Download Unit 6 review guide answers

Name:__________________________________
Block:________
DNA Strucure, History, and Replication Review
1. What is a nucleotide? What are the 3 parts?
The building blocks of DNA and RNA. 3 parts: 5 carbon sugar (deoxyribose for DNA, ribose
for RNA), phosphate group, nitrogenous bases
2. Give the 4 nucleotides found in DNA. Indicate their family and the structure of each family.
Pyrimidines: Thymine, Cytosine – 1 ring
Purines: Adenine, Guanine – 2 rings
3. How is DNA like a twisted ladder? What makes up the sides? The rungs? What holds the 2
sides together?
Nucleotides bond together to make ladder shape. Sides made of sugar + phosphate groups.
Rungs = nitrogenous bases. Sides held together with hydrogen bonds between the bases.
4. State Chargaff’s base pair rules. What is the complimentary strand to the following DNA
segment: AAATTCCGGAGCTTAACGGTA? A=T, C=G
TTTAAGGCCACGAATTGCCAT
5. When is DNA replicated? Why is DNA replication important?
Before cell divides into 2 equal parts. Each new cell needs all of the DNA information.
6. Give the 2 types of enzymes involved in DNA replication and their functions.
Helicase – breaks open the hydrogen bonds between the bases.
DNA Polymerase – brings in the new complementary nucleotides to make the new strands of
DNA.
7. Summarize the experiments/findings of the following scientists (from your notes and your
reading):
•
James Watson – Worked with Crick to determine structure of DNA
•
Francis Crick -see above
•
Edwin Chargaff – Determined the % of bases for each DNA molecule
•
Rosalind Franklin – xrays led to discovery of double helix shape
•
Alfred Hershey –N/A
•
Martha Chase –N/A
RNA, Transcription and Translation Review
1. What is the process by which the genetic code of DNA is copied into a strand of RNA?
transcription
2. What is a codon and what is its purpose? What does it code for?
A set of 3 consecutive bases that codes for 1 amino acid
3. What are some similarities and differences between RNA and DNA?
Both have phosphate groups and nitrogenous bases.
RNA – single stranded, 3 different types, bases = A, U, C, G, sugar = ribose, found in nucleus
and cytoplasm
DNA – double stranded, 1 type, bases = A, T, C, G, sugar = deoxyribose, found in nucleus
4. What is the process of decoding mRNA into a polypeptide chain? In other words, how does a
gene become protein?
translation
5. What is an anticodon and what is its purpose?
Found on tRNA, complements mRNA sequence codons, brings amino acids to ribosome
6.
1.
2.
3.
4.
What are the steps of transcription?
RNA polymerase opens DNA helix
RNA nucleotides combined to make RNA strand
RNA released from DNA
RNA leaves nucleus for cytoplasm
7. Where does transcription take place? Where does translation take place?
Transcription = nucleus; Translation = ribosome
8. What are the steps of translation?
mRNA binds with ribosome
tRNA brings amino acids based on anti-codon/codon sequence
peptide bonds form between amino acids, amino acid releases from tRNA
tRNA leaves ribosome, next tRNA comes into ribosome
At stop codon, polypeptide releases from ribosome and folds to form protein
9. What are the 3 types of RNA and what are their functions?
Messenger RNA – transcribes DNA code, takes to ribosome
Ribosomal RNA – part of the ribosome
Transfer RNA – brings amino acids to ribosomes
10. During transcription what is formed? During translation what is formed?
Transcription = copy of DNA segment = mRNA
Translation = polypeptide chain (protein)
11. How many codons specify 1 amino acid?
1 codon = 1 amino acid
12. What base is missing on RNA, & what other base replaces it?
Thymine only in DNA, replaced by Uracil
13. Uracil will pair with what other base on DNA?
Uracil = Adenine
14. Is RNA double or single stranded?
Single stranded
15. Which type of RNA copies DNA’s instructions in the nucleus?
mRNA
16. What does tRNA transport?
Amino acids
17. In what part of a cell are proteins made?
Ribosomes
18. What is RNA polymerase & tell its function.
Enzyme used to open DNA helix and combine RNA nucleotides to form into mRNA
19. Are both strands of DNA copied during transcription?
Only 1 strand is copied
20. As RNA polymerase moves along the DNA template strand, what is being added?
RNA nucleotides
21. What happens to the newly made mRNA molecule following transcription in the nucleus?
Leaves nucleus and moves to ribosome
22. How many different kinds of amino acids make up proteins?
20 Amino acids
23. Name the amino acid coded for by each of these codons:
a. UUA
b. AUU
c. UGU
d. AAA
leucine
isoleucine
cytosteine
lysine
e. GAG
f. UAA
Glutamic Acid Stop
24. What codon starts protein synthesis? What amino acid does the start codon always carry?
AUG
25. What codons stop protein synthesis?
UAG, UAA, UGA
26. What codon on mRNA would bind with these anticodons:
a. AAA
b. GGA
c. UAC
d. CGU
UUU
CCU
AUG
GCA
27. What type of bonds are the ones that attach amino acids to each other in a growing
polypeptide?
Peptide bonds