Download Biology Spring Final Review Guide

Name:
Date of Final
DNA/Protein Synthesis/Genetics
1) What is the function of DNA?
2) Label the structures and processes show in the following diagram:
E.
Processes:
Structures
:
C.
A.
F.
B.
D.
G.
3) Transcribe and translate the following segment of DNA using codon chart in your text pg 244:
GACAATCGGCTATTAGATATC
4) What is a codon?
5) What is an anti-codon?
6) Who is known as the “father” of genetics?
7) Describe the following terms:
A) Dominant
F) Genotype
B) Recessive
G) Phenotype
C) Homozygous
H) Incomplete Dominance
D) Heterozygous
I) Codominance
E) Allele
8) Provide an example of incomplete dominance and codominance.
9) Determine the probability of getting each of the offspring from the parental cross.
AaBbCc X AaBbCc= aabbcc
AAbbCc X AABbCc = AAbbcc
AABBCC x aabbcc = AABBCC
10)What is a pedigree? How do you write the following for a pedigree: Affected males? Affected females?
Carriers? Not affected? Marriages?
11)How are genes related to chromosomes?
12)What does the term “locus” mean?
13)What are the 2 possible sex chromosomes?
14)How do we show a female? Male?
15)What type of map would be used to show a chromosomal level mutation? Why?
16)What type of map would be used to show a point level mutation? Why?
17)In pigs, long snouts are dominant to short snouts. Draw a Punnett square showing the cross between
two pigs where one is homozygous dominant and the other is homozygous recessive for the trait.
A) Parental genotypes:
B) Genotypic ratio
C) Phenotypic ratio:
18) Identify all the structures (1-5) in the picture below:
Evolution/Classification
19)Define evolution.
20)Who is the “father” of evolutionary thought?
21)How do Mendel’s ideas contribute to the theory of evolution?
22)What is genetic variation?
23)Why does variation have to be present for evolution?
24)Describe and explain the following mechanisms of evolution:
A) Mutation
E) Gradualism
B) Gene Flow
F) Catastrophism
C) Genetic Drift
G) Uniformitarianism
D) Natural Selection
25)Explain the four principles or natural selection:
26)What kind of cells do mutations have to occur in for them to matter in evolution?
27)Explain Immigration and Emigration.
28)Name the 5 ways (give examples of each too) that can change gene frequency.
29)Name the 2 main processes that lead to new species. Then name all the ways to maintain a species.
30)Name and label graphs (indicate which ones have common ancestors and what is happening to
diversity between the 2 species) for the following evolutionary trends:
A) Co-evolution
C) Divergent evolution
B) Convergent evolution
D) Adaptive evolution
31)Define a species.
32)What is speciation?
33)Describe and explain the following pieces of evidence of evolution:
A) Biodiversity
D) DNA
B) Geography
E) Embryology
C) Fossils
34)Define the following and give an example of each:
A) Homologous Structures
B) Analogous structures
C) Vestigial Structures
35)Why did the population of the speckled moth increase during the industrial revolution in England while
the population of the white moth decreased?
36)What is a phylogeny?
37)What is taxonomy?
38)List the order of classification in taxonomy from most inclusive to least inclusive.
39)Name and briefly describe each of the 3 domains.
Cell Division and cell cycle
40) Name the specific stage of the cell cycle that is described in each scenario below. (a-f) You may use an answer
more than once if needed.
A) The cell’s surface area to volume is off causing this stage to occur.
B) Cromatin are re-made.
C) When the cell performs nuclear division
______
D) The largest component that makes up the cell cycle.
E) The stage directly before the M phase.
F) The shortest part of the entire cell cycle.
41) List the individual components of the mitotic apparatus
42) Draw and label a centromere
43) Draw and fully label the cell cycle and indicate what types of cells go through it. Give an example cell.
44) Describe 3 similarities and 3 differences of somatic cell creation and gametic cell creation.
45) What are polar bodies? Do men have them? (Why or why not?)
46) List the stages of meiosis in order they ooccur. Do the same for mitosis.
47) What is interkinesis? What cells undergo this? Why do they undergo this?
Ecology
48)Define ecology.
49)What are biotic and abiotic factors? Give examples of each.
50)What are the two main processes involved in the carbon cycle?
51)What is nitrogen fixation?
52)Define K. What sets K for predators? What sets K for prey?
53)Which organisms are responsible for “fixing” nitrogen?
54)Describe the following steps of the hydrologic cycle:
A) Transpiration:
C) Condensation:
B) Evaporation:
D) Precipitation:
55)What is biomass?
56)Which trophic level has the most biomass?
57)Draw out a food chain. (label each trophic level).
58)What happens to energy at every step in trophic levels?
59)List the 3 main traits that distinguish the major land biomes from one another.
60)Describe the three types of symbiosis below:
A) Mutualism
B) Commensalisms
C) Parasitism
61)Describe each of the following :
A) Autotroph
C) Herbivore
E) Omnivore
B) Heterotroph
D) Carnivore
F) Decomposer
62)Explain the factors that affect population size.
63)How do non-native species impact an environment?
64)What is the main source of air pollution?
65)Explain the greenhouse effect and global warming.
66)What are renewable resources? Give some examples.
67)What are non-renewable resources? Give some examples.
68)What are the advantages and disadvantages of solar energy?
69)What are some conservation techniques that can help to reduce our impact on the environment?
70)What would happen to a population of native species when a non-native species is introduced?
71)Draw and explain a logistic growth graph:
72)What is a carrying capacity?
73)Draw and explain an exponential growth graph:
74)What would enable an organism to experience exponential growth?
ENIRONMENTALISM:
75) What are the 5 main gases that cause air pollution?
76)What is the “blanket” effect? What 2 gases contribute to this phenomenon?
77)Describe the following cycles: N. H2O, C in terms of pollution
78) What is the difference between biodegradable and non-biodegradable? Give examples of each.
79) What is the difference between renewable and non-renewable energy? Give examples of each.
80)What is the equation for acid rain? How does it occur?
81)Draw an illustration to clearly show how sustainability is achieved? (By aligning what 3 main areas?)
82)What is the opposite of sustainability? Give an example.
83)What is an “invasive species”? Why are they hard on the natural ecosystem inhabitants?
GENERAL MATERIAL:
84)Use the information that follows to A) identify the variables, B) graph the data and C) write a possible
hypothesis that explains the data.
Scientists were studying sea slug distribution in a 10 meter square plot and found the following data.
TIME OF DAY
DISTANCE BETWEEN SLUGS
MIDNIGHT
8.0 cm
4 AM
8.9 cm
8 AM
44.8 cm
NOON
174.0 cm
4PM
350.5 cm
8PM
60.5 cm
MIDNIGHT
8.0 cm