Download Specific detection of minus strand hepatitis A

© 1994 Oxford University Press
Nucleic Acids Research, 1994, Vol. 22, No. 10
1919-1920
Specific detection of minus strand hepatitis A virus RNA
by Tail-PCR following reverse transcription
Ricardo L.Chaves*, Judith Graff, Andrea Normann and Bertram Flehmig
Hygiene-lnstitut der Universitat Tubingen, Abteilung fur Medizinische Virologie und Epidemiologie der
Viruskrankheiten, SilcherstraBe 7, Tubingen, 72076, Germany
Received March 17, 1994; Accepted April 11, 1994
The biosynthesis of RNA directed by an RNA template is a
reaction that is unique to RNA viruses. Hepatitis A virus (HAV)
contains a single, plus strand RNA genome. Viral RNA
replication occurs in the cytoplasma of infected cells, and involves
first the synthesis of a minus strand RNA molecule. The minus
strand HAV RNA, present in very low amounts, serves as
template for the production of new copies of genomic plus strand
RNA (1). Minus strand HAV RNA have been detectable for a
brief period, if at all, by blot hybridization in infected cell cultures
(2,3,4).
Recently, McGuiness and colleagues (5) pointed out the major
limitations of the specific detection of negative strand hepatitis
C virus (HCV) RNA by PCR: firstly, to ensure the complete
inactivation of the reverse transcriptase (RTase) and the
degradation of plus strand RNA after cDNA synthesis, and
secondly the RTase activity of the Taq DNA polymerase (6,7).
They concluded that reliable detection of minus strand HCV RNA
is not yet achievable by current methods.
By designing suitable primers for a modified nested PCR (TailPCR), and also by using magnetic beads technology, we have
developed a method aimed at the specific detection of singlestranded RNA.
HAV strain GBM was propagated in human embryonic lung
fibroblasts (8). The medium was discarded and the cells washed
with phosphate buffered saline (PBS). Total RNA was then
obtained from infected and noninfected cells on days 3, 7 and
10 p.i. by standard methods (9).
Streptavidin-linked magnetic beads (20 /il) were prepared for
binding to the biotinylated cDNA by resuspension in 40 fi\ of
2 M NaCl/TE (10 mM Tris-HCl pH 7.5/0.1 mM EDTA), as
described previously (10).
To detect minus strand HAV RNA, primers containing
approximately 20 additional nucleotides on their 5' end were
constructed so that a modified nested PCR could be performed.
These additional sequences, called tail-sequences, are neither
complementary nor homologous to any part of the HAV genome
(11, 12). The tail-sequences can be used as the target during the
amplification that follows, and were chosen using the computer
program Gene Jockey (Biosoft, Cambridge). To carry out reverse
transcription (RT), a biotinylated HAV positive-sense outerprimer A with a first tail-sequence, tail 1, on its 5' end was
constructed (Table 1). The i00 jtl RT assay, performed at 42°C
for 30 minutes, consisted of universal buffer (10 mM Tris-HCl,
* To whom correspondence should be addressed
pH 8.3, 50 mM KC1 and 1.5 mM MgCl2), 0.25 mM each of
dATP, dCTP, dGTP, dTTP, 4.25 pmol of primer A with the
first tail-sequence, 5 units of RTase from avian myoblastosis virus
and 10 jig of total RNA. A 40 /tl aliquot of the cDNA was bound
to the streptavidin-linked magnetic beads (Fig. 1), washed 3 times
in 2 M NaCl/TE, and finally resuspended in 100 |tl of Tail-PCR
mixture.
The first Tail-PCR primer-set comprised a primer homologous
to the first tail-sequence (primer 1) and an HAV negative-sense
outer-primer B with a second tail-sequence, tail 2, on its 5' end
(Fig. 1, Table 1). The Tail-PCR mixture consisted of universal
buffer, 0.25 mM each of dATP, dCTP, dGTP, dTTP, 30 pmol
each of the primers and 2.5 units of Taq DNA polymerase. Thirty
amplification cycles were performed in a thermocycler (MWG)
— 1 min denaturation at 94°C, 1 min annealing at 55°C and
2 min extension at 72°C. The resultant amplicon (817 bp long)
contained the second tail-sequence on the 5' end of the newly
synthesized DNA strand.
A primer homologous to the second tail-sequence (primer 2)
and an HAV positive-sense inner-primer C were used to carry
out the final amplification (Fig. 1, Table 1). An aliquot of 1 jtl
from the first amplicon was added to the second Tail-PCR
mixture. Reaction conditions were the same as in the first
amplification, except for a 1 min extension step. The second
amplicon was 337 bp long.
In order to test the specificity of the Tail-PCR, RNase A and
H digestion were performed after washing the cDNA. The RNase
A digestion mixture consisted of universal buffer and 0.5 units
of RNase A, and was incubated for 30 min at 37°C. Thereafter,
the wash steps were repeated and the PCR-mix was added. The
RNase H digestion was performed for 30 min at 37°C by raising
Table 1. Primer-set used for the detection of minus strand HAV RNA
Reverse
HAV primer A (+)(6700-6720») with the first tail-sequence':
Transcription
BiotinS' TGGGATTACCOAGTATGTGTCTTAGTCCATTTATGATTA 3'
First Tail-PCR
Primer 1 (homologous to the first tail-sequence):
(817 bp product) 5' TTGGGATTAGCGAGTATG 3'
HAV primer B (-)(7477-7456*) with the second tail-sequence*:
5' GACCTGGATAGGCTGTGTGATTTTACTGATAAAAGAAATAAAC 3'
Second Tail-PCR Pnmer 2 (homologous to the second tail-sequence):
(337 bp product) 5' GACCTGGATAGGCTGTGTGAT 3'
HAV primer C (+)(7161-7183 a ):
5' GAGGATAGAATTAGACCTGCAAT 3'
indicates nucleolide position in the HAV genome.
Tail-sequences arc underlined.
1920 Nucleic Acids Research, 1994, Vol. 22, No. 10
©©SIC
|
8MDM0 TO STREFTAVnM-STRAWOR
WHOM,
WASH AMD BOLATIOM
-STRAHORNA
Of THE
BOTMYLATED COM*
|
0'"-"
<—i—1
f
1
]
LTAL2J
Figure 1. Scheme of the Tail-PCR.
12
3 4 5 6 7 8
793 bp
337 bp
to Nylon membranes as described elsewhere (15), and finally
subjected to oligonucleotide hybridization with an HAV cDNA
fragment (13).
HAV minus strand RNA was detected in infected cells 3, 7
and 10 days p.i. by Tail-PCR after the second amplification, but
not in noninfected cells. Figure 2 shows the results of the TailPCR, RT-PCR and Southern hybridization on day 10 p.i. Neither
RNase A nor RNase H digestions, done after RT, alter the results
of the Tail-PCR (lanes 3 to 5). Total HAV RNA was detected
by RT-PCR after the first amplification, and RNase A treatment
turned RT-PCR negative, even after the second nested
amplification (lanes 6, 7 and 8). If amplicons without tailsequences from the first RT-PCR (lane 6) were used as the target
for the second Tail-PCR, the results of the Tail-PCR were
negative (not shown).
In this report, we present a method enabling the specific
detection of single-stranded RNA by using PCR. After cDNA
synthesis, RNase digestion does not alter the result of the TailPCR, i.e. the target for the Tail-PCR was the tailed cDNA
synthesized from the HAV minus strand RNA. Plus strand RNA
and RTase are eliminated by washing the biotinylated cDNA.
The addition of the tail-sequences to the cDN A target molecules
ensures the specificity of ssRNA detection, since they render the
complementary DNA strands unsuitable for amplification by TailPCR. We could show that amplicons originating from the same
HAV genomic region devoid of tail-sequences cannot serve as
target for Tail-PCR.
In summary, we regard Tail-PCR following RT as a new
approach in detecting ssRNA and monitoring the presence of low
amounts of replicative intermediates of ssRNA viruses.
ACKNOWLEDGEMENTS
Figure 2. Agarose gel analysis (a) of the PCR products and Southern hybridization
(b). RT/Tail-PCR and RT-PCR were used to detect HAV minus strand RNA
and total HAV RNA, respectively. The Southern hybrization was performed with
a digoxigenin-labelled cDNA probe derived from the 3' end of HAV. Nucleic
acids were obtained on day 10 p.i. Lanes: 1 — DNA marker VI (Boehringer
Mannheim). 2 — RT/Tail-PCR from noninfected cells. 3 — RT/Tail-PCR from
infected cells. 4 — Tail-PCR from infected cells performed after RNase A digestion
of the RT product. 5 — Tail-PCR from infected cells performed after RNase
H digestion of the RT product. 6 — RT-PCR from infected cells, without preceding
ribonuclease A digestion. 7 — RT-PCR from infected cells, as in lane 6, performed
after RNase A digestion of the viral RNA. 8 — Second (nested) PCR following
that in lane 7.
the buffer concentration of MgCl2 to 5 mM and adding 0.85
units of RNase H.
As additional control for the specificity of the Tail-PCR, RT
followed by nested PCR (RT-PCR) to detect total viral RNA was
carried out with the HAV specific primers A, B and C devoid
of tail-sequences. An additional HAV specific negative-sense
primer (downstream to HAV primer B at genome position
7478—7492) was used, as described previously, for the first
amplification (13,14). The buffer and cycling conditions were
the same as described above. The first and second RT-PCR
amplicons were, respectively, 793 and 317 bp long. To verify
whether amplicons originating from total viral RNA turn TailPCR positive, the first amplicon of the RT-PCR was also
subjected to the second Tail-PCR.
The efficacy of RNase A digestion in destroying total HAV
RNA was tested by performing the digestion before RT.
The PCR products were electrophoresed through 2% agarose
gels, visualized by staining with ethidium bromide, transferred
We would like to thank Dr Jack Stapleton, University of Iowa,
for helpful discussions. This work was supported by the Deutsche
Forschungsgemeinschaft. R.L.C. was supported by the CAPES
Scholarship (Brazilian Ministry of Education).
REFERENCES
1. Cohen,J.I. (1989) Hepatology 9, 889-895.
2. Anderson,D.A., Ross.B.C. and Locarnini,S.A. (1988) J. Virol. 62,
4201 -4206.
3. Cho,M.W. and Ehrenfeld.E. (1991) Virology 180, 770-780.
4. De Chastonay.J. and Siegl,G. (1987) Virology 1S7, 268-275.
5. McGuinness,P.H., Bishop.G.A., McCaughan,G.W., Trowbridge.R. and
Gowans.E.J. (1994) Lancet 343, 551-552.
6. Jones,M.D. and Foulkes.N.S. (1989) Nucleic Acids Res. 17, 8387-8388.
7. Tse.W.T. and Forget.B.G. (1990) Gene 88, 293-296.
8. Flehmig.B., Vallbracht,A. and Wurster,G. (1981) Med. Microbiol. Immunol.
170, 83-89.
9. Zagursky.R.J., Baumeister,K., Lomax,N. and Berman,M.L. (1985) Gene
Anal. Tech. 2, 89-94.
10. Hultman,T., Stahl.S., Hornes,E. and Uhlen,M. (1989) Nucleic Acids Res.
17, 4937-4946.
11. Cohen,J.I., Ticehurst.J.R., Purcell,R.H., Buckler-White,A. and
Baroudy.B.M. (1987) J. Virol. 61, 50-59.
12. Graff,J., Normann.A., Feinstone.S.M. and Flehmig.B. (1994) J. Virol. 68,
548-554.
13. Normann.A., Graff.J., Gerritzen,A., Brackmann,H.-H. and Flehmig,B.
(1992) Lancet 340, 1232-1233.
14. GraffJ., Ticehurst,J. and Flehmig,B. (1993)Appl. Environ. Microbiol. 59,
3165-3170.
15. Sambrook,J., Fritsch.E.F. and Maniatis.T. (1989) Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.