Download 1) A student investigated whether ants dig more tunnels in the light

1) A student investigated whether ants dig more tunnels in the light or in
the dark. She thought that ants used the filtered light that penetrated
the upper layers of earth and would dig more tunnels during the
daytime. Fifteen ant colonies were set up in commercial ant farms with
the same number and type of ants per ant farm. The same amount of
food was given to each colony, and the colonies were in the same
temperature. Five of the colonies were exposed to normal room light
and five were covered with black construction paper so they did not
receive light. The remaining 5 were exposed to the normal daily cycle
of light and dark. Every other day for three weeks the length of the
tunnels was measured in millimeter using a string and a ruler. Averages
for the light and dark groups for each measured were then computed.
2) A student investigated the effect of radiation on the germination of
bean seeds. He thought that exposure to radiation would limit the
seeds ability to germinate (grow) much like ultra-violet light causing
skin cancer. Three hundred seeds were soaked in distilled water for
one hour. They were then divided into three groups. One group was
placed in a microwave oven on high for three seconds. Another
group was microwaved on high for six seconds. The last group was not
microwaved. The seeds were then planted in three separate flats and
given the same amount of water. The seeds were then planted in
three separate flats and given the same amount of water. The flats
were placed in a location with a constant temperature of
approximately 27 degrees Celsius. Each day for two weeks the
number of seeds that germinated each group was recorded.
Identify the
A. Control Group
B. Independent Variable
C. Dependent Variable
D. Constants
E. The hypothesis being
tested
Identify the
A. Control Group
B. Independent
Variable
C. Dependent Variable
D. Constants
E. The hypothesis being
tested
Identify the
A. Independent Variable
B. Dependent Variable
C. Relationship between the two variables
Identify the
A. Independent Variable
B. Dependent Variable
C. Relationship between the two
variables
Years
Scientific Process
3) List the steps of the scientific method.
4) Why is the scientific method required?
5) Explain the proper way to evaluate someone’s work to assure it is accurately evaluated without
bias?
6) Define the following terms: discuss
7) Control group:
8) Variable/experimental group:
9) Dependent variable:
10) Independent variable:
11) What is the difference between a hypothesis and a theory?
12) How many variables can be present at one time in an experiment? Why?
13) A researcher discovers a plant that can be used as a treatment for cancer, what type of science
is being conducted?
14) Determine the name and function for each of the labeled organelles.
15) How is this cell diagram similar to a prokaryote? How is it different?
Determine the organelle that is being described:
16) The main source of energy for an animal cell:
17) The structure responsible for ridding the cell of foreign matter and dead organelle:
18) The fluid materials that suspends organelles and other materials in the cell:
19) The structure that controls cellular function and stores genetic information:
20) The structure that converts sunlight into usable energy for a plant cell:
21) Which cell part is responsible for cell respiration?
22) Which cell part is responsible for protein synthesis?
23) Which cell part is responsible for delivering proteins to the golgi apparatus?
24) Which cell part can store materials such as water, proteins or other materials?
25) Which structure provides support and rigidity to a plant cell?
26) This structure is selectively permeable to substance outside and inside the cell:
Organic Compounds and Basic Chem
27) Write the chemical formula for water and glucose.
28) Identify 3 reasons water is important to a cell. Which organelle holds the water in plant cells?
29) How did the discovery of the microscope change biological science?
30) What are the 3 parts of the Cell Theory?
31) Compare and contrast prokaryotic and eukaryotic cells. Give examples of organisms with these
types of cells.
32) Compare and contrast the 2 types of eukaryotic cells, plant and animal.
33) From smallest to largest list the organization of life.
What are the 4 major organic compounds that are found in all living things? Fill in the table to
describe them:
34) Name at least 3 things that they all have in common.
35) Name the most important property of water and 4 properties that result from it.
36) What type of reactions builds compounds? Break them down? Give examples from topics studied
in class.
37) Related to the diagram answer the following:
A) Which side is hypertonic?
Hypotonic?
B) What is meant by the term
selectively permeable?
C) If the membrane is permeable to
water, which way will the water move?
What is the term for this?
D) Is this type of movement passive or
active transport? What is the
difference between the two?
E) If the membrane were permeable to
glucose which way would it move?
Cell Transport
38) Why is the cell membrane semi-permeable?
39) Why is the cell membrane referred to as a fluid mosaic?
40) Label all of the parts on the cell (plasma) membrane shown below.
41) Fill in the tables below:
Hypertonic Solution
Hypotonic Solution
Isotonic solution
amount of solutes
amount of water
Draw a cell in the
solution type.
Which way will water
move?
Which way will solutes
move
What happens to the
cell?
Process
energy used
organelles used
concentration
gradient
Passive transport
Active transport
osmosis
diffusion
facilitated
diffusion
exocytosis
endocytosis
pinocytosis
phagocytosis
42) For the diagram below, label all of the things with a line. What is
the purpose of the entire molecule below? What is portion of the
molecule that is boxed?
43) Name the steps and who performs each step of DNA replication.
44) Explain the 2 ways that DNA is held together.
45) Compare and contrast DNA to RNA using at least 4 items each.
materials moved
Cell Division:
46) Make a table and compare and contrast (using at least 4 traits) the two types of cell division.
Include example cells.
47) Divide the circle below to illustrate a complete cell cycle.
Indicate the number of chromosomes (use humans) for each
phase.
48) In proper order, list the major players (and each ones job) used to achieve semi-conservative
replication.
49) What is the diagram to the right illustrating? Be sure to explain all
important details.
50) What is the difference between the products of meiosis for males versus females?
51) Review all steps (in order of mitosis, meiosis, DNA replication and the cell cycle)
52)
53)
Complete the following monohybrid crosses:
54) In pea plant, tall (T) is dominant to dwarf (t). Show the cross between a heterozygous tall plant
and a dwarf plant.
A) Parent genotypes: _______________
B) Genotypic ratio: ________________
C) Phenotypic ratio: ________________
55) Using the same alleles as in number 17, show the cross between two heterozygous tall plants.
A) Parent genotypes: _______________
B) Genotypic ratio: ________________
C) Phenotypic ratio: ________________
56) In baboons, red-baboon butts are dominant to blue-baboon butts. Cross a blue-butted baboon
with one that is homozygous red-butted.
A) Parent genotypes: _______________
B) Genotypic ratio: ________________
C) Phenotypic ratio: ________________
57) In flamingos, pink feathers are dominant to yellow. Cross a homozygous pink flamingo with a
heterozygous flamingo.
A) Parent genotypes: _______________
B) Genotypic ratio: ________________
C) Phenotypic ratio: ________________
Protein Synthesis:
58) Identify all the structures (1-5) in the picture below and give the function of each:
59) What is the function of DNA?
60) Label the structures and processes show in the following diagram:
Structures:
E.
Processes:
C.
A.
F.
B.
G.
D.
61) Transcribe and translate the following segment of DNA using codon chart
GACAATCGGCTATTAGATATC
62) What is a codon?
63) What is an anti-codon?
64) Who is known as the “father” of genetics?
65) Describe the following terms:
A) Dominant
B) Recessive
C) Homozygous
D) Heterozygous
E) Allele
F)
G)
H)
I)
Genotype
Phenotype
Incomplete Dominance
Codominance
66) Provide an example of incomplete dominance and codominance.
67) Determine the probability of getting each of the offspring from the parental cross.
AaBbCc X AaBbCc= aabbcc
AAbbCc X AABbCc = AAbbcc
AABBCC x aabbcc = AABBCC
68) What is a pedigree? How do you write the following for a pedigree: Affected males? Affected
females? Carriers? Not affected? Marriages?
69) How are genes related to chromosomes?
70) What does the term “locus” mean?
71) What are the 2 possible sex chromosomes?
72) How do we show a female? Male?
73) What type of map would be used to show a chromosomal level mutation? Why?
74) What type of map would be used to show a point level mutation? Why?
75) In pigs, long snouts are dominant to short snouts. Draw a Punnett square showing the cross
between two pigs where one is homozygous dominant and the other is homozygous recessive for
the trait.
A) Parental genotypes:
B) Genotypic ratio
C) Phenotypic ratio: