showed that there are two forms of this gene: the SuGDH1 form and its diverged form SuGDH1*. The SuGDH1 CDS, 1365 bp, and its up/downstream IGS (420 and 313 nucleotides, respectively) were identical in S. uvarum type strain CBS 395T (AJ627640), strains CLIB 111 and CLIB 533 (AJ418037). This sequence is identical to that in database (WashU_Sbay_Contig 673-22, MIT_Sbay_C773 PORF 24096) with strain sequences of 623-6c and MCYC 623 [16,17]. Four other S. uvarum strains of different origins: CBS 377, CBS 426, CBS 2946 and CLIB 398, exhibited also SuGDH 1 CDS. From S. bayanus CBS 380T the GDH1 sequence obtained was designated as SuGDH1* because it presented 97% nucleotide identity with SuGDH1 over the CDS, while the up/downstream IGS presented only 86% nucleotide identity due to several indels. Alignment of SuGDH1/SuGDH1* CDS showed that they differ by 42 nucleotides, of which 39 were silent substitutions, 36 at the third position of the corresponding codons and three corresponding to different leucine codons: CTA(+481) to TTG and TTG(+1123) to CTG. Three other substitutions resulted in predicted functionally similar amino-acid changes: ACA(+499) to TCA (S to T) and GTC(+790) to ATT (V to I). The nucleotide sequences were thus 97% identical, while the deduced amino-acid sequences were 99.6% identical. Thus the SuGDH1* in S. bayanus CBS 380T is apparently the diverged form of SuGDH1, identical in several S. uvarum strains. In the case of S. pastorianus strains, SuGDH1* was found in strain NRRL Y-1551; or with one substitution: in strain CBS 1513 (S. carlsbergensis), T306 replaced C (silent), while in strains CBS 1538NT and CBS 1503 (S. monacensis), G89 was replaced by A, resulting in a R(AGA) to K(AAA) change. The pair SuGDH1/SuGDH1* indicates a 3% genetic distance separating S. bayanus/pastorianus from S. uvarum. This distance is less than that which separates two sibling species such as S. cerevisiae and S. paradoxus whose GDH1 homologues differ by 6%, presenting 84 substitutions of which 61 are silent (http://genome-www4.stanford.edu/). On the other hand, SuGDH1 and ScGDH1 CDS differ by 11%. The deduced 454 amino-acid sequence from SuGDH1 showed 95% identity with that of ScGDH1. The ancient species classified as synonyms of S. bayanus: S. globosus CBS 424, S. heterogenicus CBS 425, S. intermedius var. valdensis CBS 1505 and S. tubiformis CBS 431, carry the SuGDH1 sequence (except for one silent substitution in S. globosus CBS 424). In contrast, the species S. inusitatus CBS 1546 carries the SuGDH1* allele. Thus the SuGDH1 CDS is conserved in S. uvarum strains while its diverged form SuGDH1* is present in S. bayanus CBS 380T, S. inusitatus CBS 1546 and S. pastorianus. Hence the SuGDH1* in these species has diverged from SuGDH1 by the accumulation of a number of neutral mutations, termed Multiple Neutral Mutations Accumulation (MNMA), far more than the natural polymorphism. 3.3. GDH1 alleles of S. uvarum and S. cerevisiae in the hybrids In the S. uvarum/S. cerevisiae constructed hybrid H1 or in S6U (CBS 8615) and CID1 (CBS 8614), considered as natural S. bayanus/S. cerevisiae hybrids, the ScGDH1 allele was unchanged, while the SuGDH1 sequence was unchanged in H1 and S6U or with one silent substitution in CID1. CBS 8615 (S6U) and CBS 8614 (CID1) are thus redefined as hybrids between S. uvarum and S. cerevisiae. Strains CBS 1462 and CBS 2156 were recognised as hybrids because the former carries the combination ScGDH1/SuGDH1 while the latter carries the combination ScGDH1/SuGDH1*. All the comparisons of SuGDH1/ScGDH1 sequences in Saccharomyces strains are shown in Table 4. Table 4 Sequence variation in S. bayanus/pastorianus compared with S. uvarum and S. cerevisiae Species/strain number Markers SuGDH1 %, Sn Sub ScGDH1 SuMET2 % %, Sn ScMET2 Sub %, Sn SuHO Sub %, Sn SuBAP2 Sub %, Sn SuCDC91 Sub %, sn SuD1/D2 Sub %, Sn SuNTS2 Sub %, Sn 1365 1365 1461 1461 1761 1830 1185 Reference sequences: AJ1627640 YOR375c AJ1627638 YNL277w E08858 AJ1627876 AJ630206 AJ279065 AJ243219 100 100 A A A A A A A 100 100 100 100 A A A A A A A Nd Nd Nd Nd Nd Nd 100 100 100 100 100 100 100 100 100 100 100 100 100 100 (b) (b) (b) (b) 89% (c) 100 A A Lg-BAP2 (d) Nd AJ630207 Nd AF113892 Nd 5/5 A Nd Lg-BAP2 (e) Nd Nd 89% (c) S. uvarum CBS 395T/CLIB 251 CBS 377 CBS 426 CLIB 111 CLIB 398 CBS 2946/CLIB 393 CLIB 533/623-6c S. bayanus CBS 380T/CLIB 181 B19-3C/CLIB 395 S. globosus CBS 424/CLIB 250 S. heterogenicus CBS 425/CLIB 255 S. intermedius CBS 1505/CLIB 254 S. inusitatus CBS 1546/CLIB 252 S. pastorianus CBS 1538NT/CLIB 537 syn S. carlsbergensis CBS 1513/CLIB 176 1/1 100 2/2 100 100 SuGDH1* SuGDH1* 36/42 36/42 A A 1/1 A 7/7 100 100 100 100 76/96 (a) 1/1 1 89% (c) 89% (c) 100 A SuMET2* 74/91 A Nd Lg-BAP2 (e) Nd Nd Nd 100 A SuMET2* 74/91 A Nd Lg-BAP2 (e) Nd Nd Nd A Nd Nd Nd Nd Nd Nd Nd NA AF113893 1 89% (c) 76/96 (a) Lg-BAP2 NA AF113893 1 89% AJ243214 76/96 (a) Lg-BAP2 NA AF113893 1 LgBAP2 AJ630208 AF113893 1 89% AJ243215 89% (c) SuGDH1* 36/42 A SuMET2* 74/93 SuGDH1* 36/43 A SuMET2* 74/91 4/5 SuGDH1* 37/43 NA SuMET2* 74/91 4/5 syn S. monacensis CBS 1503/CLIB 180 SuGDH1* 36/43 100 SuMET2* 74/91 NRRLY-1551/CLIB 281 SuGDH1* 36/42 A 100 Hybrids CBS 8614/CLIB 620; CID1 CBS 8615/CLIB 621 S6U CBS1462/CLIB792 CBS2156/CLIB795 H1 1/1 100 PCR/P PCR/P 100 100 PCR/P 100 100 SuGDH1* 100 36/42 A A 1/2 3/3 SuMET2* 100 74/91 PCR/E Nd 1/2 Nd Nd 3/3 Nd Nd Nd Nd Nd Nd 100 100 Nd Nd Nd 100 100 100 Nd 100 H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 CDS length (bp): Nd Nd Nd U44806 (Sc) mixte Sc/Su Nd Nd %: per cent of identity, Sn: sequence name. Sub: number of silent substitutions versus total. (a) Determined after alignment of the CDS from E08858 (S. uvarum) and from AB027451 (lager strain). (b) Identical AluI pattern with the NTS2 of S. uvarum CBS 395T. (c) 100% With the sequence NTS2 of strain CBS 1513 (AJ243214) and CBS 1503 (AJ243215). Nd, non-determined; A, absent; NA, not amplifiable. (d) Lg-BAP2 Accession No. AB049008. (e) Sequences determined in this study identical to Lg-BAP2. PCR/P: identified by PCR amplification of the MET2 partial gene and presence of PstI (P) site for S. uvarum (Su) or EcoRI (E) site for S. cerevisiae (Sc). 477 478 H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 3.4. MET2 gene of S. uvarum, S. pastorianus and S. bayanus CBS 380T Saccharomyces uvarum CBS 395T and S. bayanus CBS 380T exhibited a conserved SuMET2 CDS over 1461 nucleotides (Accession No. AJ627635, AJ627638). In five other S. uvarum strains only CLIB 398 presented SuMET2 with seven silent substitutions (AJ627875). On the other hand MET2 of CBS1513 (S. carlsbergensis) differs from SuMET2 by 91 nucleotide substitutions (93.7% identity), of which 74 are silent; nevertheless, the two deduced amino-acid sequences have 97% identity. As for the case of SuGDH1, this figure allows us to consider that S. pastorianus strains carry the diverged form of SuMET2 designated as SuMET2*. Comparatively, the MET2 of S. cerevisiae and that of S. paradoxus are separated by 127 substitutions of which 106 are silent (http://genome-www4.stanford.edu/). PCR/RFLP of the MET2 fragments from nucleotide +29 to +598 has been used to differentiate S. bayanus/S. uvarum from S. pastorianus [5,24], based on the presence or absence of a single restriction site: Pst restriction site identifies S. bayanus and S. uvarum strains while BamHI restriction site identifies S. monacensis and S. carlsbergensis. Sequence alignment indicated that the PstI site in SuMET2 at nucleotide +230 was absent from SuMET2* Fig. 3. Sequence changes in the SuMET2 alleles. Partial alignment of the SuMET2 ORF from S. uvarum (SuMET2) and S. pastorianus (SuMET2*), showing nucleotide substitutions, the loss of one PstI site and the gain of one BamHI site (boxes) in SuMET2* from S. pastorianus. Underlined are the sequences of the primers used to amplify the MET2 partial gene for identification of Saccharomyces species. H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 due to a silent substitution (G to A). Similarly, the BamHI site is present in SuMET2* but absent from SuMET2 due to an identical substitution at nucleotide +481. Thus identification based on a single-site indicator does not reflect the relatedness of two species (see Fig. 3). 3.5. CDC91 conserved sequences in S. uvarum and S. bayanus CBS 380T The CDC91 homologue of S. cerevisiae (encoding a GPI-anchored transamidase component) was amplified and sequenced from S. uvarum CBS 395T, S. bayanus CBS 380T and strain NRRL Y-1551. The CDC91 sequences found in S. bayanus CBS 380T (Accession No. AJ630207) and strain NRRL Y-1551 are identical to the PORF 17213 or Sbay_contig617.3 from strain MCYC 623 and 623-6c, respectively. The CDC91 sequence of S. uvarum CBS 395T presented one neutral substitution (Accession No. AJ630206), while it could not be amplified from S. pastorianus strains. As for the SuMET2 gene, the CDC91 sequence indicated that NRRL Y-1551 is different from S. pastorianus CBS 1538NT but similar to CBS 380T and closely related to S. uvarum. Strain NRRL Y-1551 exhibits also similar electrokaryotypes with CBS 380T and S. uvarum CBS 395T (Fig. 1(a), lanes P2, Sb, Su). 3.6. BAP2 and HO sequences from S. uvarum, S. bayanus CBS 380T and S. pastorianus BAP2 encoding a branched-chain amino-acid permease and HO encoding the mating conversion endonuclease, were reported to be identical in S. bayanus CBS 380T and an S. pastorianus lager strain [7,8]. We amplified and sequenced an identical SuBAP2 from S. uvarum strains CBS 395T and CLIB 111. Alignment with the deposited Lg-BAP2 CDS revealed that, over 1830 nucle- 479 otides, there are 172 substitutions of which 104 are silent. The two CDS showed 90.2% identity both in nucleotide and in deduced amino-acid sequences. The HO gene from strain S. uvarum EKB103 (Accession No. E08858) was also compared with the Lg-HO from the lager strain KBY001 (Accession No. AB027450): the two CDS (1761 nucleotides) differed by 96 substitutions of which 76 were silent. In comparison, between two strains EKB103 and MCYC 623 (MIT_Sbay_c627_3117), HO presented six silent substitutions. Thus, compared with MET2 genes, the HO genes of S. uvarum and S. pastorianus presented almost the same number of substitutions but over a longer sequence. Lg-BAP2 and Lg-HO are thus diverged from their homologues in S. uvarum, SuBAP2 and SuHO by MNMA. 3.7. Confirmation of the hybrid nature of S. bayanus CBS 380T by the presence of the S. cerevisiae SUC4 sequence The presence of S. cerevisiae Y 0 , X and SUC2 sequence has previously been revealed by chromosomal blot in S. bayanus CBS 380T [5,10,25]. SUC genes are located at the telomeric regions in S. cerevisiae [26]. A SUC gene was indeed amplified and sequenced from S. bayanus CBS 380T, S. cerevisiae CBS 1171NT and from S. pastorianus strains, but it corresponds to the S. cerevisiae SUC4 gene. Hybridisation of the ScSUC4 amplified from strain CBS 1171NT with Southern-blotted electrokaryotypes revealed strong signals from three chromosomes of S. bayanus CBS 380T or its derivative B19-3C and from more chromosomes of S. pastorianus and S. cerevisiae strains S288C (Fig. 4). S. uvarum strains presented only a non-specific signal (Fig. 4, lanes Su and Mc). SUC4 nucleotide sequences from S. cerevisiae CBS 1171NT (Accession No. AJ826132) and S. bayanus Fig. 4. Probing of S. cerevisiae SUC4 gene to the chromosomes of Saccharomyces strains. Left panel: Karyotypes stained with ethidium bromide. Right panel: S. cerevisiae SUC4 probing. Strains: ST: S. cerevisiae CBS 1171T; Sc: S. cerevisiae S288c; Sb: S. bayanus CBS 380T; Bc: B19-3C derivative of CBS 380T; Su: S. uvarum CBS 395T; Mc: S. uvarum CLIB 533 (623-6c); Ca: S. carlsbergensis CBS 1513; Mo: S. monacensis CBS 1503. 480 H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 CBS 380T (Accession No. AJ826136) are almost identical with the X07572 sequence (positions 210–2488). Thus, S. bayanus CBS 380T carries the SUC4 gene, CDS and up/downstream IGS, originating from S. cerevisiae. An identical ScSUC4 CDS (Accession No. AJ826132) was also amplified and sequenced from S. pastorianus CBS 1538NT, S. carlsbergensis, S. monacensis and strain NRRL Y-1551. In strain CLIB 395 (B19-3C), a derivative of S. bayanus CBS 380T [27], the ScSUC4 sequence (Accession No. AJ826137) has a (C) insertion at position +100. 3.8. Conclusion As reported in bacteria, protein-encoding genes evolve more rapidly than rRNA genes [28]. In yeast, coding sequences (CDS) are more informative than intergenic sequences (IGS) to resolve closely related species [17]. In this study, GDH1, MET2, HO and BAP2 CDS served as basis for the elucidation of phylogenetic relations for S. uvarum and S. bayanus on the one hand and, interestingly, between S. uvarum and S. pastorianus on the other hand (Fig. 5). In the hybrids S. bayanus and S. pastorianus, sequence divergence is significant, but still less than that observed between closely related Saccharomyces sibling species that are thought to have diverged millions of years ago. Thus S. bayanus and S. MET2 S. cerevisiae S. paradoxus S. uvarum S. bayanus S. monacensis S. carlsberg. 0.1 Sch. pombe S. cerevisiae GDH1 pastorianus have diverged from S. uvarum recently. The GDH1 gene having few divergences indicates clearly the relatedness between S. bayanus and S. pastorianus with S. uvarum. The same relatedness can be seen with the MET2, HO, and to a lesser extent, with the BAP2 gene. All the markers used are dispersed among five S. cerevisae chromosomes and probably in the same number of S. uvarum chromosomes because of the high synteny (97%) between these two species [29]. This leads us to interpret that these divergences reflected a recent evolution from S. uvarum to S. bayanus CBS 380T and S. pastorianus rather than the results of lateral transfers of several markers. In the hybrid genome context, sequence comparison suggested that SuGDH1 and SuMET2 had evolved gradually but independently, because several strains carried both SuMET2*/ SuGDH1*, but there were also combinations of either SuMET2/SuGDH1* as in strains S. bayanus CBS 380T, NRRL Y-1551 or SuMET2*/SuGDH1 as in strains CBS 425 and CBS 1505. This evolution is not observed with the hybrids CID1, S6U and CBS 1462, they carry sequences identical with S. uvarum as does the hybrid H1, recently constructed. Based on the sequences of GDH1 and MET2, a phylogenetic relationship between S. uvarum and S. pastorianus was established (Fig. 5). Taking all the data together, a plausible scheme is proposed to explain the evolution relationships between S. uvarum, S. bayanus and S. uvarum, S. pastorianus (Fig. 6). S. paradoxus S. uvarum S. bayanus S. carlsberg. S. monacensis Sch. pombe 0.1 Fig. 5. Phylogenetic trees established by multiple alignment of GDH1 (top) and MET2 (bottom) CDS determined in this study or from databases. The MET2 and GDH1 homologues of Sch. pombe are extracted from deposited sequences (AL023288 and AL033127). 3.8.1. S. uvarum strains form a homogeneous cluster; S. bayanus CBS 380T is genetically isolated from S. uvarum As previously demonstrated, S. uvarum strains form a cluster: similar and characteristic karyotypes have been obtained with S. uvarum isolates [10,30–32]. PCR/RFLP of NTS2 (rDNA) by AluI [9,10] and of MET2 by PstI [24] suggested that they share these same sequences. Sequence conservation in BAP2, CDC91, GDH1, HO and MET2 in many strains, identical D1/D2 sequences in different isolates (Table 4) [33] have demonstrated their genetic uniformity. Genetic inter-fertility between strain 623-6c, a derivative of MCYC 623, used as tester and all strains characterized as S. bayanus (ex S. uvarum) have demonstrated full genetic exchange between them [30]. All S. uvarum strains share common physiological characteristics: they are all Gal+, Mel+ and psychrotrophic (the growth is inhibited above 35 C). Until now S. bayanus CBS 380T and S. uvarum have been considered as conspecific because high DNA/DNA homology, but S. bayanus CBS 380T shares with S. uvarum common genes such as MET2 and CDC91 and diverged ones such as GDH1, BAP2 and HO together with S. cerevisiae Y 0 and SUC4 sequences, a status corresponding to a hybrid S. uvarum/S. cerevisiae. Therefore CBS 380T is no longer conspecific with S. uvarum. H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 S. uvarum S. uvarum derivatives S. cerevisiae 481 S. paradoxus S. bayanus CLIB 398, CBS 424 CBS 2946…. CBS 380T NRRL Y-1551 S. pastorianus CBS 1538NT S. carlsbergensis CBS 1513T S. monacensis CBS 1503T confirmed route hypothetic route Fig. 6. Possible routes of evolution from S. uvarum to S. bayanus and S. pastorianus as suggested by sequence analysis. 3.8.2. Reinstatement of S. uvarum as distinct species Rossellö-Mora and Amann [34] have proposed the following phylo-phenetic species concept for prokaryotes: ‘‘The species could be described as a monophyletic and genomically coherent cluster of individual organisms that show a high degree of overall similarity in many independent characteristics, and is diagnosable by a discriminative phenotypic property’’. This concept is entirely applicable to S. uvarum strains. They all share the same genetic and physiological characters defining a clade, allowing genetic exchange by inter-fertility and identifiable by a set of common characters. Therefore,we propose the reinstatement of S. uvarum Beijerinck as a distinct species, abolishing its current status as synonym of S. bayanus. In the reinstated S. uvarum taxon the Type strain is CBS 395. The former species S. abuliensis Santa Maria (CBS 7001T), S. intermedius E.C. Hansen var. turic- ensis Osterwalder (CBS 377T) and S. tubiformis Osterwalder (CBS 431T) are synonyms, while S. globosus Osterwalder (CBS 424T) and S. intermedius E.C. Hansen var. valdensis Osterwalder (CBS 1505T) are derivative strains (Table 5). S. inusitatus van der Walt (CBS 1546T) is reclassified as S. pastorianus. The name S. bayanus is retained for designation of partial hybrids S. uvarum/S. cerevisiae similar to strain CBS 380T, such as strain NRRL Y-1551 and S. heterogenicus Osterwalder (CBS 425T). The name S. bayanus var. uvarum (nomen invalidum) used by some authors to designate strains of S. uvarum species is no longer valid. The group Saccharomyces sensu stricto defined by Vaughan-Martini and Kurtzman [1] is thus redefined, it contains three sibling species S. cerevisiae, S. paradoxus, S. uvarum, and the hybrids between S. cerevisiae and S. uvarum, classified either as S. bayanus or as S. pastorianus. Table 5 Reclassification of S. uvarum, S. bayanus and S. pastorianus strains Old epithets Strain numbers Proposed names Status S. uvarum var. uvarum S. abuliensis S. abuliensis (derivative) S. intermedius var. turicensis S. tubiformis S. globosus S. bayanus CBS 395 CBS 7001 (a) CLIB 533 (b) CBS 377 CBS 431 CBS 424 CBS 2946 Saccharomyces uvarum S. uvarum S. uvarum S. uvarum S. uvarum S. uvarum S. uvarum Type strain Synonym Mutant Synonym Synonym Derivative Derivative S. S. S. S. S. CBS 380 B19-3C NRRL Y-1551 CBS 425 CBS 1505 Saccharomyces bayanus S. bayanus S. bayanus S. bayanus S. bayanus Type strain Mutant CBS 1546 Saccharomyces pastorianus Synonym bayanus bayanus pastorianus heterogenicus intermedius var. valdensis S. inusitatus Synonym (c) Derivative (d) (a) Also designated as MCYC 623 in the MIT sequencing project [18]. (b) Derivative of CBS 7001 designated as 623-6c. Used in the Genolevures and Washington University sequencing projects [16,18]. (c) Presence of S. cerevisiae Y 0 [10]. (d) Complex NTS2 AluI pattern [9,10]. 482 H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 3.8.3. S. pastorianus contains genetic material from more than one S. uvarum derivative In S. pastorianus several genes, GDH1 or MET2, originating from S. cerevisiae, are well-conserved while the S. uvarum homologues have undergone divergence: SuGDH1*, SuMET2*, Lg-HO and Lg-BAP2. As S. uvarum has previously been classified as synonym of S. bayanus, the proposal of Vaughan-Martini and Kurtzman [1] is still validated. Recent studies using chromosomal or AFLP analysis [5,12] and gene sequences [7,8] have supported this proposal. As can be observed, SuGDH1*, SuMET2*, Lg-HO and Lg-BAP2 sequences diverged independently, suggesting that they may have been brought over by one or two different contributors, possibly by rare-mating which has been shown possible with several hybrids [12]. One of the contributors may be S. bayanus strains CBS 380T or NRRL Y-1551. However, proteome data correlate strain NRRL Y-1551 and CBS 380T with S. pastorianus: 69% of the proteins of the former and 35% of the proteins of the latter co-migrate with lager strain proteins in a 2D electrophoresis system [4]. Other S. uvarum derivatives such as strains CBS 424 and CBS 2946 (Table 4) may also be possible contributors. Further work will be necessary to designate precisely the partner(s) of S. cerevisiae in the composite genome of S. pastorianus. Acknowledgements We thank Dr. H. Fukuhara for providing us the CBS strains of his personal collection; Dr. J. Piskur for the gift of the CID1 and S6U natural hybrids; Dr. S. Rainieri for the H1 hybrid and its parent strains. N.H.V. is very indebted to C.R. Tinsley (INA-PG) for helpful discussion and language corrections of the manuscript; Dr. C. Neuvéglise for her help during the sequencing of the clone AS0AA004C04. [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] References [18] [1] Vaughan-Martini, A. and Kurtzman, C.P. (1985) Deoxyribonucleic acid relatedness among species of Saccharomyces sensu stricto. Int. J. Syst. Bacteriol. 35, 508–511. [2] Hansen, J. and Kielland-Brandt, M.T. (1994) Saccharomyces carlsbergensis contains two functional MET2 alleles similar to homologues from S. cerevisiae and S. monacensis. Gene 140, 33– 40. [3] Borsting, C. (1997) Saccharomyces carlsbergensis contains two functional genes encoding the Acyl-CoA binding protein, one similar to the ACB1 gene from S. cerevisiae and one identical to the ACB1 gene from S. monacensis. Yeast 13, 1409–1421. [4] Joubert, R., Brignon, P., Lehman, C., Monribot, C., Gendre, F. and Boucherie, H. (2000) Two-dimensional gel analysis of the proteome of lager brewing yeasts. Yeast 16, 511–522. [5] Casaregola, S., Nguyen, H.V., Lapathitis, G., Kotyk, A. and Gaillardin, C. (2001) Analysis of the constitution of the beer yeast [19] [20] [21] [22] genome by PCR, sequencing and subtelomeric sequence hybridization. Int. J. Syst. Evol. Microbiol. 51, 1607–1618. Yamagishi, H. and Ogata, T. (1999) Chromosomal structures of bottom fermenting yeasts. Syst. Appl. Microbiol. 22, 341–353. Kodama, Y., Omura, F. and Ashikari, T. (2001) Isolation and characterization of a gene specific to lager brewing yeast that encodes a branched-chain amino acid permease. Appl. Environ. Microbiol. 67, 3455–3462. Tamai, Y., Tanaka, K., Uemoto, N., Tomizuka, K. and Kaneko, Y. (2000) Diversity of the HO gene encoding an endonuclease for mating-type conversion in the bottom fermenting yeast Saccharomyces pastorianus. Yeast 16, 1335–1343. Nguyen, H.V. and Gaillardin, C. (1997) Two subgroups within the Saccharomyces bayanus species evidenced by PCR amplification and restriction polymorphism of the non-transcribed spacer 2 in the ribosomal DNA unit. Syst. Appl. Microbiol. 20, 286–294. Nguyen, H.V., Lépingle, A. and Gaillardin, C. (2000) Molecular typing demonstrates homogeneity of Saccharomyces uvarum and reveals the existence of hybrids between S. uvarum and S. cerevisiae, including the S. bayanus type strain CBS 380. Syst. Appl. Microbiol 23, 71–85. van derWalt, J.P. (1970) Saccharomyces emend. Reess In: The Yeasts, a Taxonomic Study (Lodder, J., Ed.). North Holland Publishing Co., Amsterdam, pp. 555–718. de Barros Lopes, M., Bellon, J.R., Shirley, N.J. and Ganter, P.F. (2002) Evidence for multiple interspecific hybridization in Saccharomyces sensu stricto species. FEMS Yeast Res. 1, 323–331. Fernandez-Espinar, M.T., Barrio, E. and Querol, A. (2003) Analysis of the genetic variability in the species of the Saccharomyces sensu stricto complex. Yeast 20, 1213–1226. Rainieri, S., Zambonelli, C., Hallsworth, J.E., Pulvirenti, A. and Giudici, P. (1999) Saccharomyces uvarum: a distinct group within Saccharomyces sensu stricto. FEMS Microbiol. Lett. 177, 177– 185. Bon, E., Neuvéglise, C., Casaregola, S., Artiguenave, F., Wincker, P., Aigle, M. and Durrens, P. (2000) Genomic exploration of the hemiascomycetous yeasts: 5. Saccharomyces bayanus var. uvarum. FEBS Lett. 487, 37–41. Souciet, J.-L., Aigle, M., Artiguenave, F., Blandin, G., BolotinFukuhara, M., Bon, E., Brottier, P., Casaregola, S., de Montigny, J., Dujon, B., Durrens, P., Gaillardin, C., Lépingle, A., Llorente, B., Malpertuy, A., Neuvéglise, C., Ozier-Kalogéropoulos, O., Potier, S., Saurin, W., Tekaia, F., Toffano-Nioche, C., Wésolowski-Louvel, M., Wincker, P. and Weissenbach, J. (2000) Genomic exploration of the hemiascomycetous yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487, 3–12. Cliften, P., Sudarsanam, P., Desikan, A., Fulton, L., Fulton, B., Majors, J., Waterston, R., Cohen, B.A. and Johnston, M. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301, 71–76. Kellis, M., Patterson, N., Endrizzi, M., Birren, B. and Lander, E.S. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423, 241–254. Masneuf, I., Hansen, J., Groth, C., Piškur, J. and Dubourdieu, D. (1998) New hybrids between Saccharomyces sensu stricto yeast species found among wine and cider production strains. Appl. Environ. Microbiol. 64, 3887–3892. Groth, C., Hansen, J.and and Piškur, J. (1999) A natural chimeric yeast containing genetic material from three species. Int. J. Syst. Bacteriol. 49, 1933–1938. Zambonelli, C., Passarelli, P., Rainieri, S., Bertolini, L., Giudici, P. and Castellari, L. (1997) Technological properties and temperature response of interspecific Saccharomyces hybrids. J. Sci. Food Agric. 74, 7–12. Dear, S. and Staden, R. (1991) A sequence assembly and editing program for efficient management of large projects. Nucl. Acid Res. 19, 3907–3911. H.-V. Nguyen, C. Gaillardin / FEMS Yeast Research 5 (2005) 471–483 [23] Kurtzman, C.P. and Robnett, C.J. (1998) Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie v. Leeuwenhoek 73, 331–371. [24] Masneuf, I., Aigle, M. and Dubourdieu, D. (1996) Genetic determination of Saccharomyces cerevisiae and Saccharomyces bayanus species by PCR/RFLP analysis of the MET2 gene. J. I. Sci. Vigne Vin. 30, 15–21. [25] Naumov, G.I., Naumova, E.S., Lentto, R.A., Louis, E.J. and Korhola, M.P. (1992) Genetic homology between Saccharomyces cerevisiae and its sibling species S. paradoxus and S. bayanus: electrophoretic karyotypes. Yeast 8, 599–612. [26] Carlson, M., Celenza, J.L. and Eng, F.J. (1985) Evolution of the dispersed SUC gene family of Saccharomyces by rearrangements of chromosomes telomeres. Mol. Cell. Biol. 5, 2894–2902. [27] Ryu, S.-L., Murooka, Y. and Kaneko, Y. (1996) Genomic reorganization between two sibling yeast species, Saccharomyces bayanus and Saccharomyces cerevisiae. Yeast 12, 757–764. [28] Pidiyar, V.J., Jangid, K., Dayananda, K.M., Kaznowski, A., Gonzalez, J.M., Patole, M.S. and Shouche, Y.S. (2003) Phylogenetic affiliation of Aeromonas culicicola MTCC3249 based on gyrB gene sequence and PCR-amplicon sequence analysis of cytolytic enterotoxin gene. Syst. Appl. Microbiol. 26, 197–202. [29] Llorente, B., Malpertuy, A., Neuvéglise, C., de Montigny, J., Aigle, M., Artiguenave, F., Blandin, G., Bolotin-Fukuhara, M., [30] [31] [32] [33] [34] 483 Bon, C., Brottier, P., Casaregola, S., Durrens, P., Gaillardin, C., Lépingle, A., Ozier-Kalogéropoulos, O., Potier, S., Saurin, W., Tekaia, F., Toffano-Nioche, C., WésolowskiLouvel, M., Wincker, P., Weissenbach, J., Souciet, J.L. and Dujon, B. (2000) Genomic exploration of the hemiascomycetous yeasts: 18. Comparative analysis of chromosome maps and synteny with Saccharomyces cerevisiae. FEBS Lett. 487, 101–112. Naumov, G.I., Naumova, E.S. and Gaillardin, C. (1993) Genetic and karyotypic identification of wine Saccharomyces bayanus yeasts isolated in France and Italy. Syst. Appl. Microbiol. 16, 274–279. Kishimoto, M., Soma, E. and Goto, S. (1994) Classification of cryophilic wine yeasts based on electrophoretic karyotype, C+G content and DNA similarity. J. Gen. Appl. Microbiol. 40, 83– 93. Giudici, P., Caggia, C., Pulvirenti, A. and Rainieri, S. (1998) Karyotyping of Saccharomyces strains with different temperature profiles. J. Appl. Microbiol. 84, 811–819. Pulvirenti, A., Nguyen, H.-V., Caggia, C., Giudici, P., Rainieri, R. and Zambonelli, C. (2000) S. uvarum, a proper species within Saccharomyces sensu stricto. FEMS Microbiol. Lett. 192, 191– 196. Rossellö-Mora, R. and Amann, R. (2001) The species concept for prokaryotes. FEMS Microbiol. Rev. 25, 40–65.