Download PDF - Wiley Online Library

FEMS Microbiology Letters 219 (2003) 75^79
www.fems-microbiology.org
A TPR-family membrane protein gene is required for
light-activated heterotrophic growth of the cyanobacterium
Synechocystis sp. PCC 6803
Renqiu Kong, Xudong Xu , Zhengyu Hu
Institute of Hydrobiology, the Chinese Academy of Sciences, Wuhan, Hubei 430072, PR China
Received 30 October 2002; received in revised form 4 December 2002; accepted 5 December 2002
First published online 16 January 2003
Abstract
The unicellular cyanobacterium Synechocystis sp. PCC6803 can grow heterotrophically in complete darkness, given that a brief period
of illumination is supplemented every day (light-activated heterotrophic growth, LAHG), or under very weak ( 6 0.5 Wmol m32 s31 ) but
continuous light. By random insertion of the genome with an antibiotic resistance cassette, mutants defective in LAHG were generated. In
two identical mutants, sll0886, a tetratricopeptide repeat (TPR)-family membrane protein gene, was disrupted. Targeted insertion of
sll0886 and three downstream genes showed that the phenotype was not due to a polar effect. The sll0886 mutant shows normal
photoheterotrophic growth when the light intensity is at 2.5 Wmol m32 s31 or above, but no growth at 0.5 Wmol m32 s31 . Homologs to
sll0886 are also present in cyanobacteria that are not known of LAHG. sll0886 and homologs may be involved in controlling different
physiological processes that respond to light of low fluence.
7 2003 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
Keywords : Light-activated heterotrophic growth; Tetratricopeptide repeat-family protein ; Gene; Synechocystis PCC6803
1. Introduction
Cyanobacteria are a group of prokaryotic microbes that
carry out plant-like oxygenic photosynthesis. For the
study of certain physiological processes in plants, a unicellular cyanobacterium Synechocystis sp. PCC 6803 (Synechocystis 6803) is widely used as a model species. Like
higher plants, some processes of this strain are regulated in
response to very weak light. Cells of Synechocystis 6803
move towards visible light and away from UV light on
plates. For a positive phototactic response, the intensity
of white stimulant light could be as low as 0.002 Wmol m32
s31 [1]. A phytochrome-like photoreceptor and CheA/
CheY-type signal transduction system are required for
the phototactic movements [2,3]. Synechocystis 6803 is incapable of chemoheterotrophic growth on glucose under
conditions without any light [4]. Using a glucose-tolerant
variant, Anderson and McIntosh [5] found that Synechocystis 6803 grew heterotrophically in darkness when sup-
* Corresponding author. Fax: +86 (27) 87875132.
E-mail address : [email protected] (X. Xu).
plemented with a short period light pulse every day and
that the intensity of the light pulse could be 0.5 Wmol
m32 s31 . The light-activated heterotrophic growth
(LAHG) was only responsive to blue light with maximal
sensitivity at 450 nm and not reversible by red light, which
is similar to a blue-light response in plants. The physiological basis for the LAHG is largely unknown.
Apparently, the LAHG includes at least two basic biological processes, light-sensing/signal transduction and heterotrophic growth. A phytochrome-like gene, plpA, was
found to be necessary to autotrophic growth in blue-light,
but no information on its e¡ect on LAHG was documented [6]. A photolyase-like protein in Synechocystis
6803, presumptively a bacterial cryptochrome, could be
an alternative blue-light photoreceptor in the light-sensing
process [7]. To analyze the light-sensing/signal transduction pathway, we employed a random insertion method
to isolate mutants that are defective in LAHG but unchanged in photoheterotrophic growth. In this report, we
present genetic evidence that a tetratricopeptide repeat
(TPR)-family membrane protein is required for the
LAHG of Synechocystis 6803. TPR motif is a degenerate
conserved sequence of 34 amino acid residues and known
0378-1097 / 03 / $22.00 7 2003 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
doi:10.1016/S0378-1097(02)01205-3
FEMSLE 10824 6-2-03
76
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
for its role in protein interactions [8,9]. Proteins of TPR
family could be involved in variable biological processes,
such as organelle targeting [10], protein complex formation [11] and signal transduction [12]. In human, the TPR
protein 1, Tpr1, and the protein serine/threonine phosphatase 5 that contains the TPR motif speci¢cally interact
with a blue-light photoreceptor hCRY2 [13].
2. Materials and methods
2.1. Culture conditions for the cyanobacterium
Synechocystis 6803 was from J. Zhao of Peking University. The cyanobacterium was grown in BG11 medium in
50-ml £asks in the light (V50 Wmol m32 s31 ) at 28V30‡C
without shaking. To the media for culture of C.K2-containing strains, kanamycin was added to 10 Wg ml31 .
Tests of autotrophic growth of the mutants were done
under light of V20 Wmol m32 s31 . For photoheterotrophic growth, the strains were cultured in BG11 with 5 mM
glucose and 5 WM DCMU (Sigma) under continuous illumination of 8 Wmol m32 s31 or as described in the text.
For LAHG, the culture was exposed to light of 5 Wmol
m32 s31 for 5 min per day and kept otherwise in darkness.
2.2. DNA manipulations
Genes to be interrupted were ampli¢ed by polymerase
chain reactions using the primers listed in Table 1. The
PCR products were puri¢ed with a glass milk kit (MBI
Fermentas, Canada), restricted with EcoRI and cloned
into pRL500 [14]. Polymerase chain reactions consisted
of initial denaturation at 94‡C for 5 min and 30 cycles
of : 94‡C for 1 min, 60‡C for 1 min, 72‡C for 1 min and
a ¢nal extension at 72‡C for 4 min. The kanamycin-resistance cassette C.K2 was excised from pRL446 [14] with
PvuII. Before insertion of C.K2 into ClaI, HindIII sites of
sll0888 and sll0178 respectively, the cohesive-ends were
¢rst blunted with T4 DNA polymerase (Promega). Because there are two ClaI sites on the PCR fragment containing sll0888, insertion of sll0888 was facilitated by partial digestion of the plasmid.
2.3. Generation of cyanobacterial mutants
Synechocystis 6803 was transformed with plasmids carrying certain genes interrupted by C.K2 or a mixture of
plasmids of a random-insertion library following the procedure for transformation described by William JGK [15].
Transformants or preliminarily identi¢ed mutants were repeatedly streaked on plates and cultured in liquid medium
with kanamycin under photoheterotrophic conditions.
Targeted gene disruptions were con¢rmed by PCR using
the primers listed in Table 1. Locations of C.K2 in the
genomes of randomly generated mutants were determined
by cloning EcoRI fragments containing the interrupted
regions, sequencing from the ends of C.K2 using oligos
5P-TTGAGACACAACGTGGCT-3P and 5P-ACTGGCAGAGCATTACGCTG-3P and searching the CyanoBase
(www.kazusa.or.jp/cyano/cyano.html).
2.4. Bioinformatics
Transmembrane regions were detected using software
packages SOSUI (sosui.proteome.bio.tuat.ac.jp/sosuiframe0.html), and Tmpred (http://www.ch.embnet.org/software/TMPRED_form.html). Similarity searches and identi¢cation of conserved domains were performed using
NCBI (www.ncbi.nlm.nih.gov) BLAST programs.
3. Results and discussion
3.1. Selection of LAHG mutants by a random insertion
method
A gene library of Synechocystis 6803 was constructed by
cloning 2 to 9-kb Sau3AI-cut chromosomal DNA fragments at the BamHI site of pUC19. The library consists
of ca. 22 000 colonies and 70% of them contain inserts.
Total plasmid DNA of the library was partially restricted
with Sau3AI until the majority of the empty vector was
cut once. On an electrophoretogram of total plasmid
DNA, the empty vector band can be easily recognized
and used as an indicator for controlling the partial digestion. The total plasmids linearized as so were ligated with
C.K2, a kanamycin-resistance cassette, excised from
pRL446 with BamHI and electroporated into Escherichia
coli DH10B to construct a secondary random-insertion
library for mutagenesis of Synechocystis 6803. Random
insertion mutants of Synechocystis 6803 were generated
by transformation with total plasmid DNA of the secondary library. Kanamycin-resistant transformants were
tested on plates under mixotrophic and LAHG conditions
respectively. Eight mutants defective in LAHG were selected. One of them was slow in autotrophic growth and
defective in both LAHG and photoheterotrophic growth
(type I), two of them showed normal autotrophic growth
and slower photoheterotrophic growth (type II), while the
rest were similar to wild-type in both autotrophic and
Table 1
A list of the PCR primers (5P s 3P)
sll0886
sll0887
sll0888
sll0178
FEMSLE 10824 6-2-03
1.
2.
1.
2.
1.
2.
1.
2.
ttgaattcggaagaaccgtagatgtca
cagaattcggtcggaagtcaagttcac
acgaattcccactgccatgcactttag
ttgaattcgtagatagccgttaccaaga
ttgaattcgataatgaccctctaaccag
acgaattcaacggtttgacggcgaag
cagaattcgtgtcctcgctcaggtaaca
acgaattctcacttcttctgagtccaac
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
77
Fig. 1. Growth of mutants under di¡erent conditions. (I) targeted gene disruptions with C.K2 cassette ; (II) growth under autotrophic conditions ; (III)
growth under photoheterotrophic conditions ; (IV) growth under LAHG conditions. All data presented are the means of three independent culture measurements.
photoheterotrophic growth (type III). By DNA sequencing
and search of the Cyanobase, two mutants of type III were
found to be identical and disrupted in sll0886. The choromosomal DNA of the two mutants was extracted and used
to transform the wild-type PCC6803. After repeated
streaking on plates and transfer in liquid medium, the
transformants showed the same phenotype as the original
mutants.
3.2. Targeted gene disruptions
Downstream of sll0886 are three open reading frames
whose expression may be a¡ected in the sll0886 mutants.
To make sure that the phenotype of LAHG minus was not
due to a polar e¡ect, targeted interruptions were generated
for each of the ORFs. C.K2, a kanamycin-resistance cassette was inserted at the SmaI site of sll0886, SmaI site of
sll0887, ClaI site of sll0888, and HindIII site of sll0178
respectively in cloned PCR fragments and transformed
into the cyanobacterium by homologous recombinations
(Fig. 1). PCR detections showed that all the mutants
were completely segregated after repeated streaking
(Fig. 2).
sll0887 : :C.K2, sll0888 : :C.K2 and sll0178: : C.K2 grew as
the wild-type. These results indicate that sll0886 but not
any of its downstream genes is required for LAHG. In the
CyanoBase, M. Babykin reported that interruption of
sll0886 at BamHI site with a kanamycin-resistance marker
led to loss of viability of Synechocystis 6803, but did not
describe how the mutant was grown. Because the heterotrophic growth of Synechocystis 6803 can also be undergone under weak but continuous light, we further tested
the photoheterotrophic growth at lower light intensity. In
the light of 2.5 Wmol m32 s31 , starting from 0.015 T 0.010
1
2
3
4
5
6
7
8
23.13
9.42
6.56
4.36
2.32
2.03
3.3. Growth characters of the mutants
The mutants were tested for growth under di¡erent conditions. Because kanamycin was supplemented to the media, a pKW1188-transformed strain of Synechocystis 6803
was used as the wild-type control. This strain is similar to
the original Synechocystis 6803 in growth characters. As
shown in Fig. 1, all the strains showed normal autotrophic
and photoheterotrophic growth. The mutant sll0886 : :
C.K2 was unable to grow under LAHG conditions, while
0.56
( kb )
Fig. 2. PCR detections of targeted gene disruptions. The primers used
are listed in Table 1. Lane 1, sll0886: :C.K2 ; lane 2, sll0886; lane 3,
sll0887: :C.K2 ; lane 4, sll0887; lane 5, sll0888: :C.K2 ; lane 6, sll0888;
lane 7, sll0178: :C.K2 ; lane 8, sll0178.
FEMSLE 10824 6-2-03
78
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
Table 2
Homologs of sll0886 in cyanobacterial strains
Strains
PCC7120
ATCC29133
WH8102
MIT9313
IMS101
ORFs
E-value
all2893
6e-98
Npun-p-1721
4e-97
Synwh-p-130
2e-54
Pmit-p-258
2e-53
Tery-p-3547
8e-84
In each of the strains, only one with the highest similarity is shown.
(OD730 , turbidity of the culture), wild-type and
sll0886: :CK2 grew up to 0.990 T 0.092 and 1.103 T 0.067
respectively in 10 days; at 0.5 Wmol m32 s31 , wild-type
grew up to 0.694 T 0.060, while sll0886: :CK2 showed virtually no growth (OD730 0.053 T 0.036 on the 10th day).
Apparently, the growth of sll0886 mutant on glucose is
strictly dependent on the availability of certain amount
of light. Because sll0886 mutants showed growth similar
to wild-type on glucose in presence of DCMU, this gene is
not directly required for import or metabolism of the sugar or cell division, but is for connection of the light stimulation with growth on glucose.
3.4. sll0886 and homologs encode membrane proteins with
TPR motif structure
The LAHG gene sll0886 is predicted to encode a membrane protein with three copies of TPR motifs. According
to the Cyano2Dbase (proteome project of Synechocystis
6803 in CyanoBase), Sll0886 appears in the thylakoid
membrane fraction. It would be interesting to know
whether this protein also appears in the cytoplasmic membrane fraction and which protein(s) it interacts with. In
our knowledge, the only example that a TPR family protein may be involved in signal transduction for blue light
photoreceptor is in human [13]. Although we need more
evidence to show that Sll0886 is directly involved as a
component in the signal transduction pathway for
LAHG, its e¡ect on the regulation of heterotrophic
growth of Synechocystis 6803 is unambiguous.
Homologs of sll0886 were found in three ¢lamentous
cyanobacteria, Anabaena (or Nostoc) sp. PCC7120, Nostoc
punctiforme ATCC29133, Trichodesmium erythraeum
IMS101, and two unicellular cyanobacteria, Synechococcus
sp. WH8102 and Prochlorococcus marinus MIT9313, but
not in a thermophilic species Thermosynechococcus elongatus BP-1 (Table 2). Unlike Synechocystis 6803, the other
species are either not known of heterotrophic growth or
heterotrophic without requirement of light stimulation. It
is possible that the homologs in these species play a role in
connecting light stimulation to processes other than heterotrophic growth. Even in Synechocystis 6803, it is not
known whether heterotrophic growth is the only process
that requires stimulation of dim blue light. The e¡ects of
light of low £uence (very weak but continuous light or
complete darkness with daily short pulse of light) on other
cyanobacterial species and the possible role of homologs
of sll0886 in the relevant processes merit further investigations.
Acknowledgements
This work was supported by the One-Hundred-Talents
Project of the Chinese Academy of Sciences.
References
[1] Choi, J.S., Chung, Y.H., Moon, Y.J., Kim, C., Watanabe, M., Song,
P.S., Joe, C.O., Bogorad, L. and Park, Y.M. (1999) Photomovement
of the gliding cyanobacterium Synechocystis sp. PCC 6803. Photochem. Photobiol. 70, 95^102.
[2] Yoshihara, S., Suzuki, F., Fujita, H., Geng, X.X. and Ikeuchi, M.
(2000) Novel putative photoreceptor and regulatory genes required
for the positive phototactic movement of the unicellular motile cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol. 41,
1299^1304.
[3] Bhaya, D., Takahashi, A. and Grossman, A.R. (2001) Light regulation of type IV pilus-dependent motility by chemosensor-like elements in Synechocystis PCC6803. Proc. Natl. Acad. Sci. USA 98,
7540^7545.
[4] Rippka, R. (1972) Photoheterotrophy and chemoheterotrophy
among unicellular blue-green algae. Arch. Microbiol. 87, 93^98.
[5] Anderson, S.L. and McIntosh, L. (1991) Light-activated heterotrophic growth of the cyanobacterim Synechocystis sp. strain PCC 6803
a blue-light-requiring process. J. Bacteriol. 173, 2761^2767.
[6] Wilde, A., Churin, Y., Schubert, H. and Borner, T. (1997) Disruption
of a Synechocystis sp. PCC 6803 gene with partial similarity to phytochrome genes alters growth under changing light qualities. FEBS
Lett. 406, 89^92.
[7] Hitomi, K., Okamoto, K., Daiyasu, H., Miyashita, H., Iwai, S., Toh,
H., Ishiura, M. and Todo, T. (2000) Bacterial cryptochrome and
photolyase: characterization of two photolyase-like genes of Synechocystis sp. PCC. Nucleic Acids Res. 28, 2353^2362.
[8] Goebl, M. and Yanagida, M. (1991) The TPR snap helix: a novel
protein repeat motif from mitosis to transcription. Trends Biochem.
Sci. 16, 173^177.
[9] Das, A.K., Cohen, P.W. and Barford, D. (1998) The structure of the
tetratricopeptide repeats of protein phosphatase 5: implications for
TPR-mediated protein-protein interactions. EMBO J. 17, 1192^1199.
[10] Wimmer, C., Schmid, M., Veenhuis, M. and Gietl, C. (1998) The
plant PTS1 receptor : similarities and di¡erences to its human and
yeast counterparts. Plant J. 16, 453^464.
[11] Lapouge, K., Smith, S.J., Walker, P.A., Gamblin, S.J., Smerdon, S.J.
and Rittinger, K. (2000) Structure of the TPR domain of p67phox in
complex with Rac. GTP. Mol. Cell 6, 899^907.
[12] Ma, Q. and Whitlock, J.P.Jr. (1997) A novel cytoplasmic protein that
interacts with the Ah receptor, contains tetratricopeptide repeat motifs, and augments the transcriptional response to 2,3,7,8-tetrachlorodibenzo-p-dioxin. J. Biol. Chem. 272, 8878^8884.
FEMSLE 10824 6-2-03
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
[13] Zhao, S. and Sancar, A. (1997) Human blue-light photoreceptor
hCRY2 speci¢cally interacts with protein serine/threonine phosphatase 5 and modulates its activity. Photochem. Photobiol. 66, 727^
731.
[14] Elhai, J. and Wolk, C.P. (1988) A versatile class of positive-selection
79
vectors based on the nonviability of palindrome-containing plasmids
that allows the cloning into long polylinkers. Gene 68, 119^138.
[15] Williams, J.G.K. (1988) Construction of speci¢c mutations in photosystem II photosynthetic reaction center by genetic engineering methods in Synechocystis 6803. Methods Enzymol. 167, 766^778.
FEMSLE 10824 6-2-03