Download Expression and activity of type 1 NAD(P)H dehydrogenase at

Copyright ß Physiologia Plantarum 2005, ISSN 0031-9317
Physiologia Plantarum 125: 135–140. 2005
Expression and activity of type 1 NAD(P)H dehydrogenase at
different growth phases of the cyanobacterium,
Synechocystis PCC 6803
Weimin Ma and Hualing Mi*
National Laboratory of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Graduate
School of the Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032, China
Correspondence
*Corresponding author,
e-mail: [email protected]
Received 9 March 2005; revised 24 May 2005
doi: 10.1111/j.1399-3054.2005.00555.x
The expression and activity of type 1 NAD(P)H dehydrogenase (NDH-1) were
investigated in Synechocystis PCC 6803 cells during different growth phases
(i.e. lag, logarithmic, stationary and decline phases). The relative amount of
NDH-1, estimated by Western blot analysis using antibodies against NdhH,
NdhI and NdhK, increased more than two-fold during growth from the lag to
the logarithmic phase and then decreased after the logarithmic phase to reach
lowest levels after 15 days (decline phase). The activity of light-dependent
NADPH oxidation and cyclic electron flow around photosystem I (PSI) changed nearly in parallel with the amount of NdhH, NdhI and NdhK in cells
across the growth phases. In contrast, the activity of photosynthetic O2 evolution and respiratory O2 uptake was not significantly different across phases of
growth; the fluctuation of the activity at different phases was within 40%.
These results suggested that the activity of light-dependent NADPH oxidation
and PSI-cyclic electron flow are restricted by the amount of NDH-1 and that
other factor(s) are limiting the rates of photosynthesis and respiration.
Introduction
Cyanobacteria are globally distributed photosynthetic
organisms that grow well in a wide range of natural
environments. In laboratory batch cultures, cyanobacterial growth stages are divided into lag, logarithmic,
stationary and decline phases, depending on growth
rate and cell density. The decrease in growth rate after
the logarithmic phase is considered to be a result of
limited availability of light energy and/or nutrients.
However, few studies have examined this in cells across
different growth phases.
The enzyme type 1 NAD(P)H dehydrogenase (NDH1) consists of two complexes in cyanobacteria. Each
complex contains more than 15 subunits (Battchikova
et al. 2005, Nixon et al. 1989, Prommeenate et al. 2004,
Steinmüller 1992, Zhang et al. 2004), which are
encoded by genes homologous to the chloroplast and
mitochondrial ndh genes (Kaneko et al. 1996, Ohyama
et al. 1986). Cyanobacterial NDH-1 complexes have a
unique function in that they are involved in photosystem
I (PSI)-cyclic electron flow and CO2 uptake (Mi et al.
1992a, 1992b, 1994, 1995, Ogawa 1991). In addition,
the activity and amounts of the subunits of NDH-1
complexes are inducible by changing environmental
conditions, such as elevating light levels (Mi et al.
2001), reducing CO2 (Deng et al. 2003a, 2003b,
Zhang et al. 2004) and adding excess salt (Hibino
Abbreviations – FNR, ferredoxin-NADPþ oxidoreductase; NDH-1, type 1 NAD(P)H dehydrogenase; PSI, photosystem I; RFp,
initial rate of post-illumination increase in chlorophyll (Chl) fluorescence.
Physiol. Plant. 125, 2005
135
et al. 1996). This inducible property of NDH-1 suggests
that it may have a protective role for the NDH-1 complexes under stressful conditions.
The current study examined the effects of growth
phase on cellular levels and activity of NDH-1. The
relative amounts of each of the three subunits of NDH1 in Synechocystis PCC 6803 cells at different growth
phases were measured, together with the activity of
light-dependent NADPH oxidation, PSI-cyclic electron
flow, photosynthetic O2 evolution and respiratory O2
uptake. The amount of NDH-1 was highly dependent on
the growth phase and significantly correlated with the
activity of NADPH oxidation and PSI-cyclic electron
flow; however, there was not a significant correlation
between NDH-1 levels and photosynthesis and respiratory activity.
Materials and methods
Culture and determination of cell density
Synechocystis PCC 6803 cells were cultured at 30 C in
BG-11 medium, (Allen 1968) buffered with Tris–HCl
(5 mM, pH 8.0) and bubbled with 2% (v/v) CO2 in air
under continuous illumination by fluorescent lamps
(60 mE m2 s1). The cell density was determined every
24 h by measuring the absorbance at 730 nm using a
spectrophotometer (UV3000, Shimadzu, Kyoto, Japan).
Western analysis and light-dependent NADPH
oxidation
SDS-PAGE electrophoresis was carried out on 12% polyacrylamide gels according to the method of Laemmli
(1970). Western blot analysis was performed with an
ECL assay kit (Amersham Pharmacia, NJ), according to
the manufacturer’s protocol. Antibodies against the NDH1 subunits (NdhH, NdhI and NdhK) of Synechocystis PCC
6803 were raised in our laboratory. To amplify ndhH,
ndhI and ndhK, the primer sequences as summarized in
(Table 1) were designed. The polymerase chain reaction
products were ligated into vector pET32a, and the construct was amplified in Escherichia coli DH-5a. The plasmid was used to transform E. coli strain BL21 (DE3) pLysS
for expression. The gene expression products from E. coli
were purified and used as antigens to immunize rabbits to
produce polyclonal antibodies.
Light-dependent NADPH oxidation was performed as
described by Deng et al. (2003a). Whole-cell extracts were
diluted with medium A to a chlorophyll (Chl) concentration of 5 mg per 3 ml and supplemented with 10 mM 3-(3,
4-dichlorophenyl)-1, 1-dimethyl urea (DCMU), 0.25 mM
NaN3, 0.1 mM KCN and 0.2% (v/v) Triton X-100.
Reaction mixtures were pre-illuminated with actinic light
(AL) for 2 min to activate NDH-1, and then 100 mM
NADPH was added. The rates of NADPH oxidation were
measured at 25 C as a decrease in 340-nm absorbance
after application of AL (>660 nm, 200 mE m2 s1). An
extinction coefficient of 6.22 mM1 cm1 was used to
calculate the NADPH concentrations.
Isolation of whole-cell extracts
Cells harvested by centrifugation (5000 g for 5 min at
4 C) were suspended in medium A [10 mM HEPESNaOH, 5 mM sodium phosphate (pH 7.5), 10 mM
MgCl2 and 10 mM NaCl], supplemented with 25% glycerol and were disrupted by 5 · 20-s pulses with a
Bead-beater (Biospec, Bartlesville, OK) followed by a
3-min incubation on ice. The homogenate was centrifuged at 5000 g for 5 min at 4 C to remove unbroken
cells and debris. Membranes in the supernatant were
solubilized with 1% (w/v) N-dodecyl-b-D-maltoside
while shaking on ice for 1 h. The samples were then
immediately subjected to SDS-PAGE.
Redox changes of plastoquinone and P700+
Cells were suspended in fresh BG-11 medium buffered
with Tris–HCl (5 mM, pH 8.0) at a Chl concentration of
10 mg ml1. Chl fluorescence and absorbance changes
at 810 minus 830 nm were measured to monitor the
redox changes of plastoquinone (PQ) and reduction of
P700þ after far-red light illumination (FR, >705 nm,
5.2 mM m2s1), respectively. A PAM Chl fluorometer
(Walz, Effeltrich, Germany) and an emitter-detectorcuvette assembly (ED-101US) with a unit 101ED or a
unit ED-P700DW-II were used for these measurements,
as described by Klughammer and Schreiber (1998).
Table 1. Primer sequences for amplifying ndhH, ndhI and ndhK.
Gene
Forward primers (50 30 )
Reverse primers (50 30 )
NdhH
NdhI
NdhK
TTAAGGATCCATGACCAAGATTGAAACCAGA
ACGGGATCCGTATGTTTAACAACATTCTC
CCTAGGATCCATGAGTCCCAACCCTGCTAAC
GCAAAAGCTTCTAGCGGTCCACCGATCCCAT
AACTCTGCAGCTATTCTGCTTTCACCAA
GTTCAAGCTTTCAGCCACGGTTTAATTGCTC
136
Physiol. Plant. 125, 2005
Photosynthetic oxygen evolution and respiration
Oxygen evolution by photosynthesis and uptake by respiration were measured at 25 C (Hansatech, Hertfordshire,
UK) with a Clark-type oxygen electrode according to the
method described by Mi et al. (1995). Cells were suspended in BG-11 medium at a Chl concentration of
20 mg ml1. The intensity of AL used for the measurement
of photosynthetic oxygen evolution was 800 mE m2 s1.
Results
Amount of NDH-1 in cells at different growth
phases
Synechocystis PCC 6803 growth can be divided into
four phases. The designation of growth phase depends
on the growth rate and density of the cells, i.e. lag (0–2
days), logarithmic (2–8 days), stationary (8–15 days) and
decline (after 15 days) phases (Fig. 1). Cells harvested 1,
4, 10 and 16 days (designated 1-, 4-, 10- and 16-day
cells, respectively) after inoculation of stationary phase
cells to a new culture medium were used to represent
each phase. The amount of NDH-1 in cells is strongly
dependent on their growth phase. Western blot analysis
with antibodies against NdhH, NdhI and NdhK indicated that the amount of these subunits was highest in
4-day cells in the logarithmic phase and then decreased
after this phase to very low levels in 16-day cells (Fig. 2
and curves a–c in Fig. 3).
PSI-cyclic electron transport
The activity of PSI-cyclic electron transport was monitored by measuring the activities of three different
3
Lag
Logarithmic
Stationary
Decline
reactions: (1) light-induced NADPH oxidation, (2)
post-illumination increase of Chl fluorescence and (3)
initial rate of P700þ reduction. NADPH oxidation was
measured in the light without adding artificial electron
acceptor (Deng et al., 2003a). Under these conditions,
there was no NADPH oxidation in the dark due to the
diaphorase activity of ferredoxin-NADPþ oxidoreductase. The activity of light-dependent NADPH oxidation
was 0.9, 2.3, 1.3 and 0.6 · 101 mM min1 mg Chl1,
respectively, in 1-, 4-, 10- and 16-day cells. The change
of the amount of NDH-1 was corresponding with that of
NADPH oxidation activity during different growth
phases (curves a–c and f in Fig. 3A). The closed triangles
showing the relative activity of NADPH oxidation at
various levels of NDH-1 (the average values for NdhH,
NdhI and NdhK are taken) were located near the line
with the slope of 1 (Fig. 3B). Thus, there exists a significant correlation between the amount of NDH-1
complexes and the NADPH oxidation activity in cells
of different phases. The results indicate that the PSIdriven NADPH oxidation reflects the NADPH-oxidizing
activity of NDH-1. Western blot analysis of the thylakoid membranes after various dilutions indicated that
there existed a linearity between the densities of the
spots and the amount of proteins in the range of protein
concentrations used in Fig. 2, except that the density
dropped sharply off the linearity line when the protein
concentration was below a certain level (data not
shown). This would explain the extremely low levels
of NdhH and NdhI in 16-day cells (Fig. 2).
Post-illumination increase in Chl fluorescence is considered to reflect the reduction of PQ by NAD(P)H or
other reducing substances accumulated under light. In
higher plants and cyanobacteria, this increase in Chl
fluorescence represents the activity of PSI-cyclic electron
transport (Asada et al. 1993, Mano et al. 1995, Mi et al.
1995). Typical Chl fluorescence kinetics of Synechocystis
PCC 6803 is shown in Fig. 4A, and the area surrounded
by the square shows a post-illumination increase in Chl
A730 nm
2
1 day
4 days
10 days
16 days
NdhH
46 kDa
NdhI
24 kDa
NdhK
27 kDa
1
0
0
2
4
6
8
10
Day
12
14
16
18
Fig. 1. Growth curve of Synechocystis PCC 6803 cells and definition of
various phases. The vertical bars indicate standard errors calculated
from three independent experiments.
Physiol. Plant. 125, 2005
Fig. 2. Western blot analysis showing the relative amounts of NdhH,
NdhI and NdhK in Synechocystis PCC 6803 cells harvested at different
growth phases. Whole-cell extracts were subjected to SDS-PAGE gel
electrophoresis and immunoblotted with antibodies against NdhH, NdhI
and NdhK. Samples containing 5 mg chlorophyll were loaded in each
lane. Cells were cultured for the periods indicated above the top lane.
137
A
Chl fluorescence
100
Relative value (%)
ALon
A
80
60
40
ALoff
RFp
Fo
30 s
6s
20
0
0
B
2
4
6
8
10
Day
12
14
16
B
1 day
10 days
4 days
16 days
100
Relative value (%)
80
60
40
20
0
0
20
40
60
80
Relative amount of NDH-1 (%)
100
Fig. 3. (A) Curves showing the relative amounts of the NAD(P)H dehydrogenase subunits and the relative activities of various reactions. (a)
NdhH ( ), (b) NdhI (*), (c) NdhK (.), (d) initial rate of P700þ reduction
by far-red light (,), (e) initial rise of post-illumination increase of
chlorophyll (Chl) fluorescence (&), (f) light-dependent NADPH oxidation
(&), (g) photosynthetic O2 evolution (^) and (h) respiration (^). The
values in 4-day cells are taken as 100%. Each experiment was repeated
four times and standard errors were calculated. (B) The relative activities
of NADPH oxidation (.), post-illumination increase of Chl fluorescence
(*), P700þ reduction ( ) by far-red light, photosynthetic O2 evolution
(,) and respiration (&) as a function of the relative amounts of
NAD(P)H dehydrogenase (average values for NdhH, NdhI and NdhK).
The linear line with the slope of 1 crosses 0 and 100%.
.
.
fluorescence (Deng et al. 2003a). Both the height and
the relative rate of post-illumination increase in Chl
fluorescence correspond to the amount of NDH-1
(Fig. 4B and curve e in Fig. 3A). Similar results were
obtained on the initial rate of P700þ reduction after
far-red light (curve d in Fig. 3A). The open and closed
circles showing the initial rise of post-illumination
increase of Chl fluorescence and the initial rate of
P700þ reduction by far-red light, respectively, at various
levels of NDH-1 were located close to or on the line
with the slope of 1 (Fig. 3B). These results indicate that
the activity of these reactions is limited by the activity of
NDH-1, which is determined by the amount of NDH-1.
138
Fig. 4. Post-illumination increase in chlorophyll (Chl) fluorescence in
cells of different growth phases. The Chl concentration was adjusted
to 10 mg ml1 before measurement. Actinic light (AL; >645 nm,
200 mE m2 s1) was applied with a cut-off light filter. (A) A typical
Chl fluorescence kinetics of Synechocystis PCC 6803: the area surrounded by a square shows post-illumination increase in Chl fluorescence and the slope of the indicated line given the relative rate of
post-illumination increase in Chl fluorescence (RFp). (B) Recordings of
Chl fluorescence kinetics of 1-, 4-, 10- and 16-day cells.
Photosynthesis and respiration
Photosynthetic oxygen evolution and dark respiration
activity also depend on the growth phase of the cells,
but the relationship was not significant (Fig. 3A and B);
the fluctuation was within 40% for both photosynthesis
and respiration (Table 2 and curves g and h in Fig. 3A),
and the relative activities of oxygen evolution in photosynthesis or oxygen uptake in respiration plotted against
the relative amount of NDH-1 were far above the line
with the slope of 1 (Fig. 3B). Thus, the amount of NDH1 is not limiting the processes of photosynthesis and
respiration, at least under these conditions.
Discussion
In batch cultures, the growth stage of cells is divided
into lag, logarithmic, stationary and decline phases
depending on the growth rate and density of the cells.
Growth rate in culture depends on light intensity and
nutrient concentrations around the cells. During lag to
logarithmic phases, cells are adapting to new
Physiol. Plant. 125, 2005
Table 2. Effects of growth phases on photosynthesis and respiration in
Synechocystis PCC 6803. Mean SE from four independent
experiments.
Growth phases
(days)
Photosynthetic rate
(mmol O2 mg Chl1 h1)
Respiratory rate
(mM O2 mg Chl1 h1)
Lag (1)
Logarithmic (4)
Stationary (10)
Decline (16)
86.7
102.8
81.3
65.6
19.9
22.6
21.1
17.4
3.4
4.6
3.8
3.9
0.2
0.8
0.7
0.3
environments and may require more NDH-1 to increase
the cyclic electron transport activity to optimize photosynthesis. This is reflected by the significant increases in
the amount of NDH-1 and the activity of PSI-cyclic
electron flow during this period. Zhang et al. (2004)
reported that NDH-1L involved in respiration is a
major fraction of NDH-1 in cells grown under high
CO2 condition, while NDH-1M involved in cyclic electron transport is less abundant in these cells. Although
the present study did not distinguish NDH-1L and
NDH-1M, we may assume that NDH-1L is a major
fraction of NDH-1 in cells grown under high CO2
condition used in this study and that the amount of
NDH-1M is proportional to the total amount of NDH1 complexes. The existence of the correlation between
the amount of NDH-1 and the activity of light-induced
NADPH oxidation and PSI-cyclic electron flow supports
the notion that these reactions are mediated by NDH-1,
most likely by NDH-1M (Deng et al. 2003a, Mi et al.
1995, Zhang et al. 2004).
A number of investigations have demonstrated a protective role for cyclic electron transport in response to
stressful conditions, such as salt stress (Hibino et al.
1996, Tanaka et al. 1997), low CO2 (Deng et al.
2003a) and strong light (Mi et al. 2001) in cyanobacteria
and oxidative stress (Martin et al. 1996), water stress
(Burrow et al. 1998) and photoinhibition (Endo et al.
1999) in higher plants. During the lag phase, cells may
be exposed to oxidative and/or strong light stresses and
possibly nutrient stress. Cyclic electron flow may be
required to alleviate cells from these stresses. After the
logarithmic phase, the growth rate slowed down to
nearly zero after 16 days of culture, although there
was no significant decrease in the activity of photosynthetic O2 evolution when the initial rate was measured
upon illumination with strong light. The availability of
light and/or nutrients under the conditions of batch
culture would limit the growth of the cells after the
logarithmic phase. Our results indicate that the expression of NDH-1 was suppressed under such conditions.
Although the NDH-1 complex is an important component of the respiratory electron flow, the correlation
Physiol. Plant. 125, 2005
between the activity of respiration and the amount of
NDH-1 was not significant. Because we grew the cells
under high CO2 conditions, the major fraction of NDH1 is considered to be NDH-1L (Zhang et al. 2004). Thus,
the amount and the activity of NDH-1L are high enough
even in 16-day cells and do not appear to be limiting the
respiratory activity. Furthermore, photosynthetic activity
showed the same trend as the respiration activity and
did not change significantly in cells of different growth
phases. Therefore, the contribution of NDH-1-mediated
cyclic electron flow to photosynthesis appears to be
small under the conditions for the measurement of O2
evolution. However, it is possible that the reduced
activity of cyclic electron transport after the logarithmic
phase is partially responsible for the deceleration of the
growth rate. Taken together, these results suggested that
the activity of light-dependent NADPH oxidation and
PSI-cyclic electron flow are restricted by the amount of
NDH-1, and other factor(s) are limiting the rates of
photosynthesis and respiration.
Acknowledgements – We thank Dr T. Ogawa, retired professor of Nagoya University and visiting professor of the
Institute of Plant Physiology and Ecology, Shanghai
Institutes for Biological Sciences, for reviewing the manuscript and fruitful discussion. This work was supported in part
by grants from the National Natural Science Foundation of
China (no. 30270123 and no. 90306013).
References
Allen MM (1968) Simple conditions for growth of unicellular
blue-green algae on plates. J Phycol 4: 1–4
Asada K, Heber U, Schreiber U (1993) Electron flow to the
intersystem chain from stromal components and cyclic
electron flow in maize chloroplasts, as detected in intact
leaves by monitoring redox change of P700 and chlorophyll fluorescence. Plant Cell Physiol 34: 39–50
Battchikova N, Zhang P, Rudd S, Ogawa T, Aro EM (2005)
Identification of NdhL and Ssl1690 (NdhO) in NDH-1L
and NDH-1M complexes of Synechocystis sp. PCC 6803. J
Biol Chem 280: 2587–2595
Burrows PA, Sazanov LA, Svab Z, Maliga P, Nixon PJ (1998)
Identification of a functional respiratory complex in
chloroplasts through analysis of tobacco mutants containing disrupted plastid ndh genes. EMBO J 17: 868–876
Deng Y, Ye J, Mi H (2003a) Effects of low CO2 on NAD(P)H
dehydrogenase, a mediator of cyclic electron transport
around photosystem I in the cyanobacterium
Synechocystis PCC 6803. Plant Cell Physiol 44: 534–540
Deng Y, Ye J, Mi H, Shen Y (2003b) Response of
NAD(P)H dehydrogenase complex to the alteration of CO2
concentration in the cyanobacterium Synechocystis PCC
6803. J Plant Physiol 160: 967–970
139
Endo T, Shikanai T, Takabayashi A, Asada K, Sato F (1999)
The role of chloroplastic NAD(P)H dehydrogenase in
photoprotection. FEBS Lett 457: 5–8.
Hibino T, Lee BH, Rai AK, Ishikawa H, Kojima H, Tawada M,
Shimoyama H, Takabe T (1996) Salt enhances photosystem I content and cyclic electron flow via NAD(P)H
dehydrogenase in the halotolerant cyanobacterium
Aphanothece halophytica. Aust J Plant Physiol 23: 321–330
Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y,
Miyajima N, Hirosawa M, Sugiura M, Sasamoto S, Kimura T,
Hosouchi T, Matsuno A, Muraki A, Nakazaki N, Naruo K,
Okumura S, Shimpo S, Takeuchi C, Wada T, Watanabe A,
Yamada M, Yasuda M, Tabata S (1996) Sequence analysis
of the genome of the unicellular cyanobacterium
Synechocystis sp. strain PCC 6803. II. Sequence determination of the entire genome and assignment of potential
protein-coding regions. DNA Res 3: 109–136
Klughammer C, Schreiber U (1998) Measuring P700 absorbance changes in the near infrared spectral region with a
dual wavelength pulse modulation system. In: Grab G (ed)
Photosynthesis: Mechanisms and Effects, Vol. V. Kluwer
Academic Publishers, Dordrecht, pp 4657–4660
Laemmli UK (1970) Cleavage of structural proteins during
the assembly of the head of bacteriophage T4. Nature 227:
680–685
Mano J, Miyake C, Schreiber U, Asada K (1995)
Photoactivation of the electron flow from NADPH to
plastoquinone in spinach chloroplasts. Plant Cell Physiol
36: 1589–1598
Martin M, Casano LM, Sabater B (1996) Identification of the
product of ndhA gene as a thylakoid protein synthesized in
response to photooxidative treatment. Plant Cell Physiol
37: 293–298
Mi H, Deng Y, Tanaka Y, Hibino T, Takabe T (2001) Photoinduction of an NADPH dehydrogenase which functions
as a mediator of electron transport to the intersystem chain
in the cyanobacterium Synechocystis PCC 6803. Photosyn
Res 70: 167–172
Mi H, Endo T, Ogawa T, Asada K (1995) Thylakoid membrane-bound pyridine nucleotide dehydrogenase complex
mediates cyclic electron transport in the cyanobacteria
Synechocystis PCC 6803. Plant Cell Physiol 36: 661–668
Mi H, Endo T, Schreiber U, Asada K (1992a) Donation of
electrons to the intersystem chain in the cyanobacterium
Synechocystis sp. PCC 7002. Plant Cell Physiol 33:
1099–1105
Mi H, Endo T, Schreiber U, Ogawa T, Asada K (1992b)
Electron donation from cyclic and respiratory flows to the
photosynthetic intersystem chain is mediated by pyridine
nucleotide dehydrogenase in the cyanobacterium
Synechocystis PCC 6803. Plant Cell Physiol 33:
1233–1237
Mi H, Endo T, Schreiber U, Ogawa T, Asada K (1994)
NAD(P)H-dehydrogenase-dependent cyclic electron flow
around photosystem I in the cyanobacterium
Synechocystis PCC 6803: a study of dark-starved cells and
spheroplasts. Plant Cell Physiol 35: 163–173
Nixon PJ, Gounaris K, Coomber SA, Hunter CN, Dyer TA,
Barber J (1989) psbG is not a photosystem two gene but
may be an ndh gene. J Biol Chem 264: 14129–14135
Ogawa T (1991) A gene homologous to the subunit-2 gene of
NADH dehydrogenase is essential to inorganic carbon
transport of Synechocystis PCC 6803. Proc Natl Acad Sci
USA 88: 4275–4279
Ohyama K, Fukuzawa H, Kohchi T, Shirai H, Sano T, Sano S,
Umersono K, Inokuchi H, Ozeki H (1986) Chloroplast
gene organization deduced from complete sequence of
liverwort Marchantia polymorpha chloroplast DNA.
Nature 322: 572–574
Prommeenate P, Lennon AM, Markert C, Hippler M, Nixon PJ
(2004) Subunit composition of NDH-1 complexes
of Synechocystis sp. PCC 6803: identification of two
new ndh gene products with nuclear-encoded homologues in the chloroplast Ndh complex. J Biol Chem 279:
28165–28173
Steinmüller K (1992) Nucleotide sequence and expression of
the ndhH gene of the cyanobacterium Synechocystis sp.
PCC 6803. Plant Mol Biol 18: 135–137
Tanaka Y, Katada S, Ishikawa H, Ogawa T, Takabe T (1997)
Electron flow from NAD(P)H dehydrogenase to photosystem I is required for adaptation to salt shock in the cyanobacterium Synechocystis sp. PCC 6803. Plant Cell
Physiol 38: 1311–1318
Zhang P, Battchikova N, Jansen T, Appel J, Ogawa T, Aro EM
(2004) Expression and functional roles of the two distinct
NDH-1 complexes and the carbon acquisition complex
NdhD3/NdhF3/CupA/Sll1735 in Synechocystis sp. PCC
6803. Plant Cell 16: 3326–3340
Edited by E.-M. Aro
140
Physiol. Plant. 125, 2005