Download Envelope gene sequences encoding variable regions 3 and 4 are

Journal
of General Virology (1999), 80, 2639–2646. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Envelope gene sequences encoding variable regions 3 and 4
are involved in macrophage tropism of feline
immunodeficiency virus
Thomas W. Vahlenkamp,1 Anthony De Ronde,2 Nancy N. M. P. Schuurman,1 Arno L. W. van Vliet,1
Judith van Drunen,1 Marian C. Horzinek1 and Herman F. Egberink1
1
Virology Unit, Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 1,
3584 CL Utrecht, The Netherlands
2
Department of Human Retrovirology, Academic Medical Centre, Amsterdam, The Netherlands
The envelope is of cardinal importance for the entry of feline immunodeficiency virus (FIV) into its
host cells, which consist of cells of the immune system including macrophages. To characterize the
envelope glycoprotein determinants involved in macrophage tropism, chimeric infectious molecular clones were constructed containing envelope gene sequences from isolates that had been
propagated in peripheral blood mononuclear cells (PBMC). The progeny virus was examined for
growth in PBMC and bone marrow-derived macrophages and viruses with different replication
kinetics in macrophages were selected. Envelope-chimeric viruses revealed that nucleotide
sequences encoding variable regions 3 and 4 of the surface glycoprotein, SU, are involved in
macrophage tropism of FIV. To assess the biological importance of this finding, the phenotypes of
envelope proteins of viruses derived from bone marrow, brain, lymph node and PBMC of an
experimentally FIV-infected, healthy cat were examined. Since selection during propagation had to
be avoided, provirus envelope gene sequences were amplified directly and cloned into an
infectious molecular clone of FIV strain Petaluma. The viruses obtained were examined for their
replication properties. Of 15 clones tested, 13 clones replicated both in PBMC and macrophages,
two (brain-derived clones) replicated in PBMC only and none replicated in Crandell feline kidney
cells or astrocytes. These results indicate that dual tropism for PBMC and macrophages is a
common feature of FIV variants present in vivo.
Introduction
Feline immunodeficiency virus (FIV) is a lentivirus pathogen
of domestic cats. FIV infection is characterized by an
impairment of immune functions and a progressive depletion
of CD4+ T lymphocytes (Ackley et al., 1990 ; Pedersen et al.,
1987 ; Siebelink et al., 1990). Pathogenesis of FIV infection is
similar to that of human immunodeficiency virus (HIV)
infection in man, both leading to AIDS after an extended
asymptomatic period (Pedersen et al., 1987 ; Yamamoto et al.,
1988). In addition to CD4+ T cells, the tropism of FIV involves
Author for correspondence : Thomas Vahlenkamp. Present address :
Institute of Virology, Faculty of Veterinary Medicine, University of
Leipzig, An den Tierkliniken 29, D-04103 Leipzig, Germany.
Fax j49 341 9738219. e-mail vahlen!rz.uni-leipzig.de
0001-6297 # 1999 SGM
CD8+ T cells, CD21+ B cells, astrocytes, megakaryocytes and
monocytes\macrophages (Brunner & Pedersen, 1989 ; Dow et
al., 1992 ; English et al., 1993 ; Pedersen et al., 1987). Certain FIV
strains that were isolated from diseased cats also replicate in
cells of the Crandell feline kidney (CRFK) line (Miyazawa et al.,
1989 ; Nishimura et al., 1996 ; Phillips et al., 1990 ; Siebelink et
al., 1992 ; Yamamoto et al., 1988). It is not known whether the
phenotype of virus variants present in the asymptomatic phase
of FIV infection differs from the phenotype present in the
disease phase, as described in about 50 % of HIV-1-infected
individuals (Tersmette et al., 1989). Differences have been
found, however, between the infected cell populations at
different times : early after infection, CD4+ T cells are the
predominant cellular targets, and the proportion of infected
macrophages increases during the acute flu-like illness. In the
chronic stage, most infected cells are CD8+ T lymphocytes, B
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 05:45:40
CGDJ
T. W. Vahlenkamp and others
lymphocytes and macrophages (Beebe et al., 1994 ; Dean et al.,
1996 ; English et al., 1993).
The envelope glycoprotein plays a key role in the initial
virus–cell interaction, although other virus proteins may also
be involved. The tropism of FIV for CRFK cells has been
shown to be affected by the third variable (V3) region of the
surface glycoprotein, SU (Siebelink et al., 1995 ; Verschoor et
al., 1995), and by the ectodomain of the transmembrane (TM)
glycoprotein (Vahlenkamp et al., 1997). The V3 region also
contains a linear neutralization domain (de Ronde et al., 1994 ;
Lombardi et al., 1993). FIV was shown to use CXCR4 for cell
fusion and the V3 region was found to be involved in the
interaction (Willett et al., 1997 a, b). Although having a
different sequence, the V3 region of the viral envelope protein
of HIV-1 is also important for tropism, cytopathicity and virus
neutralization and is involved in the interaction with CCR5
and CXCR4, the main co-receptors used by the macrophagetropic and T cell-tropic HIV-1 isolates (Cao et al., 1993 ; Deng
et al., 1996 ; Dragic et al., 1996 ; Feng et al., 1996 ; Levy, 1993 ;
Wain-Hobson, 1996 ; Wild et al., 1993).
Macrophages play an important role in the immune system
as antigen-presenting cells (Beebe et al., 1994 ; Bendinelli et al.,
1995 ; Levy, 1993) and they are probably also involved in FIV
pathogenesis – by harbouring the virus and contributing to its
dissemination in the organism. Only a few studies have
addressed macrophage tropism (Beebe et al., 1994 ; Brunner &
Pedersen, 1989 ; Power et al., 1998) ; FIV was shown to be
present in peritoneal macrophages of cats infected with FIV
strain Petaluma for 6–18 months. Cultures of peritoneal
macrophages were found to be susceptible to infection with
this strain, which had been propagated on CRFK cells (Brunner
& Pedersen, 1989). By using in situ hybridization, Beebe et al.
(1994) showed that the dominant cell type that was infected
shifted from T lymphocytes to macrophages during the onset
of primary disease. The shift might be due to cytopathic
infection of T lymphocytes with subsequent selection of
macrophage-tropic variants (Beebe et al., 1994).
In an attempt to identify determinants of macrophage
tropism, we focused on the FIV envelope glycoprotein.
Chimeric infectious molecular clones derived from peripheral
blood mononuclear cells (PBMC)-tropic and macrophagetropic viruses were constructed and progeny virus was
examined for replication kinetics in macrophages and PBMC in
vitro. The V3 and V4 regions of the FIV SU glycoprotein were
indeed found to possess determinants involved in macrophage
tropism. In order to get an impression of the phenotype of
virus variants present in a persistently viraemic, experimentally
infected healthy cat, we constructed infectious molecular clones
by using envelope gene sequences derived directly from
tissues of different body compartments. By using this approach,
the tropism of variants present in vivo can be determined
without introducing possible errors due to in vitro selection.
Viruses derived from these clones were tested for their ability
to replicate in feline PBMC, bone marrow-derived macroCGEA
phages, primary astrocytes and CRFK cells. Our results indicate
that dual tropism for PBMC and macrophages is a common
feature of FIV variants present in vivo.
Methods
Cell culture. CRFK-HO6 cells were cultured in Dulbecco’s modified
Eagle’s medium (DMEM) supplemented with 5 % foetal calf serum (FCS).
Feline PBMC were maintained in Iscove’s medium supplemented with
200 U\ml recombinant interleukin-2 (Eurocetus), 2n5 µg\ml concanavalin
A and 10 % FCS. Bone marrow-derived macrophages were prepared as
described by Daniel et al. (1993) and cultured in Iscove’s medium
supplemented with 15 % Hyclone serum and 2 mM glutamine. Primary
astrocytes were obtained from newborn kittens, prepared essentially as
described by Dow et al. (1992) and tested for glial fibrillary acidic protein
positivity prior to infection. All culture media were supplemented with
100 µg\ml streptomycin and 100 IU\ml penicillin.
Tissues and virus isolates. Virus isolates were obtained from the
cerebrospinal fluid (CSF) and PBMC of a naturally FIV-infected cat that
showed signs of central nervous system involvement by co-cultivation of
uninfected feline PBMC. The virus isolates obtained (FIV-UT48), derived
from the CSF and PBMC, were stored at k80 mC. Both virus isolates
were used to infect feline PBMC and proviral DNA was isolated by using
the method described by Boom et al. (1990).
Tissues [bone marrow, brain (cortex, cerebellum), lymph node
(mandibularis)] and PBMC were obtained from an experimentally FIVUT48-infected cat (no. 330). The cat was infected and kept under
specified-pathogen-free conditions for more than 6 years, but did not
show any clinical symptoms. Proviral DNA was isolated from the tissues
and PBMC by using the method described by Boom et al. (1990).
Amplification and cloning of envelope gene sequences.
Gene sequences encoding the FIV envelope glycoprotein were amplified
by using primers with flanking 5h MluI (ACGCGT) and 3h SalI
(GTCGAC) restriction sites (underlined). Primer 217 consisted of the
nucleotide sequence 5h TAGACGCGTAAGATTTTTAAGATACTCTGATG 3h (nt 6512–6543 ; Talbott et al., 1989) and primer 259 consisted
of the sequence 5h CTTGTCGACTAAGTCTGAGATACTTCATCATTCCTCC 3h (nt 8861–8825). PCR was performed for 35 cycles by using
the Expand Long Template reaction mixture (Boehringer Mannheim).
Each cycle consisted of 1 min at 94 mC, 1 min at 55 mC and 2n5 min at
68 mC. The 50 µl reaction mixture contained 100 ng cellular DNA,
100 ng of each primer, 50 mM Tris–HCl (pH 9n2), 1n75 mM MgCl ,
#
14 mM (NH ) SO , 200 µM of each deoxynucleoside triphosphate and
%# %
0n75 µl of the enzyme mixture. Amplification products were analysed on
a 1 % agarose gel, purified from the gel by using a QIAquick kit (Qiagen)
and digested with the restriction enzymes MluI and SalI. After
preparative gel electrophoresis, the purified amplification products were
cloned into pPETENV. This vector is basically identical to Pet-14
(Olmsted et al., 1989) but lacks flanking DNA sequences. In addition,
pPETENV contains unique MluI and SalI restriction sites to allow
selective exchange of envelope gene sequences (Verschoor et al., 1995).
Exchange of envelope gene fragments. To construct envelopechimeric clones, the MluI–SalI fragments were first cloned into vector
pSH, a derivative of pSP73 containing MluI and SalI cloning sites
(Verschoor et al., 1995). Construction of chimeric clones 27\8 and 8\27
was performed by exchanging the MluI–NsiI (1293 bp) and NsiI–SalI
(1045 bp) fragments between the parent clones 8 and 27. The resultant
chimeric MluI–SalI fragments were subsequently cloned into pPETENV.
Sequence analysis confirmed that the fragment exchanges were performed correctly. Exchange of the V3–V4 region was performed
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 05:45:40
Macrophage tropism of FIV
Fig. 1. Schematic representation of the leader (L), surface (SU) and transmembrane (TM) envelope regions of the parental and
chimeric molecular clones. The restriction sites used for the exchange of the DNA fragments are indicated. Virus replication of
the corresponding envelope-chimeric viruses was determined by measuring p24 production in the culture supernatant by an
antigen-capture ELISA.
similarly, except that the XbaI–NsiI (602 bp) fragments were exchanged
between the parent clones 8 and 27, resulting in clones 8\27\8 and
27\8\27 (Fig. 1). Sequence analysis of the V3–V4 region was performed
by generating PCR fragments of the clones by using the primers T7-273
(5h TAATACGACTCACTATAGGGACCTAATCAAACATGTATGTGG 3h ; T7 sequence in italics ; FIV-specific part from nt 7265–7286) and
SP6-NsiI (5h ATTTAGGTGACACTATAGCTTTTGTCATATTGAAATGTAC 3h ; SP6 sequence in italics ; FIV-specific part from nt 7827–7806).
The PCR fragments were sequenced by using SP6 and T7 Taq dye
primers (Applied Biosystems) and the ThermoSequenase fluorescencelabelled primer cycle-sequencing kit (Amersham). The sequence products
were analysed on an automatic DNA sequencer (model 377 ; Applied
Biosystems). The sequences were aligned manually. Phylogenetic analysis
of the V3–V4 regions of the clones was performed by the neighbourjoining method of the TREECON program (Van de Peer & De Wachter,
1994) rooted at the FIV-Petaluma sequence. The distance matrix was
generated by Kimura’s two-parameter estimation (Kimura, 1980).
Bootstrap analysis was done after 100 replicates.
Transfection and infection experiments. Transfections were
performed using the Lipofectamine reagent (Life Technologies) following
the manufacturer’s instructions. DNA of the constructed molecular clones
was transfected into 1n25i10& CRFK-HO6 cells grown overnight in a
24-well plate. Fifty µl aliquots of DMEM without FCS and antibiotics
(DMEM−) were mixed with 0n5 µg DNA and with 2 µl Lipofectamine.
The two reagents were mixed and left at room temperature for 15 min.
CRFK-HO6 cells were rinsed with DMEM− and the 100 µl transfection
mixture was added to the cultures for 5 min. DMEM− (100 µl) was added
and cultures were incubated at 37 mC. After 4 h, 0n5 ml DMEM
supplemented with 5 % FCS and antibiotics was added and the cells were
incubated overnight. Cultures were rinsed with PBS and maintained in
DMEM with 5 % FCS and antibiotics. CRFK-HO6 cells were monitored
for p24 production by using an antigen-capture ELISA. For preparation of
cell-free virus stocks, the culture supernatant was harvested on day 5,
centrifuged, filtered (0n45 µm) and stored at k80 mC. Reverse transcriptase activity was determined as described by Pedersen et al. (1987)
and cultures of feline PBMC, macrophages and astrocytes were infected
with an equivalent of 5i10% c.p.m. Cultures were monitored at regular
intervals for antigen production by measuring p24 in the supernatant.
Results
Characterization of envelope gene sequences involved
in macrophage tropism
Molecular clones containing envelope gene sequences were
derived from a cat infected with isolate FIV-UT48. FIV isolates
had been obtained after co-cultivation of CSF and PBMC with
PBMC from uninfected cats. By using PCR, virus envelope
sequences were cloned into an FIV-Petaluma background and
the viruses obtained were examined for their replication
kinetics in cultures of PBMC and macrophages. For detailed
study, we selected clones 8 and 27 from PBMC cultures that
did not replicate in CRFK cells. As shown in Fig. 2 (a), both
clones replicated with similar kinetics in PBMC, virus antigen
being detectable in the supernatant from day 4 onwards.
However, the replication curves in macrophages were different.
In three independent experiments, virus replication of clone 8
could be measured from day 8 onwards, whereas virus antigen
in the supernatant of cultures infected with progeny of clone
27 was already detectable on day 4 (Fig. 2 b). In addition, the
slope of virus production against time was different for the two
viruses : clone 8 replicated slightly more slowly than clone 27.
Construction of envelope-chimeric clones
To identify virus determinants responsible for the different
phenotypes, we constructed envelope-chimeric clones ; a
schematic representation of the constructs derived from clones
8 and 27 is shown in Fig. 1. The MluI–NsiI fragment consisted
of a part of the envelope leader sequence and encoded the V2,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 05:45:40
CGEB
T. W. Vahlenkamp and others
(a)
1.75
1.50
A450
1.25
1.00
0.75
0.50
0.25
4
8
11
15
18
Time post-infection (days)
22
4
8
11
15
18
Time post-infection (days)
22
(b)
1.75
1.50
A450
1.25
1.00
0.75
0.50
0.25
Fig. 2. Replication kinetics of viruses derived from clones 8 ($), 27 (4),
8/27/8 (
) and 27/8/27 (>) in feline PBMC (a) and bone marrowderived macrophages (b). The experiments were repeated at least three
times. The results of one representative experiment are shown. Virus
antigen production was measured by p24 ELISA in the culture
supernatant.
V3 and V4 regions of the envelope glycoprotein. The
XbaI–NsiI gene fragment encoded the V3 and V4 regions of
the SU envelope glycoprotein. The results of the infection
experiments with progeny of these clones are also summarized
in Fig. 1. Virus derived from clone 8\27, with envelope genes
consisting of the MluI–NsiI fragment (1293 bp) of clone 8
and the NsiI–SalI fragment (1045 bp) of clone 27, replicated
similarly in PBMC and macrophages to virus from the parent
clone 8 and the corresponding virus derived from clone 27\8
replicated with similar kinetics to virus from clone 27.
Progeny of clone 8\27\8 [MluI–XbaI (602 bp) and NsiI–
SalI fragments (1045 bp) derived from clone 8 and XbaI–NsiI
fragment (691 bp) derived from clone 27] showed the same
replication kinetics as virus from the parent clone, 27. Virus
derived from the corresponding clone 27\8\27 showed the
same phenotype as virus derived from the parent clone, 8 (Fig.
2). These results indicated that the envelope gene sequence
encoding the V3–V4 region is involved in macrophage tropism
of FIV.
Sequence analysis of the envelope gene fragment
The MluI–SalI DNA fragments of clone 27 (lymphotropic
and macrophage tropic), 8 (lymphotropic with an impaired
capacity to replicate in macrophages) and 46 were sequenced
and the deduced amino acid sequences were analysed. Clone
46, which was derived from the CSF, was included because
CGEC
Fig. 3. Comparison of the deduced amino acid sequences of the XbaI–NsiI
fragments from clones 8, 27 and 46. Clone 27 is lymphotropic and
macrophage tropic whereas clones 8 and 46 are lymphotropic but have
only limited or absent ability to replicate in macrophages. Sequence
differences from clone 27, amino acid positions and the restriction sites
for XbaI and NsiI are indicated.
progeny virus replicated only in PBMC. Exchange of envelope
fragments derived from this clone did not result in replication
competent viruses, however. The amino acid sequences
encoded by the XbaI–NsiI fragments are shown in Fig. 3. The
amino acid changes between clone 27 and clone 8 present
within the V3 and V4 regions were lysine to arginine (K R)
at position 395, aspartic acid to glutamic acid (D E) at
position 409, isoleucine to valine (I V) at position 413,
proline to leucine (P L) at position 423, serine to threonine
(S T) at position 429, asparagine to threonine (N T) at
position 448, phenylalanine to leucine (F L) at position 452
and lysine to glutamic acid (K E) at position 478. When
comparing clone 46 with clone 8, two amino acid changes were
observed within the V3 region : arginine to lysine (R K) and
glycine to arginine (G R) at positions 395 and 397,
respectively. The P L change at position 423 resulted in the
appearance of a potential N-glycosylation site in clones 8 and
46. The T N change at position 448, introducing an
additional potential N-glycosylation site, was present in both
clones 27 and 46.
Cell tropism of infectious molecular clones derived
from different cat tissues
Tissue samples were obtained from a cat infected for 6
years with the FIV-UT48 isolate. Fifteen infectious molecular
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 05:45:40
Macrophage tropism of FIV
Table 1. Replication of FIV clones derived from different tissues
Virus replication was determined by measuring p24 production in the culture supernatant by an antigencapture ELISA. , Not done.
Replication in :
Tissue
Clone
CFRK cells
PBMC
Macrophages
Astrocytes
Bone marrow
63
90
11
37
38
40
122
4
5
110
31
32
33
62
111
Pet
k
k
k
k
k
k
k
k
k
k
k
k
k
k
k
j
j
j
j
j
j
j
j
j
j
j
j
j
j
j
j
j
j
j
j
k
j
k
j
j
j
j
j
j
j
j
j
j


k
k
k
k
k
k
k
k
k
k
k
k
k
j
Brain
Lymph node
PBMC
pPet
clones were constructed (Table 1). Two clones contained
envelope gene sequences derived from the bone marrow
(63, 90), three clones were derived from the lymph node
(4, 5, 110) and five clones were isolated from each of
brain tissue (11, 37, 38, 40, 122) and PBMC (31, 32, 33,
62, 111). An infectious clone containing the envelope gene
sequence of FIV-Petaluma (pPet) with MluI and SalI restriction
sites was included as a positive control. Except for two clones
(37 and 40, which replicated in PBMC only) derived from the
brain, all clones replicated in PBMC and macrophages. None of
the 15 clones grew in either CRFK cells or astrocytes. The
Petaluma clone (pPet) replicated in all four cell-culture systems
tested.
The V3–V4 envelope gene regions of clones containing
envelope genes derived from different tissues of a cat infected
for 6 years with FIV-UT48 were sequenced. Analysis revealed
a close relatedness of these sequences and clones 27, 8 and 46
of the FIV-UT48 isolate. Differences were too small to show
significant bootstrap values. No amino acids or glycosylation
sites specific for the exclusively lymphotropic phenotype and
present only in the brain-derived clones 37 and 40 (Table 1)
and clone 46 could be identified.
Discussion
To characterize virus determinants involved in macrophage
tropism, we selected clones with different phenotypes derived
from PBMC-propagated FIV isolates : clone 8, which replicates
well in PBMC but poorly in macrophages, and clone 27, which
replicates well in both cell types. These clones differ de-
monstrably in their glycoprotein gene sequences and the
results obtained support the premise that determinants of
macrophage tropism are present on the virus envelope. The
construction of envelope-chimeric viruses revealed that the
V3–V4 region of the SU envelope glycoprotein is important
for macrophage tropism. The deduced amino acid sequence
obtained from these clones showed that a potential Nglycosylation site at position 448 within the lympho- and
macrophage-tropic clone 27 is shifted to position 422 in clone
8.
The exclusively lymphotropic clone 46 contains potential
N-glycosylation sites at both positions 422 and 448,
suggesting that glycosylation at position 422 does not favour
entry into macrophages. In HIV-1, glycosylation in the V3
region is involved in the binding of neutralizing antibodies, is
lost upon prolonged culture in a T cell line and is related to the
non-syncytium-inducing (NSI) versus syncytium-inducing (SI)
character of the virus isolate ; all this suggests a role in HIV-1
entry (Back et al., 1994). Our lymphotropic clone, 46, also
contained a glycine to arginine mutation at position 397, which
adds a positively charged amino acid to the V3 region. Within
the V3 region of HIV-1, basic amino acid substitutions or a loss
of acidic amino acids are correlated with the T cell-tropic
phenotype (Chesebro et al., 1992 ; De Jong et al., 1992 ;
Fouchier et al., 1992 ; Shioda et al., 1994 ; Simmonds et al.,
1991). The overall charge of the V3 region in clone 46 may
influence the interaction between the V3 region and a cellular
receptor.
The V3 region of the SU envelope glycoprotein and the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 05:45:40
CGED
T. W. Vahlenkamp and others
ectodomain of the TM envelope glycoprotein of FIV have
previously been shown to contain virus determinants for
CRFK cell tropism (Siebelink et al., 1995 ; Vahlenkamp et al.,
1997 ; Verschoor et al., 1995). These cell culture-adapted strains
of FIV use the chemokine receptor CXCR4 for cell fusion
(Willett et al., 1997 a, b, 1998, Poeschla & Looney, 1998). The
same chemokine receptor is used by T cell line-adapted SI HIV1 strains, while NSI macrophage-tropic strains make use of the
chemokine receptor CCR5 as second receptor (Deng et al.,
1996 ; Dragic et al., 1996 ; Feng et al., 1996). However, the
relationship between receptor usage and virus strains seems to
be complex, and several dual-tropic strains of HIV-1 have been
described (Doranz et al., 1996 ; Simmons et al., 1996).
Our genotypically and phenotypically characterized FIV
clones will be useful in the search for additional receptors and
in elucidating the mechanisms involved in the broader cell
tropism of FIV. The identification of determinants important
for macrophage tropism in the V3 and V4 regions indicates
evolutionary links between the basic entry mechanisms of FIV
and HIV-1. By comparing virus and cellular determinants
involved in cell tropism of FIV and HIV-1, factors responsible
for the similar pathogenesis of the two lentivirus infections
may be identified.
The limited or absent capacity of clones 8 and 46 to
replicate in macrophages could have been the result of their
previous propagation in and adaptation to PBMC. To exclude
this factor as a reason for the absence of macrophage tropism,
we decided to clone envelope genes directly from tissues of an
infected cat by PCR. We constructed 15 infectious molecular
clones with envelope genes derived directly from cat tissues
(bone marrow, brain, lymph node) and PBMC.
All viruses containing the envelope gene sequences from
PBMC, lymph node and bone marrow replicated in macrophages and PBMC. However, progeny of two (of five) clones
derived from the brain showed a different phenotype : they
replicated in PBMC only.
The amino acid sequences of the V3–V4 region differed
between all clones analysed. These clones are likely to differ at
positions in the remainder of the envelope as well, which does
not allow a direct comparison as could be done between the
envelope chimeras of clones 27 and 8 (Fig. 1). By comparing all
V3–V4 sequences, including clones 27, 8 and 46 from the first
set of experiments, we could not identify amino acid positions
or potential glycosylation sites in the V3–V4 region that were
specific for the exclusively lymphotropic phenotype. This
suggests that, rather than an individual amino acid, the
conformation of the whole envelope protein and in particular
of the V3–V4 region is responsible, as evidenced by the
chimeric clones 8 and 27.
Although unlikely, we cannot exclude PCR errors as the
explanation for the absence of macrophage tropism. The
phenotypes of these two clones are probably derived from
variants with a tropism for cells of the central nervous system.
None of the 15 clones replicated in primary feline astrocyte
CGEE
Fig. 4. Phylogenetic tree of a 417 bp fragment of the V3–V4 envelope
region of clones of the FIV-UT48 isolate (clones 27, 8 and 46) and clones
from different tissues of an FIV-UT48 infected cat. BM, Bone marrow ;
BR, brain ; LN, lymph node. The tree included the FIV-UT113 and FIV-PPR
sequences and was rooted at the FIV-Petaluma sequence (PET). Bootstrap
values above 70 % are shown.
cultures or CRFK cells. For primary HIV-1 isolates and
laboratory strains, tropism for macrophages and microglial
cells is highly overlapping (Watkins et al., 1990), but differences
in tropism for microglial cells and macrophages have also been
reported for some primary isolates (Strizki et al., 1996). Our
non-macrophage-tropic clones obtained from the brain may
therefore represent variants that preferentially infect microglial
cells and not macrophages. Interestingly, the envelope gene of
the exclusively lymphotropic clone 46 was derived from the
CSF isolate of FIV-UT48.
Our observations indicate that, within the FIV quasispecies,
variants occur that are exclusively lymphotropic, as also
shown in Fig. 4. The V3–V4 region of the envelope
glycoprotein contains determinants that influence this
difference in cellular tropism. Most variants, however, are dualtropic and infect both lymphocytes and macrophages.
The FIV-14 molecular clone of the Petaluma strain was obtained from
R. A. Olmsted through the AIDS Research and Reference Reagent
Program, Division of AIDS, NIAH NIH (pFIV-14 Petaluma). CRFK-HO6
cells were kindly provided by O. Jarrett, Glasgow, UK. This work was
supported by the Deutsche Forschungsgemeinschaft (DFG), Bonn,
Germany.
References
Ackley, C. D., Yamamoto, J. K., Levy, N., Pedersen, N. C. & Cooper,
M. D. (1990). Immunologic abnormalities in pathogen-free cats exper-
imentally infected with feline immunodeficiency virus. Journal of Virology
64, 5652–5655.
Back, N. K., Smit, L., De Jong, J. J., Keulen, W., Schutten, M., Goudsmit,
J. & Tersmette, M. (1994). An N-glycan within the human immuno-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 05:45:40
Macrophage tropism of FIV
deficiency virus type 1 gp120 V3 loop affects virus neutralization.
Virology 199, 431–438.
Beebe, A. M., Dua, N., Faith, T. G., Moore, P. F., Pedersen, N. C. &
Dandekar, S. (1994). Primary stage of feline immunodeficiency virus
infection : viral dissemination and cellular targets. Journal of Virology 68,
3080–3091.
Bendinelli, M., Pistello, M., Lombardi, S., Poli, A., Garzelli, C.,
Matteucci, D., Ceccherini-Nelli, L., Malvaldi, G. & Tozzini, F. (1995).
Feline immunodeficiency virus : an interesting model for AIDS studies
and an important cat pathogen. Clinical Microbiological Reviews 8,
87–112.
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van
Dillen, P. M. E. & van der Noordaa, J. A. (1990). Rapid and simple
method for purification of nucleic acids. Journal of Clinical Microbiology
28, 495–503.
Brunner, D. & Pedersen, N. C. (1989). Infection of peritoneal
macrophages in vitro and in vivo with feline immunodeficiency virus.
Journal of Virology 63, 5483–5488.
Cao, J., Bergeron, L., Helseth, E., Thali, M., Repke, H. & Sodroski, J.
(1993). Effects of amino acid changes in the extracellular domain of the
human immunodeficiency virus type 1 gp41 envelope glycoprotein.
Journal of Virology 67, 2747–2755.
Chesebro, B., Wehrly, K., Nishio, J. & Perryman, S. (1992).
Macrophage-tropic human immunodeficiency virus isolates from
different patients exhibit unusual V3 envelope sequence homogeneity in
comparison with T-cell-tropic isolates : definition of critical amino acids
involved in cell tropism. Journal of Virology 66, 6547–6554.
Daniel, S. L., Legendre, A. M., Moore, R. N. & Rouse, B. T. (1993).
Isolation and functional studies on feline bone marrow derived
macrophages. Veterinary Immunology and Immunopathology 36, 107–122.
Dean, G. A., Reubel, G. H., Moore, P. F. & Pedersen, N. C. (1996).
Proviral burden and infection kinetics of feline immunodeficiency virus in
lymphocyte subsets of blood and lymph node. Journal of Virology 70,
5165–5169.
De Jong, J. J., De Ronde, A., Keulen, W., Tersmette, M. & Goudsmit, J.
(1992). Minimal requirements for the human immunodeficiency virus
type 1 V3 domain to support the syncytium-inducing phenotype :
analysis by single amino acid substitution. Journal of Virology 66,
6777–6780.
Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., Di
Marzio, P., Marmon, S., Sutton, R. E., Hill, C. M., Davis, C. B., Peiper,
S. C., Schall, T. J., Littman, D. R. & Landau, N. R. (1996). Identification
of a major co-receptor for primary isolates of HIV-1. Nature 381,
661–666.
de Ronde, A., Stam, J. G., Boers, P., Langedijk, H., Meloen, R.,
Hesselink, W., Keldermans, C. E. J. M., van Vliet, A. L. W., Verschoor,
E. J., Horzinek, M. C. & Egberink, H. F. (1994). Antibody response in
cats to the envelope proteins of feline immunodeficiency virus :
identification of an immunodominant neutralization domain. Virology
198, 257–264.
Doranz, B. J., Rucker, J., Yi, Y., Smythz, R. J., Samson, M., Peiper,
S. C., Parmentier, M., Collman, R. G. & Doms, R. W. (1996). A dual-
tropic primary HIV-1 isolate that uses fusin and the beta-chemokine
receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 85,
1149–1158.
Dow, S. W., Dreitz, M. J. & Hoover, E. A. (1992). Feline immunodeficiency virus neurotropism : evidence that astrocytes and microglia are
the primary target cells. Veterinary Immunology and Immunopathology 35,
23–35.
Dragic, T., Litwin, V., Allaway, G. P., Martin, S. R., Huang, Y.,
Nagashima, K. A., Cayanan, C., Maddon, P. J., Koup, R. A., Moore,
J. P. & Paxton, W. A. (1996). HIV-1 entry into CD4+ cells is mediated
by the chemokine receptor CC-CKR-5. Nature 381, 667–673.
English, R. V., Johnson, C. M., Gebhard, D. H. & Tompkins, M. B.
(1993). In vivo lymphocyte tropism of feline immunodeficiency virus.
Journal of Virology 67, 5175–5186.
Feng, Y., Broder, C. C., Kennedy, P. E. & Berger, E. A. (1996). HIV-1
entry cofactor : functional cDNA cloning of a seven-transmembrane, G
protein-coupled receptor. Science 272, 872–877.
Fouchier, R. A. M., Groenink, M., Kootstra, N. A., Tersmette, M.,
Huisman, H. G., Miedema, F. & Schuitemaker, H. (1992). Phenotype-
associated sequence variation in the third variable domain of the human
immunodeficiency virus type 1 gp120 molecule. Journal of Virology 66,
3183–3187.
Kimura, M. (1980). A simple method for estimating evolutionary
rates of base substitutions through comparative studies of nucleotide
sequences. Journal of Molecular Evolution 16, 111–120.
Levy, J. A. (1993). Pathogenesis of human immunodeficiency virus
infection. Microbiological Reviews 57, 183–289.
Lombardi, S., Garzelli, C., La Rosa, C., Zaccaro, L., Specter, S.,
Malvaldi, G., Tozzini, F., Esposito, F. & Bendinelli, M. (1993).
Identification of a linear neutralization site within the third variable
region of feline immunodeficiency virus envelope. Journal of Virology 67,
4742–4749.
Miyazawa, T., Furuya, T., Itagaki, S. I., Tohya, Y., Nakano, K.,
Takahashi, E. & Mikami, T. (1989). Preliminary comparisons of the
biological properties of two strains of feline immunodeficiency virus (FIV)
isolated in Japan with FIV Petaluma strain isolated in the United States.
Archives of Virology 108, 59–68.
Nishimura, Y., Nakamura, S., Goto, N., Hasegawa, T., Pang, H., Goto,
Y., Kato, H., Youn, H. Y., Endo, Y., Mizuno, T., Momoi, Y., Ohno, K.,
Watari, T., Tsujimoto, H. & Hasegawa, A. (1996). Molecular charac-
terization of feline immunodeficiency virus genome obtained directly
from organs of a naturally infected cat with marked neurological
symptoms and encephalitis. Archives of Virology 141, 1933–1948.
Olmsted, R. A., Barnes, A. K., Yamamoto, J. K., Hirsch, V. M., Purcell,
R. H. & Johnson, P. R. (1989). Molecular cloning of feline immuno-
deficiency virus. Proceedings of the National Academy of Sciences, USA 86,
2448–2452.
Pedersen, N. C., Ho, E. W., Brown, M. L. & Yamamoto, J. K. (1987).
Isolation of a T-lymphotropic virus from domestic cats with an
immunodeficiency-like syndrome. Science 235, 790–793.
Phillips, T. R., Talbott, R. L., Lamont, C., Muir, S., Lovelace, K. & Elder,
J. H. (1990). Comparison of two host cell range variants of feline
immunodeficiency virus. Journal of Virology 64, 4605–4613.
Poeschla, E. M. & Looney, D. J. (1998). CXCR4 is required by a
nonprimate lentivirus : heterologous expression of feline immunodeficiency virus in human, rodent, and feline cells. Journal of Virology 72,
6858–6866.
Power, C., Buist, R., Johnston, J. B., Del Bigio, M. R., Ni, W., Dawood,
M. R. & Peeling, J. (1998). Neurovirulence in feline immunodeficiency
virus-infected neonatal cats is viral strain specific and dependent on
systemic immune suppression. Journal of Virology 72, 9109–9115.
Shioda, T., Oka, S., Ida, S., Nokihara, K., Toriyoshi, H., Mori, S.,
Takebe, Y., Kimura, S., Shimada, K. & Nagai, Y. (1994). A naturally
occurring single basic amino acid substitution in the V3 region of the
human immunodeficiency virus type 1 env protein alters the cellular host
range and antigenic structure of the virus. Journal of Virology 68,
7689–7696.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 05:45:40
CGEF
T. W. Vahlenkamp and others
Siebelink, K. H. J., Hai Chu, I., Rimmelzwaan, G. F., Weijer, K., van
Herwijnen, R., Knell, P., Egberink, H. F., Bosch, M. L. & Osterhaus,
A. D. M. E. (1990). Feline immunodeficiency virus (FIV) infection in the
cat as a model for HIV infection in man : FIV-induced impairment of
immune function. AIDS Research and Human Retroviruses 6, 1373–1378.
Siebelink, K. H. J., Hai Chu, I., Rimmelzwaan, G. F., Weijer, K.,
Osterhaus, A. D. M. E. & Bosch, M. L. (1992). Isolation and partial
characterization of infectious molecular clones of feline immunodeficiency
virus obtained directly from bone marrow DNA of a naturally infected
cat. Journal of Virology 66, 1091–1097.
Vliet, A. L. W., Horzinek, M. C., Egberink, H. F. & de Ronde, A. (1997).
A single amino acid substitution in the transmembrane glycoprotein of
feline immunodeficiency virus alters cellular tropism. Journal of Virology
71, 7132–7135.
Van de Peer, Y. & De Wachter, R. (1994). TREECON for Windows : a
software package for the construction and drawing of evolutionary trees
for the Microsoft Windows environment. Computer Applications in the
Biosciences 10, 569–570.
Verschoor, E. J., Boven, L. A., Blaak, H., van Vliet, A. L. W., Horzinek,
M. C. & de Ronde, A. (1995). A single mutation within the V3 envelope
deficiency virus involved in Crandell feline kidney cell tropism. Veterinary
Immunology and Immunopathology 46, 61–69.
neutralization domain of feline immunodeficiency virus determines its
tropism for CRFK cells. Journal of Virology 69, 4752–4757.
Wain-Hobson, S. (1996). HIV. One on one meets two. Nature 384,
117–118.
Simmonds, P., Zhang, L. Q., McOmish, F., Balfe, P., Ludlam, C. A. &
Brown, A. J. L. (1991). Discontinuous sequence change of human
Watkins, B. A., Dorn, H. H., Kelly, W. B., Armstrong, R. C., Potts, B. J.,
Michaels, F., Kufta, C. V. & Dubois-Dalcq, M. (1990). Specific tropism
immunodeficiency virus (HIV) type 1 env sequence in plasma viral and
lymphocyte-associated proviral populations in vivo : implications for
models of HIV pathogenesis. Journal of Virology 65, 6266–6276.
of HIV-1 for microglial cells in primary human brain cultures. Science 249,
549–553.
Wild, C., Greenwell, T. & Matthews, T. (1993). A synthetic peptide from
HIV-1 gp41 is a potent inhibitor of virus-mediated cell–cell fusion. AIDS
Research and Human Retroviruses 9, 1051–1053.
Siebelink, K. H. J., Karlas, J. A., Rimmelzwaan, G. F., Osterhaus,
A. D. M. E. & Bosch, M. L. (1995). A determinant of feline immuno-
Simmons, G., Wilkinson, D., Reeves, J. D., Dittmar, M. T., Beddows, S.,
Weber, J., Carnegie, G., Desselberger, U., Gray, P. W., Weiss, R. A. &
Clapham, P. R. (1996). Primary, syncytium-inducing human immuno-
Willett, B. J., Picard, L., Hosie, M. J., Turner, J. D., Adema, K. &
Clapham, P. R. (1997 a). Shared usage of the chemokine receptor
deficiency virus type 1 isolates are dual-tropic and most can use either
Lestr or CCR5 as coreceptors for virus entry. Journal of Virology 70,
8355–8360.
CXCR4 by the feline and human immunodeficiency viruses. Journal of
Virology 71, 6407–6415.
Strizki, J. M., Albright, A. V., Sheng, H., O’Connor, M., Perrin, L. &
Gonzalez-Scarano, F. (1996). Infection of primary human microglia and
Willett, B. J., Hosie, M. J., Neil, J. C., Turner, J. D. & Hoxie, J. A.
(1997 b). Common mechanism of infection by lentiviruses. Nature 385,
monocyte-derived macrophages with human immunodeficiency virus
type 1 isolates : evidence of differential tropism. Journal of Virology 70,
7654–7662.
Willett, B. J., Adema, K., Heveker, N., Brelot, A., Picard, L., Alizon, M.,
Turner, J. D., Hoxie, J. A., Peiper, S., Neil, J. C. & Hosie, M. J. (1998).
Talbott, R. L., Sparger, E. E., Lovelace, K. M., Fitch, W. M., Pedersen,
N. C., Luciw, P. A. & Elder, J. H. (1989). Nucleotide sequence and
genomic organization of feline immunodeficiency virus. Proceedings of the
National Academy of Sciences, USA 86, 5743–5747.
Tersmette, M., Lange, J. M., de Goede, R. E. Y., de Wolf, F., EeftinkSchattenkerk, J. K., Schellekens, P. T., Coutinho, R. A., Huisman, J. G.,
Goudsmit, J. & Miedema, F. (1989). Association between biological
properties of human immunodeficiency virus variants and risk for AIDS
and AIDS mortality. Lancet i, 983–985.
Vahlenkamp, T. W., Verschoor, E. J., Schuurman, N. N. M. P., van
CGEG
587.
The second extracellular loop of CXCR4 determines its function as a
receptor for feline immunodeficiency virus. Journal of Virology 72,
6475–6481.
Yamamoto, J. K., Sparger, E., Ho, E. W., Andersen, P. R., O’Connor,
T. P., Mandell, C. P., Lowenstine, L., Munn, R. & Pedersen, N. C.
(1988). Pathogenesis of experimentally induced feline immunodeficiency
virus infection in cats. American Journal of Veterinary Research 49,
1246–1258.
Received 9 March 1999 ; Accepted 14 June 1999
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 05:45:40