Download Role of Hoxa-2 in axon pathfinding and rostral hindbrain patterning

3693
Development 124, 3693-3702 (1997)
Printed in Great Britain © The Company of Biologists Limited 1997
DEV2185
Role of Hoxa-2 in axon pathfinding and rostral hindbrain patterning
Anthony Gavalas1,*, Marc Davenne1,*, Andrew Lumsden2, Pierre Chambon1 and Filippo M. Rijli1,†
1Institut de Génétique et de Biologie Moléculaire et Cellulaire, CNRS/INSERM/ULP, Collège de France, BP 163 – 67404 Illkirch
Cedex, CU de Strasbourg, France
2Department of Developmental Neurobiology, UMDS, Guy’s Hospital, London SE1 9RT, UK
*These authors have equally contributed to this work
†Author for correspondence (e-mail: [email protected])
SUMMARY
Segmentation plays an important role in neuronal diversification and organisation in the developing hindbrain. For
instance, cranial nerve branchiomotor nuclei are organised
segmentally within the basal plates of successive pairs of
rhombomeres. To reach their targets, motor axons follow
highly stereotyped pathways exiting the hindbrain only via
specific exit points in the even-numbered rhombomeres. Hox
genes are good candidates for controlling this pathfinding,
since they are segmentally expressed and involved in rhombomeric patterning. Here we report that in Hoxa-2−/−
embryos, the segmental identities of rhombomere (r) 2 and
r3 are molecularly as well as anatomically altered. Cellular
analysis by retrograde dye labelling reveals that r2 and r3
trigeminal motor axons turn caudally and exit the hindbrain
from the r4 facial nerve exit point and not from their normal
exit point in r2. Furthermore, dorsal r2-r3 patterning is
affected, with loss of cochlear nuclei and enlargement of the
lateral part of the cerebellum. These results point to a novel
role for Hoxa-2 in the control of r2-r3 motor axon guidance,
and also suggest that its absence may lead to homeotic
changes in the alar plates of these rhombomeres.
INTRODUCTION
together with r1, the vast majority of hindbrain crest cells whereas
r3 and r5 are massively depleted from crest cells through
apoptosis (Graham et al., 1993, 1994), generating small subpopulations migrating rostrally and caudally in the arches (Sechrist
et al., 1993, Köntges and Lumsden, 1996). The hindbrain neural
crest cells migrate ventrally in three distinct streams at the axial
levels of rhombomeres 2, 4 and 6, and give rise to cranial sensory
ganglia and mesenchyme that will populate the three branchial
arches and contribute to the formation of muscular, skeletal and
vascular structures (Le Lievre and Le Douarin, 1975; Noden,
1983; Bockman and Kirby, 1984; Couly et al., 1993; Köntges and
Lumsden, 1996). A late-migrating subset of neural crest cells,
derived exclusively from even-numbered rhombomeres, populate
the prospective exit points of the cranial nerves and may thus
provide chemoattractive signal(s) for growing axons (Niederländer and Lumsden, 1996).
Clues to the genetic control of hindbrain and neural crest
segmentation and patterning came from the finding that several
classes of genes display segment-restricted expression patterns,
including transcription factors such as Krox-20 and Hox genes
at the 3′ ends of the Hoxa and Hoxb clusters, growth factors,
receptor tyrosine kinases (RTK) and their ligands and genes
involved in the cellular response to retinoic acid (reviewed in
Wilkinson, 1995; Lumsden and Krumlauf, 1996). Functional
inactivation by gene targeting of several of the above genes
allowed the investigation of their roles in hindbrain segmentation, neuronal specification, and patterning of neural crestderived structures.
The patterning of the vertebrate hindbrain proceeds through a
segmentation process that has been highly conserved in vertebrate evolution (Lumsden, 1990; Keynes and Krumlauf, 1994;
Wilkinson, 1995). This region of the neural tube is transiently
divided, along the anteroposterior axis, into a series of 7-8
lineage-restricted compartments (Fraser et al., 1990; Birgbauer
and Fraser, 1994; Wingate and Lumsden, 1996). This
metameric organisation is reflected in the organisation of the
associated cranial nerves. Retrograde labelling, using fluorescent lipophilic dyes, of mouse and chicken hindbrain motor
nuclei has shown the existence of a two rhombomere-repeat
organisation (Lumsden and Keynes, 1989; Marshall et al., 1992;
Carpenter et al., 1993). The trigeminal (Vth) nerve collects
axons from motor nuclei lying in rhombomere (r) 2, r3 and a
few in r1, exits the brain from r2 and innervates the first
branchial arch. Conversely, the facioacoustic (VIIth/VIIIth) and
glossopharyngeal (IXth) nerves collect axons from motor nuclei
lying in r4/r5 and r6/r7 respectively, and exit the brain from r4
(VIIth/VIIIth) and r6 (IXth) innervating the second and the third
branchial arches, respectively. Within the hindbrain, motor
axons follow highly stereotyped pathways but very little is
known about the genetic control of this pathfinding.
Rhombomere-specific production of neural crest cells is
observed along the dorsal part of the hindbrain, resulting in a
segmental pathway of migration (Lumsden et al., 1991; Sechrist
et al., 1993). The even-numbered rhombomeres generate,
Key words: rhombomere, axon guidance, segmentation, cerebellum,
EGL cell, hindbrain, patterning
3694 A. Gavalas and others
The Hox genes appear to be good candidates to establish
rhombomeric segmental identities, as suggested by the results of
the Hoxa-1 and Hoxb-1 knockouts (Lufkin et al., 1991; Chisaka
et al., 1992; Mark et al., 1993; Carpenter et al., 1993; Dollé et
al., 1993; Goddard et al., 1996; Studer et al., 1996). The Hoxa1 null mutant mice are not viable and exhibit defects in the
formation of the inner ear, cranial nerves and certain bones of
the skull. Dye injections, morphological criteria and molecular
markers showed a complete or near-complete deletion of r5 and
a severe reduction of r4 suggesting a role in maintenance and/or
generation of segments, more than conferring a specific fate to
hindbrain neurons (Lufkin et al., 1991; Chisaka et al., 1992;
Mark et al., 1993; Carpenter et al., 1993; Dollé et al., 1993). In
contrast, the targeted inactivation of its paralog, Hoxb-1, did not
produce any segmentation defect, but resulted in failure to form
the motor component of the facial nerve due to inability of r4
motor neuron cell bodies to migrate properly (Goddard et al.,
1996; Studer et al., 1996). Underlying this defect is the formation
of an r4 that may be partially homeotically transformed towards
an r2 identity (Studer et al., 1996).
Another transcription factor, Krox-20, plays an important role
in hindbrain segmentation and patterning (Schneider-Maunoury
et al., 1993, 1997; Swiatek and Gridley, 1993). Krox-20 is
specifically activated in the presumptive r3 and r5 territories
before the appearance of any rhombomere boundaries
(Wilkinson et al., 1989). In the Krox-20 mutants, the r3 and r5
territories are normally formed, at early stages, but fail to be
maintained and are completely eliminated. This results in shortening of the hindbrain, with fusion of the Vth with the
VIIth/VIIIth and the IXth with the Xth ganglion in the
periphery, and perinatal death (Schneider-Maunoury et al.,
1993; Swiatek and Gridley, 1993). As a consequence of the segmentation defect, the facial and the trigeminal exit points are
brought closer, the trigeminal motor axons fasciculate with the
facial motor axons and are subsequently misrouted towards the
second arch (Schneider-Maunoury et al., 1997). Interestingly, it
was shown that Krox-20 is an upstream regulator of the Hoxb2 (Sham et al., 1993) and the Hoxa-2 (Nonchev et al., 1996)
genes in r3 and r5 suggesting that at least some of the abnormalities observed in the Krox-20 mutants may be accounted for
by the lack of expression of these genes in those rhombomeres.
Hoxa-2 is the most anteriorly expressed Hox gene, with an
expression boundary coinciding with the r1/r2 border
(Krumlauf, 1993; Prince and Lumsden, 1994). In addition,
Hoxa-2 is the only Hox gene expressed in r2 and, in r3, is coexpressed only with its paralog, Hoxb-2 (Krumlauf, 1993; and
refs. therein). The targeted inactivation of Hoxa-2 resulted in
lethality at birth and in a homeotic transformation of the second
arch neural crest-derived skeletal elements into first arch derivatives (Gendron-Maguire et al., 1993; Rijli et al., 1993),
demonstrating that Hoxa-2, acting as a Drosophila selector
gene, modifies in the second branchial arch a skeletogenic
ground patterning program common to the neural crest of (part
of) the first and second arches (Rijli et al., 1993). However, the
Hoxa-2 knockout did not result in any apparent segmentation
defect at 9.5 dpc, both molecularly and morphologically
(Gendron-Maguire et al., 1993; Rijli et al., 1993).
The recent finding that the expression of MDK1, an Eph
receptor tyrosine kinase (RTK), was abolished in r3 and altered
in r2 and r4 of Hoxa-2−/− mutants (Taneja et al., 1996) prompted
us to further investigate the segmentation pattern, at later stages
than previously investigated, using both molecular and morphological criteria. In this report, we demonstrate that Hoxa-2 is
required for normal axonal pathfinding of r2 and r3 motor
neurons. In its absence, a significant proportion of these motor
neuron axons turn caudally and exit through the r4 exit point, thus
innervating the transformed second branchial arch, instead of the
first. Furthemore, we show that the lack of Hoxa-2 results in the
loss of the r1/r2 boundary, reduction of alar r2 and r3 territories
and a concomitant expansion of the r1 territory, both by molecular
and morphological criteria. These hindbrain defects lead to an
enlargement of the cerebellum and to a corresponding reduction
of pontine structures, suggesting that fate changes may have
occurred in the alar plates of the Hoxa-2 mutant fetuses.
MATERIALS AND METHODS
In situ hybridisation, immunostaining and histological
analysis
Whole-mount in situ hybridisation was performed as described (Dupé
et al., 1997). The Sek-1 probe was derived by PCR amplification of
cDNA from total P19 cell RNA, using the specific primers 5′GGAGCTACGGAATCGTTATGTGG3′ and 5′CTTCTGTGGTATAAACCGAGCCC3′ derived from the available Sek-1 sequence (GilardiHebenstreit et al., 1992). The resulting fragment, spanning nucleotides
2411-3450, was subcloned into Bluescript (Stratagene). The Sax-1
(Schubert et al., 1995), PLZF (Cook et al., 1995), Otx2 (Simeone et
al., 1992) and En-2 (Davis and Joyner, 1988) probes were kind gifts
from P. Gruss, A. Zelent, S.-L. Ang and A. Joyner, respectively.
Whole-mount immunostaining using the anti-neurofilament monoclonal antibody 2H3 (Developmental Studies Hybridoma Bank) was
performed as described (Mark et al., 1993). Mouse fetuses were fixed
in Bouin’s fluid and brains were dissected out, photographed and subsequently embedded in paraffin for histology. Serial sections 7 µm
thick were stained with Mallory’s trichrome.
Retrograde labeling
Embryos were fixed in 4% paraformaldehyde in phosphate-buffered
saline and injected with the carbocyanine tracers DiI and DiO
(Molecular Probes). Flat-mount preparations and analysis under a
confocal microscope of retrogradely labeled specimens were as
described (Studer et al., 1996).
RESULTS
Molecular and morphological changes in the
hindbrain of Hoxa-2 mutant embryos
Initial characterization of the expression patterns of Krox-20,
Hoxb-2, Hoxb-1 and Hoxa-3 in the hindbrain of 8.5-9.5 day
post coitum (dpc) Hoxa-2−/− mutant embryos did not reveal any
obvious alterations (Gendron-Maguire et al., 1993; Rijli et al.,
1993). Furthermore, the segmentation pattern and gross morphology of rhombomeres at 9.5 dpc did not appear to be
affected (Gendron-Maguire et al., 1993; Rijli et al., 1993).
However, the finding that the expression of MDK1, an Eph
receptor tyrosine kinase (RTK), was abolished in r3 and altered
in r2 and r4 of Hoxa-2−/− mutants (Taneja et al., 1996; see also
Fig. 5) prompted us to further investigate the segmentation
pattern, at both the molecular and morphological levels.
In 9.0 dpc wild-type (WT) embryos, the Eph RTK Sek-1 is
expressed at high levels in r3 and r5 and at a lower level
dorsally in r2 (Nieto et al., 1992; Figs 1A, 5). In Hoxa-2−/−
embryos, Sek-1 expression is selectively abolished in r2 (arrow
Role of Hoxa-2 in hindbrain patterning 3695
in Fig. 1B), whereas the remainder of its expression domain is
not affected. This result shows that Hoxa-2 is required to
maintain Sek-1 expression in r2 and suggests a possible change
in the r2 segmental identity, since Hoxa-2 is the only Hox gene
expressed in r2 (Krumlauf, 1993; Prince and Lumsden, 1994;
Fig. 5).
The overall size of the r1-r3 territory and the position of the
mid-hindbrain border do not appear to be significantly affected
in Hoxa-2−/− embryos (compare Fig. 1E with 1F) as
inferred by double whole-mount in situ hybridisation of
WT and homozygous 9.0 dpc embryos with Hoxb-1,
which marks r4 (Frohman et al., 1990), and Otx2, which
has a sharp caudal expression boundary at the midhindbrain border (Simeone et al, 1992; arrowheads in Fig.
1E,F). However, double in situ hybridisation of WT and
Hoxa-2−/− 9.0 dpc embryos with Hoxb-1 and En-2, which
is expressed in the mid-hindbrain domain, including r1,
(Davis and Joyner, 1988) and is involved in cerebellar
development (Millen et al., 1994), reveals a caudal
expansion of the r1 expression domain of En-2 in mutant,
as compared to WT embryos (compare the expression
domains demarcated by the arrowheads in Fig. 1E,F).
To examine r1 features at later stages, we analysed the
expression pattern of the homeobox gene Sax-1 (Schubert
et al., 1995) which, in WT 10.5 dpc embryos, is selectively expressed in the ventral portion of r1 with a sharp
caudal boundary at the r2 border and a narrow stripe of
cells next to the floor plate extending further caudally
(Fig. 1G). In Hoxa-2−/− embryos, the sharp r1/r2 boundary
does not exist and the broad Sax-1 expression domain
extends posteriorly into the r2 and, possibly, r3 territories,
as inferred by comparing the gaps between the expression
domains of Hoxb-1 and Sax-1 in double staining of WT
and Hoxa-2−/− 10.5 dpc embryos (compare Fig. 1G,H).
The described molecular changes in the hindbrain of
Hoxa-2−/− embryos prompted us to analyse the segmentation pattern of Hoxa-2−/− embryos at 10.5 dpc, i.e. later
than previously analysed (Gendron-Maguire et al., 1993;
Rijli et al., 1993). Comparison of flatmount WT and
mutant hindbrains (Fig. 2A,B) shows an apparent loss of
the r1/r2 border (compare Fig. 2A,B). This finding was
further confirmed by examining the expression pattern of
the PLZF gene (Cook et al., 1995) which, in WT 10.5 dpc
embryos, is strongly expressed at rhombomeric boundFig. 1. Changes in r2 molecular identity of Hoxa-2−/−
embryos. (A,B) Dorsal views of WT (A) and mutant (B) 9.0
dpc embryos probed with Sek-1 for r2, r3 and r5. The arrow
in B indicates the lack of expression in mutant r2 (r2*).
(C,D) Lateral view of WT (C) and Hoxa-2−/− (D) embryos at
9.0 dpc probed with Otx-2 and Hoxb-1, as a marker for r4.
The arrowheads denote the mid-hindbrain boundary.
(E,F) Lateral view of WT (E) and Hoxa-2−/− (F) embryos at
9.0 dpc probed with En-2 and Hoxb-1. Note the caudal
expansion of the metencephalic (r1) expression domain of
En-2 in the mutant (F) as compared to WT (E), as denoted
by the arrowheads. (G,H) 10.5 dpc WT (G) and Hoxa-2−/−
(H) hindbrains probed with Sax-1 and Hoxb-1, as markers
for r1 and r4 segmental identities, respectively. Arrowheads
in H indicate the caudal spreading of Sax-1 expression
domain in the mutant hindbrain. ot, otocyst. Bar, 570 µm
(A,B; G,H), 580 µm (C,D) and 560 µm (E,F).
aries (Fig. 2C). The comparison of the PLZF staining in WT
and Hoxa-2−/− embryos shows the lack of any apparent r1/r2
boundary (compare Fig. 2C with 2D) and suggests that the
integrity of the r2/r3 boundary may have been partially compromised as well (compare Fig. 2C,D).
The segmentation pattern of Hoxa-2−/− hindbrains, together
with the ectopic Sax-1 and En-2 expression and the loss of Sek1 expression in r2 suggest a homeotic change of r2 into r1
3696 A. Gavalas and others
territory, which is, however, only partial, since the r2 trigeminal exit point is still present in Hoxa-2−/− mutants (arrow in
Fig. 2B) and axons can still exit through it (Fig. 3E,H). In
addition, r3 segmental identity may as well be partially altered
in Hoxa-2−/− embryos since r3 appears dorsally reduced
(compare brackets in Fig. 2A,B and C,D) and molecularly
affected (see above; Taneja et al., 1996).
mediodorsal territory (Martinez and Alvarado-Mallart, 1989;
Hallonet et al., 1990; Hallonet and Le Douarin, 1993). Fatemapping studies in chick have also shown that there is a very
limited cerebellar contribution from alar r2 and that the border
between the cerebellum and the longitudinal column of
cochlear nuclei, originating from the alar plates of more
posterior rhombomeres, coincides exactly with the r2/r3
boundary (Marin and Puelles, 1995). Thus, with anterior
homeotic changes within the r2-r3 domain of the Hoxa-2−/−
mutants, expansion of the cerebellar territory and reduction of
the cochlear nuclei may be expected.
Fig. 4C shows the brain of a 18.5 dpc WT fetus. In all five
18.5 dpc homozygous mutants examined (Fig. 4D, and data not
shown), the cerebellum appears consistently extended along its
rostrocaudal and mediolateral axis (compare Fig. 4C,D). Horizontal sections through different levels of the cerebellum and
comparison between WT and mutant fetuses confirm this
phenotype (compare Fig. 4E,F and G,H; and data not shown).
Similar results were obtained with transverse and sagittal
sections (data not shown). Interestingly, in horizontal sections
of the ventral part of the Hoxa-2−/− cerebellum, the external
Pathfinding of motor axons is altered in Hoxa-2−/−
embryos
The above rhombomeric abnormalities and molecular changes
observed in the mutants may be expected to have consequences
on the patterning of rostral hindbrain structures. Therefore, we
investigated the development and axonal projections of the
trigeminal (V) and facial (VII) motor nuclei by retrograde DiO
and DiI labelling, respectively, of 10.5 dpc WT (Fig. 3A-C)
and Hoxa-2−/− (Fig. 3D-I; and data not shown) embryos.
In WT embryos, DiI injection at the VIIth nerve exit point
in r4 labels neurons only in r4 and r5 (Fig. 3A), whereas DiO
injection at the Vth nerve exit point in r2 labels neurons only
in r2, r3 and r1 (Fig. 3B). Motor axon trajectories are highly
stereotyped: neurons in r2 and r4 project their
axons dorsally (laterally) to reach their respective exit points located in the alar plate, whereas
motor axons in r3 and r5 first project in a dorsal
direction and then turn rostrally to exit the
hindbrain via the r2 and r4 exit points, respectively (Fig. 3A,B). Strikingly, DiI injection at the
r4 VIIth nerve exit point of the Hoxa-2−/− mutant
in Fig. 2D reveals that all of the r3 and some of
the r2 motor axons drastically change their
pathfinding, turning caudally and exiting the
hindbrain with r4 and r5 facial motor axons
(arrow). DiO retrograde labelling of axons
exiting at the r2 Vth nerve exit point confirms the
lack of r3 axons exiting from r2, whereas fewer
axons are labeled in r2 than in WT (Fig. 3E).
Labelling of five additional Hoxa-2−/− mutants
not only confirmed these results, but revealed
that, in some embryos, r3 motor axons, similarly
to those of r2, displayed mixed trajectories, some
exiting at the r2 and others at the r4 exit points
(Fig. 3G,H; and data not shown). In the case of
r2 axons, it is noteworthy that a few migrate a
long way caudally to reach the r4 exit point,
instead of going out at the closest exit point in
r2 (arrows in Fig. 3D,G). Accordingly, wholemount immunostaining by an anti-neurofilament
antibody reveals that the thickness of the axon
bundle at the r2 exit point is reduced and the
presence of an additional nerve branch innervating the second branchial arch of Hoxa-2−/− 10.5
Fig. 2. Morphological and molecular analysis of rhombomere boundaries in Hoxadpc embryos (bracket and arrow in Fig. 4B,
2−/− 10.5 dpc embryos. (A,B) Flat-mounted WT (A) and mutant (B) hindbrains.
respectively).
Cerebellar and pons defects in Hoxa-2−/−
fetuses
The alar plate of the rostral metencephalon (r1 +
isthmic region) generates the majority of the
cells in the cerebellar cortex, with a mesencephalic contribution restricted only to a
Note in B the absence of the r1/r2 boundary as well as the dorsally reduced r3 as
compared to WT (A) (brackets in A and B). Arrows in A and B indicate the Vth
nerve exit point. (C,D) PLZF in situ hybridization of flat-mounted WT (C) and
mutant (D) hindbrains. Note that the r1/r2 boundary (white arrowheads in C) is
missing in the mutant (D). In addition, the r2/r3 boundary in the mutant in D can be
identified only unilaterally (white arrowhead in D). Note also that the r3 territory in
D appears dorsally reduced as compared to the WT in C (brackets in C and D). Bar,
645 µm (A,B) and 450 µm (C,D).
Role of Hoxa-2 in hindbrain patterning 3697
germinal layer (EGL) appears thicker than in WT (compare
Fig. 4E,F), with a dramatic accumulation of cells in a specific
posteroventral region (open arrowhead) which may correspond
to the proliferating ‘germinal trigone’ (Altman and Bayer,
1978) (compare Fig. 4G,H). In addition, horizontal sections
through the dorsal pons of the Hoxa-2−/− fetus reveals a striking
loss of the anterior portion of the cochlear nuclei (co) column,
as compared to WT (compare Fig. 4I,J). Altogether these
results suggest that the alar plates of r2 and r3 may be partially
transformed to a more anterior cerebellar phenotype in the
hindbrain of Hoxa-2−/− mutants.
hypothesis. Accordingly, the r1/r2 boundary is missing in
Hoxa-2 mutants, even though some r2 features seem to be
conserved since an r2/r3 border is still, at least partially,
formed and the r2 exit point is present (Fig. 2B), suggesting
that specification of the remaining r2 territory may not be under
the control of Hox genes (see also below). Interestingly, r3 and
its derivatives also appear to be molecularly and morphologically affected by the Hoxa-2 inactivation (Figs 1 to 5; see also
DISCUSSION
In this report, we show that the functional inactivation of Hoxa2 leads to molecular and morphological changes in the
hindbrain of the mutant embryos (summarised in Fig. 5),
demonstrating that Hoxa-2 does not only act as a selector gene
for second arch mesenchymal neural crest cell (NCC) morphogenetic identity (Rijli et al., 1993; Gendron-Maguire et al.,
1993) but it also plays a fundamental role in rostral hindbrain
patterning by establishing r2 and, to a lesser extent, r3
segmental identities and by contributing in the genetic control
of r2-r3 motor neuron axon pathfinding.
r2 and r3 molecular and morphological segmental
identities are altered in Hoxa-2 mutants
Previous loss- and gain-of-function studies (Chisaka and
Capecchi, 1991; Lufkin et al., 1991; Chisaka et al., 1992;
Carpenter et al., 1993; Mark et al., 1993; Zhang et al., 1994;
Studer et al., 1996; Goddard et al., 1996; Barrow and Capecchi,
1996; Dupé et al., 1997) have investigated the functional role
of Hox genes in the specification of segment identity. The
emerging picture is consistent with a role of these genes in
establishing and maintaining the segmental identity of rhombomeres, although the interpretation of the mutant phenotypes
may have been hampered by the existence of other Hox genes
displaying expression patterns overlapping that of the investigated gene. Hoxa-2 is the only Hox gene expressed in r2
(Krumlauf, 1993; Prince and Lumsden, 1994; Fig. 5), therefore
providing a unique situation to investigate its role in rhombomere patterning in the absence of expression of any other
Hox gene. In initial studies (Gendron-Maguire et al., 1993;
Rijli et al., 1993), the molecular identities of rhombomeres (as
assessed by the expression patterns of Krox-20, Hoxb-2, Hoxb1, and Hoxa-3) appeared unmodified in Hoxa-2 mutants, and
hindbrain alterations were not detected at the stage analysed
(9.5 dpc), using standard histological techniques. However, the
aberrant expression pattern of MDK1 (Taneja et al., 1996; Fig.
5) suggested the existence of abnormalities in the hindbrain of
the mutants that may be morphologically evident at later stages
than previously investigated. In the present study, we find patterning defects restricted to the rostralmost expression domain
of Hoxa-2, namely in r2 and r3, in the hindbrain of 10.5 dpc
Hoxa-2 mutant embryos (Figs 1 and 2). The molecular changes
in the expression patterns of Sek-1, En-2 and Sax-1 in the r1r2 region of the mutants (Fig. 1B,F,H), may be consistent with
a switch in cell fate of r2 towards an r1 identity and the corresponding morphological phenotype observed in the mutants
(Figs 2B,D and 4D,F,H,J; see below) may further support this
Fig. 3. r2 and r3 motor axon trajectories are altered in Hoxa-2−/−
embryos. (A-C) Retrograde DiI and DiO labelling of facial (A) and
trigeminal (B) motor nerves, respectively, and a composite image of
the two patterns (C) in a 10.5 dpc WT embryo. The r4 exit point
(VII) collects axons only from r4 and r5 (A), and the r2 exit point
(V) only from r2, r3 and a few from r1 (B); the arrow in B shows the
pathway of r3 motor axons. (D-I) Retrograde DiI and DiO tracing at
the r4 (D,G) and the r2 (E,H) exit points of two 10.5 dpc Hoxa-2−/−
embryos, respectively, and composite images of the patterns (F,I).
The mutant in D shows DiI labelling of all of the r3 and some of the
r2 motor axons and the arrow indicates their altered migration
pathways; accordingly, DiO injection in E labels only r2 motor
axons. The mutant in G-I has been bilaterally injected. Note that r3
motor axons display mixed trajectories, with some correctly exiting
through r2 (H), and others through r4 (G). The arrow in G indicates
the trajectories of some r2 motor axons exiting at r4. Bar, 210 µm
(A-C), 260 µm (D-F) and 525 µm (G-I).
3698 A. Gavalas and others
Taneja et al., 1996), although to a lesser extent than
r2, since segment boundaries can still be detected and
the r3 territory appears only dorsally reduced (Fig.
2B). Since in r3 Hoxa-2 is only coexpressed with its
paralog Hoxb-2 (Krumlauf, 1993; and refs. therein),
one possibility is that Hoxb-2 may partially compensate for the loss of Hoxa-2. The analysis of compound
Hoxa-2/Hoxb-2 mutants will reveal whether these
genes genetically interact for r3 patterning. In this
respect, it is noteworthy that the functional inactivation of Krox-20, an upstream regulator of both Hoxa2 (Nonchev et al., 1996) and Hoxb-2 (Sham et al.,
1993), leads to the complete elimination of r3 and r5,
while the rest of hindbrain segmentation is maintained
(Schneider-Maunoury et al., 1997).
Hoxa-2 is required for normal pathfinding of
r2-r3 motor axons
The experiments presented here indicate that Hoxa-2
is required to control r2-r3 motor axon trajectories,
providing the first evidence for the involvement of a
Hox gene in axon guidance. In the mutants, axons
from the r2/r3 region exit, incorrectly, from r4 and
innervate the transformed second branchial arch.
Changes in the neural crest of the second branchial
arch, in the neuroepithelium of the hindbrain and in
the identity of the motor neurons themselves could be
invoked to interpret these results.
The misrouting of the r2/r3 axons into the second
branchial arch is consistent with the homeotic transformation of the second arch neural crest-derived
skeletal elements into first arch derivatives (GendronMaguire et al., 1993; Rijli et al., 1993) since an anteriorly transformed second arch may be able to attract
axons bearing matching positional information.
However, this is not sufficient to explain the axon
routes, since axons exiting from the r2 exit point do
not turn caudally to innervate the transformed second
Fig. 4. Cranial nerve and cerebellar alterations in
Hoxa-2−/− mutants. (A,B) Lateral views of antineurofilament staining of 10.5 dpc WT (A) and Hoxa-2−/−
(B) embryos. Note in B that the trigeminal axon bundle is
markedly reduced at the exit point (compare brackets in
A,B) and that an additional nerve branch (arrow) innervates
the second branchial arch of the mutant (BA2*).
(C,D) Whole-mount preparations of WT (C) and Hoxa-2−/−
(D) newborn brains. The mutant cerebellum (cb) in D is
extended along its rostrocaudal and mediolateral axis
(compare arrows in C and D). (E-J) Horizontal histological
sections of the WT (E,G,I) and mutant (F,H,J) brains
shown in C and D, respectively, at the level of the
cerebellum (E-H) and pons (I,J). Note that, in the lateral
part of the ventral-most portion of the mutant cerebellum
(F), the external germinal layer (EGL) (arrow) is thicker
than in the WT (E). At a slightly more dorsal level,
increased EGL cell accumulation (open arrowhead) is
observed in mutant (H), as compared to WT (G).
Conversely, the cochlear nuclei column (co) (between
arrows) is markedly reduced in the mutant pons (J), as
compared to WT (I). BA1, BA2, first and second branchial
arch, respectively; mb, midbrain; cp, choroid plexus. Bar,
770 µm (A,B), 970 µm (C,D) and 300 µm (E-J).
Role of Hoxa-2 in hindbrain patterning 3699
Fig. 5. Summary diagram of the
changes occuring in the
Hoxa-2−/− mutant hindbrain. The
segmental and neuronal
organisation of WT and
Hoxa-2−/− 10.5 dpc hindbrain is
shown on the left side of each
diagram. r1, r2, r3 and r4, r5
motor axons are coloured in
orange and violet, respectively.
Exit points of the trigeminal (V)
and facial (VII) nerves are
presented as orange and violet
ovals, respectively. Note that, in
the mutant, some axons from r2*
and r3* exit incorrectly from the
r4* exit point (orange and violet
oval). The expression patterns of
molecular markers in WT and
Hoxa-2−/− hindbrains are shown
on the right side of each diagram
or as adjacent bars. The normal
Hoxa-2 expression pattern is also
indicated (light-blue-shaded bar).
Boundaries between
rhombomeres, as assessed by PLZF staining and morphological observation (see Fig. 2), are presented with dashed lines. For simplicity, the
Hoxa-2−/− r1/r2 boundary is shown nearly absent and the dorsal reduction of r3 (see Fig. 2) is not shown. The r2/r3 boundary is also presented
with a dashed line, although it appears to be partially altered as well in Hoxa-2−/− mutants (see Fig. 2). Less or more intense colour shading
represents lower or higher levels of gene expression, respectively. Note that, in the mutant, dorsal r2 Sek-1 expression (light-green) is lacking (at
9.0 dpc) and En-2 (grey-shaded bar) as well as Sax-1 (yellow) expression domains have spread caudally into at least the r2* territory (at 9.0 and
10.5 dpc, respectively) (see Fig. 1). Note also the changes in MDK1 expression in Hoxa-2−/− (red) 9.0 dpc embryos (Taneja et al., 1996).
Rhombomeres in which a molecular and/or anatomical change has been observed in Hoxa-2−/− mutants are marked with an asterisk. BA1, BA2,
first and second arch, respectively; BA2*, homeotically transformed Hoxa-2−/− second arch (Rijli et al., 1993; Gendron-Maguire et al., 1993);
ov, otic vesicle; gV, gVII, trigeminal and facial ganglia, respectively.
arch. Clearly, intermediate cues should be guiding, or allowing,
these axons through the r3 and r4 territories towards the r4 exit
point and into the transformed second branchial arch (BA2*,
Figs 4B, 5).
Rhombomere reversal and ablation studies (Guthrie and
Lumsden, 1992; Chang et al., 1992) have suggested that
growth cones are driven by chemoattractive cues from their
respective exit points (see also Tessier-Lavigne and Goodman,
1996; and refs. therein). Recently, cranial nerve exit points
have been shown to be defined by a subpopulation of rhombomeric neural crest cells (NCC) (Niederländer and Lumsden,
1996). NCC emanating from r2 are devoid of Hox gene
expression, whereas r4-NCC express Hoxa-2, Hoxb-2 and
Hoxb-1 (Krumlauf, 1993 and refs. therein). It is conceivable
that Hoxa-2 may confer specific identity not only to the second
arch mesenchymal NCC (Rijli et al., 1993; Gendron-Maguire
et al., 1993) but also to the NCC of r4 exit point. In Hoxa-2−/−
mutants an r4 exit point with a partial Vth nerve identity may
attract some r2 and r3 axons to exit the hindbrain through r4
and innervate the transformed second branchial arch (BA2*,
Figs 4B, 5). This hypothetical transformation can be only
partial, since Hoxb-1 and Hoxb-2 expression in mutant r4 and
r4-NCC is normal (Rijli et al., 1993; Gendron-Maguire et al.,
1993) and r4/r5 motorneurons are still exiting through the r4
exit point. However, the lack of specific markers that would
distinguish between the r2 and r4 exit points does not allow us
to directly test this hypothesis.
Beside chemoattraction from the exit points, a limited degree
of guidance cues might also reside in the neuroepithelium, as
suggested by r3 rotation experiments (Guthrie and Lumsden,
1992). Members of the Eph family of RTKs have been implicated in axon repulsion (e.g. Cheng et al., 1995; Drescher et
al., 1995; Wang and Anderson, 1997, Varela-Echavarria and
Guthrie, 1997 and refs. therein). The detected changes in the
expression of two Eph family RTKs in the hindbrain of Hoxa2−/− embryos suggest that changes in the identity of the r2 and
r4 microenvironment and pathfinding signals emanating from
these rhombomeres could also account for the misrouting of
the r2/r3 axons. The Sek-1 and MDK1 expression profiles of r2
and r4, which are dissimilar in the WT become identical in the
Hoxa-2−/− embryos (Fig. 5), providing a possible molecular
basis for the inability of r3 and r2 axons to distinguish between
r2 and r4. Extension of Sax-1 and En-2 expression into r2 may
also result in alterations of pathfinding signals from this
territory. The lack of MDK1 expression in the r3 of Hoxa-2−/−
embryos (Taneja et al., 1996; Fig. 5) may withdraw a ‘barrier’
allowing some r2 and r3 axons to reach r4. It is noteworthy that
r2-r3 motor axons can ‘choose’ to exit either at the r2 or the
r4 exit points (Fig. 3). This variability (Fig. 3D-I; and data not
shown) may reflect a variable reduction in the r2 territory and
its exit point among different mutants. This reduction would
alter quantitatively and/or qualitatively the chemoattractive
signals from r2, thus allowing some axons to be attracted by
the r4 territory.
A further possibility is that some r4 facial branchiomotor
neurons, which normally migrate into r5 (Studer et al., 1996),
3700 A. Gavalas and others
may also aberrantly migrate into r2/r3 territories and send their
axons through the r4 exit point. This could result from the elimination of inhibitory cues, emanating from r2 and/or r3 and
would be consistent with the molecular analysis. Indeed, as
assessed by retrograde labelling, there appears to be an occasional paucity of VIIth nerve motor neurons in the r4 of the
mutants (Fig. 3).
Alternatively, r2 and r3 trigeminal motor neurons may
partially change their fate to a VIIth nerve identity. r2-r3 motor
neuron axonal trajectories similar to those shown in this study
have been reported in mouse embryos treated with high doses
of retinoic acid at midgastrulation (Marshall et al., 1992;
Kessel, 1993). Those results were consistent with a morphological transformation of the trigeminal motor nerve towards a
facial identity, accompanied by anteriorised expression of more
posterior markers such as Hoxb-1 and Hoxb-2, which indeed
have been recently shown to control aspects of facial motor
nucleus identity during normal development (Goddard et al.,
1996; Studer et al., 1996; Barrow and Capecchi, 1996). Since
Hoxb-1, Hoxb-2, Hoxa-3 and Hoxb-3 are not ectopically
expressed in Hoxa-2 mutant r2-r3 territories (GendronMaguire et al., 1993; Rijli et al., 1993; and data not shown),
we consider the above hypothesis less likely.
Finally, it may be argued that, in the absence of Hoxa-2, r2r3 motor neurons adopt a ‘generic’ motor neuron fate with no
anteroposterior specification such that they respond equally to
the r2 and r4 chemoattractive signals extending axons towards
either exit point. In the absence of an available trigeminal
motor neuron-specific marker, this possibility cannot be
formally ruled out. However, the normal expression of Hoxb2 in the r3 of the mutants (Rijli et al., 1993; Gendron-Maguire
et al., 1993) suggests that r3 motor neurons may receive at least
some degree of anteroposterior specification, making this latter
hypothesis also less likely.
In summary, we favour the idea that it is not a switch in the
identity of r2/r3 motor neurons but changes in axon pathfinding signals emanating from the r2-r4 region that result in the
aberrant axonal projections. In contrast, there may be a switch
in cell fate identity in the alar plates of r2 and r3, as suggested
by the molecular and morphological analysis presented (see
also below). This apparent dichotomy can be obviated by not
requiring Hoxa-2 to specify the fate of all cells within a rhombomere but assuming that Hoxa-2 acts to specify the fate of
subsets of cell populations in these segments. In this respect,
it is noteworthy that Hoxb-1 appears to be acting in a comparable manner, since its targeted inactivation led to selective
loss of the facial somatomotor nucleus due to the misspecification of r4 branchiomotor neurons (Goddard et al., 1996;
Studer et al., 1996).
The cerebellar and pons defects observed in Hoxa2−/− mutant fetuses may indicate cell identity
changes in the rhombic lip
Fate-mapping studies have demonstrated that the cerebellum is
mostly derived from the alar plate of the metencephalic brain
vesicle, with a limited mesencephalic contribution (Martinez
and Alvarado-Mallart, 1989; Hallonet et al., 1990; Hallonet
and Le Douarin, 1993). In particular, while r2 may contribute
to deep cerebellar nuclei (Marin and Puelles, 1995), granule
neuron precursors of the cerebellar cortex originate from the
proliferating edge of the neuroepithelium of rostral meten-
cephalon (r1+ isthmic region), within the ‘rhombic lip’ (Hatten
and Heintz, 1995 and refs. therein), and migrate anteriorly and
medially covering the entire developing cerebellum to form the
external germinal layer (EGL) (Hallonet and Le Douarin,
1993). The limit between cerebellar and pontine structures
coincides with the r2/r3 boundary, since r3 does not normally
form any part of the cerebellum (Tan and Le Douarin, 1991;
Marin and Puelles, 1995). The Hoxa-2 mutant mice lack any
Hox expression in both r1 and r2, and the only Hox gene
expressed in mutant r3 is Hoxb-2 (Rijli et al., 1993; GendronMaguire et al., 1993). Can cerebellar derivatives be now
induced in the mutant r2-r3 region? We speculate that the
enlargement of the cerebellar surface in the Hoxa-2 mutants
may be due to increased EGL cell number (Fig. 4F,H) resulting
from abnormal recruitment of dorsal, rhombic lip-derived, r2
and r3 cells. Analysis of granule neuron-specific markers
(Alder et al., 1996; Yang et al., 1996) will be required to
address this point. This hypothesis is indirectly supported by
the striking loss of the anterior portion of the cochlear nuclei
(co) column (Fig. 4J) which originates from the alar plates of
r3 and more posterior rhombomeres (Marin and Puelles, 1995).
In this respect, it is interesting to note that a fate change in r2
and r3, leading to development of ectopic cerebellar structures
including EGL cells, could be induced by grafting prospective
isthmocerebellar neuroepithelium from a quail or a mouse
embryo into the hindbrain of a host chick embryo (Martinez et
al., 1995). Interestingly, induction of ectopic cerebellar structures occurred only in the alar plates of the rhombomeres
immediately contacting the graft, and only when the graft was
not adjacent to the host interrhombomeric boundaries
(Martinez et al., 1995). These findings suggested that rhombomere alar plates can be transformed to a cerebellar fate in
the absence of segment boundaries, which therefore may act
as barriers to morphogenetic signal(s) spreading from the graft.
It is tempting to speculate that the lack of the r1/r2 boundary
in Hoxa-2 mutant embryos may also withdraw a barrier to
putative signal(s) spreading from the isthmic region.
We wish to thank I. McKay, R. Wingate, N. Adams and other
members of A. Lumsden’s laboratory for helpful discussions and
training regarding retrograde labelling; the referees for their useful
suggestions; P. Gruss, A. Zelent, S. L. Ang and A. Joyner for the Sax1, PLZF, Otx2 and En-2 probes, respectively; M. Poulet for excellent
technical assistance; C. Werlé and R. Bucher for help in preparing
figures. The 2H3 monoclonal antibody was obtained from the Developmental Studies Hybridoma Bank maintained by The University of
Iowa, Department of Biological Sciences, Iowa City, IA 52242, under
contract NO1-HD-7-3263 from the NICHD. A. G. was supported by
fellowships from EC Human Capital Mobility and Fondation pour la
Recherche Médicale (FRM) and M. D. by a fellowship from La Ligue
Nationale contre le Cancer (LNC). F. M. R. was a recipient of an
EMBO short-term fellowship, while in Andrew Lumsden’s lab. This
work was supported by funds from the INSERM, CNRS, Collège de
France, Association pour la Recherche sur le Cancer (ARC), FRM,
and LNC.
REFERENCES
Alder, J., Cho, N. K. and Hatten, M. E. (1996) Embryonic precursor cells
from the rhombic lip are specified to a cerebellar granule neuron identity.
Neuron 17, 389-399.
Altman, J. and Bayer, S. (1978). Prenatal development of the cerebellar
Role of Hoxa-2 in hindbrain patterning 3701
system in the rat. Cytogenesis and histogenesis of the deep nuclei and the
cortex of the cerebellum. J. Comp. Neur. 179, 23-48.
Barrow, J. R. and Capecchi, M. R. (1996) Targeted disruption of the Hob-2
locus in mice interferes with expression of Hoxb-1 and Hoxb-4. Development
122, 3817-3828.
Birgbauer, E. and Fraser, S. E. (1994). Violation of cell lineage restriction
compartments in the chick hindbrain. Development 120, 1347-1356.
Bockman, D. E. and Kirby, M. L. (1984). Dependence of thymus
development on derivatives of the neural crest. Science 223, 498-500.
Carpenter, E. M., Goddard, J. M., Chisaka, O., Manley, N. R. and
Capecchi, M. R. (1993). Loss of HoxA-1 (Hox-1. 6) function results in the
reorganization of the murine hindbrain. Development 118, 1063-1075.
Chang, S., Fan, J. and Nayak, J. (1992). Pathfinding by cranial nerve VII
(facial) motoneurons in the chick hindbrain. Development 114, 815-823.
Cheng, H. J., Nakamoto, M., Bergemann, A. D. and Flanagan, J. G. (1995).
Complementary gradients in expression and binding of ELF-1 and Mek4 in
development of the topographic retinoectal projection map. Cell 82, 371-381.
Chisaka, O., and Capecchi, M. R. (1991). Regionally restricted
developmental defects resulting from targeted disruption of the mouse
homeobox gene Hox-1. 5. Nature 350, 473-479.
Chisaka, O., Musci, T. S. and Capecchi, M. R. (1992). Developmental defects
of the ear, cranial nerves and hindbrain resulting from targeted disruption of
the mouse homeobox gene Hox-1. 6. Nature 355, 516-520.
Cook, M., Gould, A., Brand, N., Davies, J., Strutt, P., Shaknovich, R., Licht,
J., Waxman, S., Chen, Z., Glueckson-Waelsch, S., Krumlauf, R., and
Zelent, A. (1995). Expression of the zinc-finger gene PLZF at rhombomere
boundaries in the vertebrate hindbrain. Proc. Natl. Acad. Sci. USA 92, 22492253.
Couly, G. F., Coltey, P. M. and Le Douarin, N. (1993). The triple origin of
skull in higher vertebrates: a study in quail-chick chimeras. Development
117, 409-429.
Davis, C. A. and Joyner, A. L. (1988). Expression patterns of the homeobox
containing genes En-1 and En-2 and the proto-oncogene int-1 diverge during
mouse development. Genes Dev. 2, 1736-1744.
Dollé, P., Lufkin, T., Krumlauf, R., Mark, M., Duboule, D. and Chambon,
P. (1993). Local alterations of Krox-20 and Hox gene expression in the
hindbrain suggest lack of rhombomeres 4 and 5 in homozygote null Hoxa-1
(Hox-1. 6) mutant embryos. Proc. Natl. Acad. Sci. USA 90, 7666-7670.
Drescher, U., Kremoser, C., Handwerker, C., Loschinger, J., Noda, M. and
Bonhoeffer F. (1995). In vitro guidance of retinal ganglion cell axons by
RAGS, a 25kDa tactal protein related to ligands for Eph receptor tyrosine
kinases. Cell 82, 359-370.
Dupé, V., Davenne, M., Brocard, J., Dollé, P., Mark, M., Dierich, A.,
Chambon, P., and Rijli, F. M. (1997) In vivo functional analysis of the
Hoxa-1 3′ retinoic acid response element (3′ RARE). Development 124, 399410.
Fraser, S., Keynes, R. and Lumsden, A. (1990). Segmentation in the chick
embryo hindbrain is defined by cell lineage restrictions. Nature 344, 431435.
Frohman, M. A., Boyle, M. and Martin, G. R. (1990). Isolation of the mouse
Hox-2. 9 gene; analysis of embryonic expression suggests that positional
information along the anterior-posterior axis is specified by mesoderm.
Development 110, 589-607.
Gendron-Maguire, M., Mallo, M., Zhang, M. and Gridley, T. (1993). Hoxa2 mutant mice exhibit homeotic transformation of skeletal elements derived
from cranial neural crest. Cell 75, 1317-1331.
Gilardi-Hebenstreit, P., Nieto, M. A., Frain, M., Mattéi, M-G., Chestier, A.,
Wilkinson, D. G. and Charnay, P. (1992). An Eph-related receptor protein
tyrosine kinase gene segmentally expressed in the developing mouse
hindbrain. Oncogene 7, 2499-2506.
Goddard, J. M., Rossel, M., Manley, N. R and Capecchi, M. R. (1996). Mice
with targeted disruption of Hoxb-1 fail to form the motor nucleus of the VIIth
nerve. Development 122, 3217-3228.
Graham, A. Francis West, P. and Lumsden, A. (1994). The signalling
molecule BMP-4 mediates apoptosis in the rhombencephalic neural crest.
Nature 372, 684-686.
Graham, A., Heyman, I. and Lumsden, A. (1993). Even-numbered
rhombomeres control the apoptotic elimination of neural crest cells from
odd-numbered rhombomeres in in the chick hindbrain. Development 119,
233-245.
Guthrie, S. and Lumsden, A. (1992). Motor neuron pathfinding following
rhombomere reversals in the chick embryo hindbrain. Development 114,
663-673.
Hallonet, M. E. R. and Le Douarin, N. M. (1993). Tracing neuroepithelial
cells of the mesencephalic and metencephalic alar plates during cerebellar
ontogeny in quail-chick chimaeras. Eur. J. Neurosci. 5, 1145-1155.
Hallonet, M. E. R., Teillet, M. A. and Le Douarin, N. M. (1990). A new
approach to the development of the cerrebelum provided by the quail-chick
marker system. Development 108, 19-31.
Hatten, M. E. and Heintz, N. (1995). Mechanisms of neural patterning and
specification in the developing cerebellum. Annu. Rev. Neurosci. 18, 385408.
Kessel, M. (1993). Reversal of axonal pathways from rhombomere 3 correlates
with extra Hox expression domains. Neuron 10, 379-393.
Keynes, R. and Krumlauf, R. (1994). Hox genes and regionalization of the
nervous system. Annu. Rev. Neurosci. 17, 109-132.
Köntges, G. and Lumsden, A. (1996). Rhomboencephalic neural crest
segmentation is preserved throughout craniofacial ontogeny. Development
122, 3229-3242.
Krumlauf, R. (1993). Hox genes and pattern formation in the branchial region
of the vertebrate head. Trends Genet 9, 106-112.
Le Lievre, C. S. and Le Douarin, N. M. (1975). Mesenchymal derivatives of
the neural crest: analysis of chimaeric quail and chick embryos. J. Embryol.
Exp. Morph. 34, 125-154.
Lufkin, T., Dierich, A., Le Meur, M., Mark, M. and Chambon, P. (1991).
Disruption of the Hox-1. 6 homeobox gene results in defects in a region
corresponding to its rostral domain of expression. Cell 66, 1105-1119.
Lumsden, A. (1990). The cellular basis of segmentation in the developing
hindbrain. Trends Neurosci. 13, 329-335.
Lumsden, A. and Keynes, R. (1989). Segmental patterns of neural
development in the chick hindbrain. Nature 337, 424-428.
Lumsden, A. and Krumlauf, R. (1996). Patterning the vertebrate neuraxis.
Science 274, 1109-1115.
Lumsden, A., Sprawson, N. and Graham, A. (1991). Segmental origin and
migration of neural crest cells in the hindbrain region of the chick embryo.
Development 113, 1281-1291.
Marin, F. and Puelles, L. (1995). Morphological fate of rhombomeres in
quail/chick chimeras: a segmental analysis of hindbrain nuclei. Eur. J.
Neurosci. 7, 1714-1738.
Mark, M., Lufkin, T., Vonesch, J. L., Ruberte, E., Olivo, J. C., Gorry, P.,
Lumsden, A. and Chambon, P. (1993). Two rhombomeres are altered in
Hoxa-1 mutant mice. Development 119, 319-338.
Marshall, H., Nonchev, S., Sham, M. H., Muchamore, I., Lumsden, A. and
Krumlauf, R. (1992). Retinoic acid alters hindbrain Hox code and induces
transformation of rhombomeres 2/3 into a 4/5 identity. Nature 360, 737-741.
Martinez, S. and Alvarado-Mallart, R. M. (1989). Rostral cerebellum
originates from the caudal portion of the so-called mesencephalic vesicle: a
study using chick/quail chimeras. Eur. J. Neurosci. 1, 549-560.
Martinez, S., Marin, F., Nieto, M. A. and Puelles, L. (1995). Induction of
ectopic engrailed expression and fate change in avian rhombomeres:
intersegmental boundaries as barriers. Mech. Develop. 51, 289-303.
Millen, K. J., Wurts, W., Herrup, K. and Joyner, A. L. (1994). Abnormal
embryonic cerebellar development and patterning of postnatal foliation in
two mouse Engrailed-2 mutants. Development 120, 695-706.
Niederländer, C. and Lumsden A. (1996). Late emigrating crest cells migrate
specifically to the exit points of cranial branchiomotor nerves. Development
122, 2367-2374.
Nieto, M. A., Gilardi-Hebenstreit, P., Charnay, P., Wilkinson, D. G. (1992).
A receptor protein tyrosine kinase implicated in the segmental patterning of
the hindbrain and mesoderm. Development 116, 37-50.
Noden, D. M. (1983). The role of the neural crest in patterning of avian cranial
skeletal, connective, and muscle tissues. Dev. Biol. 96, 144-165.
Nonchev, S., Vesque, C., Maconochie, M., Seitanidou, T., AizaMcNaughton, L., Frain, M., Marshall, H., Sham, M. H., Krumlauf, R.
and Charnay, P. (1996). Segmental expression of Hoxa-2 in the hindbrain is
directly regulated by Krox-20. Development 122, 543-554.
Prince, V. and Lumsden, A. (1994). Hoxa-2 expression in normal and
transposed rhombomeres: independent regulation in the neural tube and
neural crest. Development 120, 911-923.
Rijli, F. M., Mark, M., Lakkaraju, S., Dierich, A., Dolle, P. and Chambon,
P. (1993). A homeotic transformation is generated in the rostral branchial
region of the head by disruption of Hoxa-2, which acts as a selector gene. Cell
75, 1333-1349.
Schneider-Maunoury, S., Seitanidou, T., Charnay, P and Lumsden, A.
(1997). Segmental and neuronal architecture of the hindbrain of Krox-20
mouse mutants. Development 124, 1215-1226.
Schneider-Maunoury, S., Topilko, P., Seitanidou, T., Levi, G., CohenTannoudji, M., Pournin, S., Babinet, C., Charnay, P. (1993). Disruption of
3702 A. Gavalas and others
Krox-20 results in alteration of rhombomeres 3 and 5 in the developing
hindbrain. Cell 75,1199-1214.
Schubert, F. R., Fainsod, A., Gruenbaum, Y. and Gruss, P. (1995).
Expression of the novel murine homeobox gene Sax-1 in the developing
nervous system. Mech. Development 51, 99-114.
Sechrist, J., Serbedzija, G. N., Scherson, T., Fraser, S. E., and BronnerFraser, M. (1993). Segmental migration of the hindbrain neural crest does
not arise from its segmental generation. Development 118, 691-703.
Sham, M. H., Vesque, C, Nonchev, S., Marshall, H., Frain, M., Gupta, R. D.,
Whiting, J., Wilkinson, D., Charnay, P. and Krumlauf, R. (1993). The
zinc finger gene Krox20 regulates Hoxb-2 (Hox2. 8) during hindbrain
segmentation. Cell 72, 183-196.
Simeone, A., Acampora, D., Guilisano, M., Stornaiuolo, A., and Boncinelli,
E. (1992). Nested expression domains of four homeobox genes in the
developing brain. Nature 358, 687-690.
Studer, M., Lumsden, A., Ariza-McNaughton, L., Bradley, A. and
Krumlauf, R. (1996). Altered segmental identity and abnormal migration of
motor neurons in mice lacking Hoxb-1. Nature 384, 630-634.
Swiatek, P. J. and Gridley, T. (1993). Perinatal lethality and defects in
hindbrain development in mice homozygous for a targeted mutation of the
zinc finger gene Krox-20. Genes Dev 7, 2071-2084.
Tan, K. and Le Douarin, N. M. (1991). Development of the nuclei and cell
migration in the medulla oblongata-application of the quail-chick chimera
system. Anat. Embryol. 183, 321-343.
Taneja, R., Thisse, B., Rijli, F. M., Thisse, C., Bouillet, P., Dollé, P. and
Chambon, P. (1996). The expression pattern of the mouse receptor tyrosine
kinase gene MDK1 is conserved through evolution and requires Hoxa-2 for
rhombomere-specific expression in mouse embryos. Dev. Biol. 177, 397-412.
Tessier-Lavigne, M. and Goodman, C. S. (1996). The molecular biology of
axon guidance. Science 274, 1123-1133.
Varela-Echavarria, A. and Guthrie, S. (1997). Molecules making waves in
axon guidance. Genes Dev. 11, 545-557.
Wang, H. U. and Anderson, D. J. (1997). Eph family transmembrane ligands
can mediate repulsive guidance of trunk neural crest migration and motor
axon outgrowth. Neuron 18, 383-396.
Wilkinson, D. G. (1995). Genetic control of segmentation in the vertebrate
hindbrain. Perspec. Devel. Neurobiol. 3, 29-38.
Wilkinson, D. G., Bhatt, S., Chavrier, P., Bravo, R. and Charnay, P. (1989).
Segment-specific expression of a zinc-finger gene in the developing nervous
system of the mouse. Nature 337, 461-464.
Wingate, R. and Lumsden, A. (1996). Persistence of rhombomeric
organisation in in the postsegmental avian hindbrain. Development 122,
2143-2152.
Yang, X. W., Zhong, R. and Heintz, N. (1996). Granule cell specification in
the developing mouse brain as defined by the expression of the zinc finger
transcription factor RU49. Development 122, 555-566.
Zhang, M., Kim, H. J., Marshall, H., Gendron-Maguire, M., Lucas, DA.,
Baron, A., Gudas, L. J., Gridley, T., Krumlauf, R. and Grippo, J. F.
(1994): Ectopic Hoxa-1 induces rhombomere transformation in mouse
hindbrain. Development 120, 2431-2442.
(Accepted 14 July 1997)