Survey							
                            
		                
		                * Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Copyright ß Physiologia Plantarum 2005, ISSN 0031-9317 Physiologia Plantarum 125: 135–140. 2005 Expression and activity of type 1 NAD(P)H dehydrogenase at different growth phases of the cyanobacterium, Synechocystis PCC 6803 Weimin Ma and Hualing Mi* National Laboratory of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Graduate School of the Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032, China Correspondence *Corresponding author, e-mail: [email protected] Received 9 March 2005; revised 24 May 2005 doi: 10.1111/j.1399-3054.2005.00555.x The expression and activity of type 1 NAD(P)H dehydrogenase (NDH-1) were investigated in Synechocystis PCC 6803 cells during different growth phases (i.e. lag, logarithmic, stationary and decline phases). The relative amount of NDH-1, estimated by Western blot analysis using antibodies against NdhH, NdhI and NdhK, increased more than two-fold during growth from the lag to the logarithmic phase and then decreased after the logarithmic phase to reach lowest levels after 15 days (decline phase). The activity of light-dependent NADPH oxidation and cyclic electron flow around photosystem I (PSI) changed nearly in parallel with the amount of NdhH, NdhI and NdhK in cells across the growth phases. In contrast, the activity of photosynthetic O2 evolution and respiratory O2 uptake was not significantly different across phases of growth; the fluctuation of the activity at different phases was within 40%. These results suggested that the activity of light-dependent NADPH oxidation and PSI-cyclic electron flow are restricted by the amount of NDH-1 and that other factor(s) are limiting the rates of photosynthesis and respiration. Introduction Cyanobacteria are globally distributed photosynthetic organisms that grow well in a wide range of natural environments. In laboratory batch cultures, cyanobacterial growth stages are divided into lag, logarithmic, stationary and decline phases, depending on growth rate and cell density. The decrease in growth rate after the logarithmic phase is considered to be a result of limited availability of light energy and/or nutrients. However, few studies have examined this in cells across different growth phases. The enzyme type 1 NAD(P)H dehydrogenase (NDH1) consists of two complexes in cyanobacteria. Each complex contains more than 15 subunits (Battchikova et al. 2005, Nixon et al. 1989, Prommeenate et al. 2004, Steinmüller 1992, Zhang et al. 2004), which are encoded by genes homologous to the chloroplast and mitochondrial ndh genes (Kaneko et al. 1996, Ohyama et al. 1986). Cyanobacterial NDH-1 complexes have a unique function in that they are involved in photosystem I (PSI)-cyclic electron flow and CO2 uptake (Mi et al. 1992a, 1992b, 1994, 1995, Ogawa 1991). In addition, the activity and amounts of the subunits of NDH-1 complexes are inducible by changing environmental conditions, such as elevating light levels (Mi et al. 2001), reducing CO2 (Deng et al. 2003a, 2003b, Zhang et al. 2004) and adding excess salt (Hibino Abbreviations – FNR, ferredoxin-NADPþ oxidoreductase; NDH-1, type 1 NAD(P)H dehydrogenase; PSI, photosystem I; RFp, initial rate of post-illumination increase in chlorophyll (Chl) fluorescence. Physiol. Plant. 125, 2005 135 et al. 1996). This inducible property of NDH-1 suggests that it may have a protective role for the NDH-1 complexes under stressful conditions. The current study examined the effects of growth phase on cellular levels and activity of NDH-1. The relative amounts of each of the three subunits of NDH1 in Synechocystis PCC 6803 cells at different growth phases were measured, together with the activity of light-dependent NADPH oxidation, PSI-cyclic electron flow, photosynthetic O2 evolution and respiratory O2 uptake. The amount of NDH-1 was highly dependent on the growth phase and significantly correlated with the activity of NADPH oxidation and PSI-cyclic electron flow; however, there was not a significant correlation between NDH-1 levels and photosynthesis and respiratory activity. Materials and methods Culture and determination of cell density Synechocystis PCC 6803 cells were cultured at 30 C in BG-11 medium, (Allen 1968) buffered with Tris–HCl (5 mM, pH 8.0) and bubbled with 2% (v/v) CO2 in air under continuous illumination by fluorescent lamps (60 mE m2 s1). The cell density was determined every 24 h by measuring the absorbance at 730 nm using a spectrophotometer (UV3000, Shimadzu, Kyoto, Japan). Western analysis and light-dependent NADPH oxidation SDS-PAGE electrophoresis was carried out on 12% polyacrylamide gels according to the method of Laemmli (1970). Western blot analysis was performed with an ECL assay kit (Amersham Pharmacia, NJ), according to the manufacturer’s protocol. Antibodies against the NDH1 subunits (NdhH, NdhI and NdhK) of Synechocystis PCC 6803 were raised in our laboratory. To amplify ndhH, ndhI and ndhK, the primer sequences as summarized in (Table 1) were designed. The polymerase chain reaction products were ligated into vector pET32a, and the construct was amplified in Escherichia coli DH-5a. The plasmid was used to transform E. coli strain BL21 (DE3) pLysS for expression. The gene expression products from E. coli were purified and used as antigens to immunize rabbits to produce polyclonal antibodies. Light-dependent NADPH oxidation was performed as described by Deng et al. (2003a). Whole-cell extracts were diluted with medium A to a chlorophyll (Chl) concentration of 5 mg per 3 ml and supplemented with 10 mM 3-(3, 4-dichlorophenyl)-1, 1-dimethyl urea (DCMU), 0.25 mM NaN3, 0.1 mM KCN and 0.2% (v/v) Triton X-100. Reaction mixtures were pre-illuminated with actinic light (AL) for 2 min to activate NDH-1, and then 100 mM NADPH was added. The rates of NADPH oxidation were measured at 25 C as a decrease in 340-nm absorbance after application of AL (>660 nm, 200 mE m2 s1). An extinction coefficient of 6.22 mM1 cm1 was used to calculate the NADPH concentrations. Isolation of whole-cell extracts Cells harvested by centrifugation (5000 g for 5 min at 4 C) were suspended in medium A [10 mM HEPESNaOH, 5 mM sodium phosphate (pH 7.5), 10 mM MgCl2 and 10 mM NaCl], supplemented with 25% glycerol and were disrupted by 5 · 20-s pulses with a Bead-beater (Biospec, Bartlesville, OK) followed by a 3-min incubation on ice. The homogenate was centrifuged at 5000 g for 5 min at 4 C to remove unbroken cells and debris. Membranes in the supernatant were solubilized with 1% (w/v) N-dodecyl-b-D-maltoside while shaking on ice for 1 h. The samples were then immediately subjected to SDS-PAGE. Redox changes of plastoquinone and P700+ Cells were suspended in fresh BG-11 medium buffered with Tris–HCl (5 mM, pH 8.0) at a Chl concentration of 10 mg ml1. Chl fluorescence and absorbance changes at 810 minus 830 nm were measured to monitor the redox changes of plastoquinone (PQ) and reduction of P700þ after far-red light illumination (FR, >705 nm, 5.2 mM m2s1), respectively. A PAM Chl fluorometer (Walz, Effeltrich, Germany) and an emitter-detectorcuvette assembly (ED-101US) with a unit 101ED or a unit ED-P700DW-II were used for these measurements, as described by Klughammer and Schreiber (1998). Table 1. Primer sequences for amplifying ndhH, ndhI and ndhK. Gene Forward primers (50 30 ) Reverse primers (50 30 ) NdhH NdhI NdhK TTAAGGATCCATGACCAAGATTGAAACCAGA ACGGGATCCGTATGTTTAACAACATTCTC CCTAGGATCCATGAGTCCCAACCCTGCTAAC GCAAAAGCTTCTAGCGGTCCACCGATCCCAT AACTCTGCAGCTATTCTGCTTTCACCAA GTTCAAGCTTTCAGCCACGGTTTAATTGCTC 136 Physiol. Plant. 125, 2005 Photosynthetic oxygen evolution and respiration Oxygen evolution by photosynthesis and uptake by respiration were measured at 25 C (Hansatech, Hertfordshire, UK) with a Clark-type oxygen electrode according to the method described by Mi et al. (1995). Cells were suspended in BG-11 medium at a Chl concentration of 20 mg ml1. The intensity of AL used for the measurement of photosynthetic oxygen evolution was 800 mE m2 s1. Results Amount of NDH-1 in cells at different growth phases Synechocystis PCC 6803 growth can be divided into four phases. The designation of growth phase depends on the growth rate and density of the cells, i.e. lag (0–2 days), logarithmic (2–8 days), stationary (8–15 days) and decline (after 15 days) phases (Fig. 1). Cells harvested 1, 4, 10 and 16 days (designated 1-, 4-, 10- and 16-day cells, respectively) after inoculation of stationary phase cells to a new culture medium were used to represent each phase. The amount of NDH-1 in cells is strongly dependent on their growth phase. Western blot analysis with antibodies against NdhH, NdhI and NdhK indicated that the amount of these subunits was highest in 4-day cells in the logarithmic phase and then decreased after this phase to very low levels in 16-day cells (Fig. 2 and curves a–c in Fig. 3). PSI-cyclic electron transport The activity of PSI-cyclic electron transport was monitored by measuring the activities of three different 3 Lag Logarithmic Stationary Decline reactions: (1) light-induced NADPH oxidation, (2) post-illumination increase of Chl fluorescence and (3) initial rate of P700þ reduction. NADPH oxidation was measured in the light without adding artificial electron acceptor (Deng et al., 2003a). Under these conditions, there was no NADPH oxidation in the dark due to the diaphorase activity of ferredoxin-NADPþ oxidoreductase. The activity of light-dependent NADPH oxidation was 0.9, 2.3, 1.3 and 0.6 · 101 mM min1 mg Chl1, respectively, in 1-, 4-, 10- and 16-day cells. The change of the amount of NDH-1 was corresponding with that of NADPH oxidation activity during different growth phases (curves a–c and f in Fig. 3A). The closed triangles showing the relative activity of NADPH oxidation at various levels of NDH-1 (the average values for NdhH, NdhI and NdhK are taken) were located near the line with the slope of 1 (Fig. 3B). Thus, there exists a significant correlation between the amount of NDH-1 complexes and the NADPH oxidation activity in cells of different phases. The results indicate that the PSIdriven NADPH oxidation reflects the NADPH-oxidizing activity of NDH-1. Western blot analysis of the thylakoid membranes after various dilutions indicated that there existed a linearity between the densities of the spots and the amount of proteins in the range of protein concentrations used in Fig. 2, except that the density dropped sharply off the linearity line when the protein concentration was below a certain level (data not shown). This would explain the extremely low levels of NdhH and NdhI in 16-day cells (Fig. 2). Post-illumination increase in Chl fluorescence is considered to reflect the reduction of PQ by NAD(P)H or other reducing substances accumulated under light. In higher plants and cyanobacteria, this increase in Chl fluorescence represents the activity of PSI-cyclic electron transport (Asada et al. 1993, Mano et al. 1995, Mi et al. 1995). Typical Chl fluorescence kinetics of Synechocystis PCC 6803 is shown in Fig. 4A, and the area surrounded by the square shows a post-illumination increase in Chl A730 nm 2 1 day 4 days 10 days 16 days NdhH 46 kDa NdhI 24 kDa NdhK 27 kDa 1 0 0 2 4 6 8 10 Day 12 14 16 18 Fig. 1. Growth curve of Synechocystis PCC 6803 cells and definition of various phases. The vertical bars indicate standard errors calculated from three independent experiments. Physiol. Plant. 125, 2005 Fig. 2. Western blot analysis showing the relative amounts of NdhH, NdhI and NdhK in Synechocystis PCC 6803 cells harvested at different growth phases. Whole-cell extracts were subjected to SDS-PAGE gel electrophoresis and immunoblotted with antibodies against NdhH, NdhI and NdhK. Samples containing 5 mg chlorophyll were loaded in each lane. Cells were cultured for the periods indicated above the top lane. 137 A Chl fluorescence 100 Relative value (%) ALon A 80 60 40 ALoff RFp Fo 30 s 6s 20 0 0 B 2 4 6 8 10 Day 12 14 16 B 1 day 10 days 4 days 16 days 100 Relative value (%) 80 60 40 20 0 0 20 40 60 80 Relative amount of NDH-1 (%) 100 Fig. 3. (A) Curves showing the relative amounts of the NAD(P)H dehydrogenase subunits and the relative activities of various reactions. (a) NdhH ( ), (b) NdhI (*), (c) NdhK (.), (d) initial rate of P700þ reduction by far-red light (,), (e) initial rise of post-illumination increase of chlorophyll (Chl) fluorescence (&), (f) light-dependent NADPH oxidation (&), (g) photosynthetic O2 evolution (^) and (h) respiration (^). The values in 4-day cells are taken as 100%. Each experiment was repeated four times and standard errors were calculated. (B) The relative activities of NADPH oxidation (.), post-illumination increase of Chl fluorescence (*), P700þ reduction ( ) by far-red light, photosynthetic O2 evolution (,) and respiration (&) as a function of the relative amounts of NAD(P)H dehydrogenase (average values for NdhH, NdhI and NdhK). The linear line with the slope of 1 crosses 0 and 100%. . . fluorescence (Deng et al. 2003a). Both the height and the relative rate of post-illumination increase in Chl fluorescence correspond to the amount of NDH-1 (Fig. 4B and curve e in Fig. 3A). Similar results were obtained on the initial rate of P700þ reduction after far-red light (curve d in Fig. 3A). The open and closed circles showing the initial rise of post-illumination increase of Chl fluorescence and the initial rate of P700þ reduction by far-red light, respectively, at various levels of NDH-1 were located close to or on the line with the slope of 1 (Fig. 3B). These results indicate that the activity of these reactions is limited by the activity of NDH-1, which is determined by the amount of NDH-1. 138 Fig. 4. Post-illumination increase in chlorophyll (Chl) fluorescence in cells of different growth phases. The Chl concentration was adjusted to 10 mg ml1 before measurement. Actinic light (AL; >645 nm, 200 mE m2 s1) was applied with a cut-off light filter. (A) A typical Chl fluorescence kinetics of Synechocystis PCC 6803: the area surrounded by a square shows post-illumination increase in Chl fluorescence and the slope of the indicated line given the relative rate of post-illumination increase in Chl fluorescence (RFp). (B) Recordings of Chl fluorescence kinetics of 1-, 4-, 10- and 16-day cells. Photosynthesis and respiration Photosynthetic oxygen evolution and dark respiration activity also depend on the growth phase of the cells, but the relationship was not significant (Fig. 3A and B); the fluctuation was within 40% for both photosynthesis and respiration (Table 2 and curves g and h in Fig. 3A), and the relative activities of oxygen evolution in photosynthesis or oxygen uptake in respiration plotted against the relative amount of NDH-1 were far above the line with the slope of 1 (Fig. 3B). Thus, the amount of NDH1 is not limiting the processes of photosynthesis and respiration, at least under these conditions. Discussion In batch cultures, the growth stage of cells is divided into lag, logarithmic, stationary and decline phases depending on the growth rate and density of the cells. Growth rate in culture depends on light intensity and nutrient concentrations around the cells. During lag to logarithmic phases, cells are adapting to new Physiol. Plant. 125, 2005 Table 2. Effects of growth phases on photosynthesis and respiration in Synechocystis PCC 6803. Mean SE from four independent experiments. Growth phases (days) Photosynthetic rate (mmol O2 mg Chl1 h1) Respiratory rate (mM O2 mg Chl1 h1) Lag (1) Logarithmic (4) Stationary (10) Decline (16) 86.7 102.8 81.3 65.6 19.9 22.6 21.1 17.4 3.4 4.6 3.8 3.9 0.2 0.8 0.7 0.3 environments and may require more NDH-1 to increase the cyclic electron transport activity to optimize photosynthesis. This is reflected by the significant increases in the amount of NDH-1 and the activity of PSI-cyclic electron flow during this period. Zhang et al. (2004) reported that NDH-1L involved in respiration is a major fraction of NDH-1 in cells grown under high CO2 condition, while NDH-1M involved in cyclic electron transport is less abundant in these cells. Although the present study did not distinguish NDH-1L and NDH-1M, we may assume that NDH-1L is a major fraction of NDH-1 in cells grown under high CO2 condition used in this study and that the amount of NDH-1M is proportional to the total amount of NDH1 complexes. The existence of the correlation between the amount of NDH-1 and the activity of light-induced NADPH oxidation and PSI-cyclic electron flow supports the notion that these reactions are mediated by NDH-1, most likely by NDH-1M (Deng et al. 2003a, Mi et al. 1995, Zhang et al. 2004). A number of investigations have demonstrated a protective role for cyclic electron transport in response to stressful conditions, such as salt stress (Hibino et al. 1996, Tanaka et al. 1997), low CO2 (Deng et al. 2003a) and strong light (Mi et al. 2001) in cyanobacteria and oxidative stress (Martin et al. 1996), water stress (Burrow et al. 1998) and photoinhibition (Endo et al. 1999) in higher plants. During the lag phase, cells may be exposed to oxidative and/or strong light stresses and possibly nutrient stress. Cyclic electron flow may be required to alleviate cells from these stresses. After the logarithmic phase, the growth rate slowed down to nearly zero after 16 days of culture, although there was no significant decrease in the activity of photosynthetic O2 evolution when the initial rate was measured upon illumination with strong light. The availability of light and/or nutrients under the conditions of batch culture would limit the growth of the cells after the logarithmic phase. Our results indicate that the expression of NDH-1 was suppressed under such conditions. Although the NDH-1 complex is an important component of the respiratory electron flow, the correlation Physiol. Plant. 125, 2005 between the activity of respiration and the amount of NDH-1 was not significant. Because we grew the cells under high CO2 conditions, the major fraction of NDH1 is considered to be NDH-1L (Zhang et al. 2004). Thus, the amount and the activity of NDH-1L are high enough even in 16-day cells and do not appear to be limiting the respiratory activity. Furthermore, photosynthetic activity showed the same trend as the respiration activity and did not change significantly in cells of different growth phases. Therefore, the contribution of NDH-1-mediated cyclic electron flow to photosynthesis appears to be small under the conditions for the measurement of O2 evolution. However, it is possible that the reduced activity of cyclic electron transport after the logarithmic phase is partially responsible for the deceleration of the growth rate. Taken together, these results suggested that the activity of light-dependent NADPH oxidation and PSI-cyclic electron flow are restricted by the amount of NDH-1, and other factor(s) are limiting the rates of photosynthesis and respiration. Acknowledgements – We thank Dr T. Ogawa, retired professor of Nagoya University and visiting professor of the Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, for reviewing the manuscript and fruitful discussion. This work was supported in part by grants from the National Natural Science Foundation of China (no. 30270123 and no. 90306013). References Allen MM (1968) Simple conditions for growth of unicellular blue-green algae on plates. J Phycol 4: 1–4 Asada K, Heber U, Schreiber U (1993) Electron flow to the intersystem chain from stromal components and cyclic electron flow in maize chloroplasts, as detected in intact leaves by monitoring redox change of P700 and chlorophyll fluorescence. Plant Cell Physiol 34: 39–50 Battchikova N, Zhang P, Rudd S, Ogawa T, Aro EM (2005) Identification of NdhL and Ssl1690 (NdhO) in NDH-1L and NDH-1M complexes of Synechocystis sp. PCC 6803. J Biol Chem 280: 2587–2595 Burrows PA, Sazanov LA, Svab Z, Maliga P, Nixon PJ (1998) Identification of a functional respiratory complex in chloroplasts through analysis of tobacco mutants containing disrupted plastid ndh genes. EMBO J 17: 868–876 Deng Y, Ye J, Mi H (2003a) Effects of low CO2 on NAD(P)H dehydrogenase, a mediator of cyclic electron transport around photosystem I in the cyanobacterium Synechocystis PCC 6803. Plant Cell Physiol 44: 534–540 Deng Y, Ye J, Mi H, Shen Y (2003b) Response of NAD(P)H dehydrogenase complex to the alteration of CO2 concentration in the cyanobacterium Synechocystis PCC 6803. J Plant Physiol 160: 967–970 139 Endo T, Shikanai T, Takabayashi A, Asada K, Sato F (1999) The role of chloroplastic NAD(P)H dehydrogenase in photoprotection. FEBS Lett 457: 5–8. Hibino T, Lee BH, Rai AK, Ishikawa H, Kojima H, Tawada M, Shimoyama H, Takabe T (1996) Salt enhances photosystem I content and cyclic electron flow via NAD(P)H dehydrogenase in the halotolerant cyanobacterium Aphanothece halophytica. Aust J Plant Physiol 23: 321–330 Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N, Hirosawa M, Sugiura M, Sasamoto S, Kimura T, Hosouchi T, Matsuno A, Muraki A, Nakazaki N, Naruo K, Okumura S, Shimpo S, Takeuchi C, Wada T, Watanabe A, Yamada M, Yasuda M, Tabata S (1996) Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC 6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res 3: 109–136 Klughammer C, Schreiber U (1998) Measuring P700 absorbance changes in the near infrared spectral region with a dual wavelength pulse modulation system. In: Grab G (ed) Photosynthesis: Mechanisms and Effects, Vol. V. Kluwer Academic Publishers, Dordrecht, pp 4657–4660 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685 Mano J, Miyake C, Schreiber U, Asada K (1995) Photoactivation of the electron flow from NADPH to plastoquinone in spinach chloroplasts. Plant Cell Physiol 36: 1589–1598 Martin M, Casano LM, Sabater B (1996) Identification of the product of ndhA gene as a thylakoid protein synthesized in response to photooxidative treatment. Plant Cell Physiol 37: 293–298 Mi H, Deng Y, Tanaka Y, Hibino T, Takabe T (2001) Photoinduction of an NADPH dehydrogenase which functions as a mediator of electron transport to the intersystem chain in the cyanobacterium Synechocystis PCC 6803. Photosyn Res 70: 167–172 Mi H, Endo T, Ogawa T, Asada K (1995) Thylakoid membrane-bound pyridine nucleotide dehydrogenase complex mediates cyclic electron transport in the cyanobacteria Synechocystis PCC 6803. Plant Cell Physiol 36: 661–668 Mi H, Endo T, Schreiber U, Asada K (1992a) Donation of electrons to the intersystem chain in the cyanobacterium Synechocystis sp. PCC 7002. Plant Cell Physiol 33: 1099–1105 Mi H, Endo T, Schreiber U, Ogawa T, Asada K (1992b) Electron donation from cyclic and respiratory flows to the photosynthetic intersystem chain is mediated by pyridine nucleotide dehydrogenase in the cyanobacterium Synechocystis PCC 6803. Plant Cell Physiol 33: 1233–1237 Mi H, Endo T, Schreiber U, Ogawa T, Asada K (1994) NAD(P)H-dehydrogenase-dependent cyclic electron flow around photosystem I in the cyanobacterium Synechocystis PCC 6803: a study of dark-starved cells and spheroplasts. Plant Cell Physiol 35: 163–173 Nixon PJ, Gounaris K, Coomber SA, Hunter CN, Dyer TA, Barber J (1989) psbG is not a photosystem two gene but may be an ndh gene. J Biol Chem 264: 14129–14135 Ogawa T (1991) A gene homologous to the subunit-2 gene of NADH dehydrogenase is essential to inorganic carbon transport of Synechocystis PCC 6803. Proc Natl Acad Sci USA 88: 4275–4279 Ohyama K, Fukuzawa H, Kohchi T, Shirai H, Sano T, Sano S, Umersono K, Inokuchi H, Ozeki H (1986) Chloroplast gene organization deduced from complete sequence of liverwort Marchantia polymorpha chloroplast DNA. Nature 322: 572–574 Prommeenate P, Lennon AM, Markert C, Hippler M, Nixon PJ (2004) Subunit composition of NDH-1 complexes of Synechocystis sp. PCC 6803: identification of two new ndh gene products with nuclear-encoded homologues in the chloroplast Ndh complex. J Biol Chem 279: 28165–28173 Steinmüller K (1992) Nucleotide sequence and expression of the ndhH gene of the cyanobacterium Synechocystis sp. PCC 6803. Plant Mol Biol 18: 135–137 Tanaka Y, Katada S, Ishikawa H, Ogawa T, Takabe T (1997) Electron flow from NAD(P)H dehydrogenase to photosystem I is required for adaptation to salt shock in the cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol 38: 1311–1318 Zhang P, Battchikova N, Jansen T, Appel J, Ogawa T, Aro EM (2004) Expression and functional roles of the two distinct NDH-1 complexes and the carbon acquisition complex NdhD3/NdhF3/CupA/Sll1735 in Synechocystis sp. PCC 6803. Plant Cell 16: 3326–3340 Edited by E.-M. Aro 140 Physiol. Plant. 125, 2005