Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Designing a switch to conditionally control gene expression in bacteria Reina Betancourt1,2, Travis Wiles3 and Karen Guillemin3 1. Georgia Institute of Technology, Atlanta, Ga 30332 2. Georgia State University, Atlanta, Ga 30303 3. University of Oregon, Eugene Or 97401 Abstract Optimizing Repression Engineering Scheme It has been recognized that coordinated expression of genes allows bacterial pathogens to develop and quickly respond to and survive host immune responses1. Of particular interest would be elucidating the mechanisms by which the complex bacterial communities that comprise host associated microbiota develop in the face of volatile fluctuations in environmental conditions. 1. Starting Vector Constitutive expression of dTomato (dTom) yields red only bacteria. In order to obtain a mutation free, functionally correct pRB2 construct, tetR expression was dampened by changing the base sequence at its ribosome binding site (RBS). This change in base pairs works at a translational level by modulating ribosomal affinity to tetR’s ribosome binding site. Ribosome Binding Site Sequence Logo for tetR in E. coli Question: How do gene expression patterns control the development of microbiota? Hypothesis: Bacterial members of the normal zebrafish gut microbiota require coordinated gene expression for community development and function within the host. 2. Insert Specifically we wanted to observe how expression patterns for genes that control motility and chemotaxis influenced bacterial behaviors of swimming and biofilm formation. We wanted to vary gene expression as bacteria progressed through the three major growth phases. To this end we set out to engineer a genetic device that would allow us to conditionally control and track gene expression. RBS The AvrII and SacI restriction sites were used to insert a tet-inducible element containing sfGFP. At this stage bacteria express both red and green protein. 3. Repression Inspiration The NotI and SalI restriction sites were used to insert the tetR gene. The PLtetO promoter is repressed which results in red only bacteria unless induced with aTc to yield bacteria that are both red and green. Naturally occurring tetR used in pRB2 TTAGGAATTAATGATGTCTAGATTAGAT tetR library with randomized RBS. N=A/G/C/T, R=A/G, D=A/G/T TNDRRDNATTACATCATGTCTAGATTAG Functional clone (pRB3). 3. Repression (pRB3) 4. Gene of Interest The multiple cloning site allows for genes of interest to be inserted into to the construct. The gene can then be conditionally expressed and tracked in vivo. TCTAGGTATTACATCATGTCTAGATTAG sfGFP dTom Merged A single colony grown with stage 3 plasmid. The pRB3 construct demonstrated noticeably higher expression of the dTom gene. Construction of the Switch 1. Starting Vector (pTW92) The naturally occurring tet repressor system negatively controls tetracycline (tc) resistance. In the presence of tc the constitutively produced TetR protein is inhibited and detaches from its cognate DNA sequence allowing the expression of tetA which codes for a tc antiporter (efflux pump)2. Design sfGFP dTom sfGFP Merged A single colony grown with the starting vector 2. Insert (pRB1) sfGFP dTom Merged Merged In a functional test, pRB3 showed visible induction of GFP with the addition of aTc. Result: Successful construction of an aTc inducible switch using modified synthetic transcriptional elements and translationally optimized modulation of gene expression. A single colony grown with stage 2 plasmid. 3. Repression (pRB2) dTom Future Directions sfGFP dTom Merged A single colony grown with stage 3 plasmid. sfGFP dTom (4X) Merged Same as above with dTom image at 4X the intensity. 4. Gene of Interest The next step will be inserting genes of interest into the synthetic construct, pRB3, transforming it into natural isolates of the zebrafish microbiota and observing the effects of gene expression on bacterial behavior. The switch could potentially be a key tool in future experiments centered around the identification and characterization of genetically encoded behaviors. References The pRB2 construct was sequenced confirmed, but demonstrated very dim expression of dTom. Our design uses an analog of tc, aTc, a similarly powerful inducer molecule without antibiotic properties. The construct will allow for the tracking of gene expression using co-transcribed genes that code for fluorescent proteins. The backbone of the vector codes for ampicillin resistance, which allows for selective growth of bacteria containing the plasmid. In a functional test, aTc was added to a small disc of Whatman filter paper that was placed on a plate of E. coli containing the pRB2 construct and no induction of sfGFP was observed. sfGFP dTom Merged The only clones that were functionally correct were those that had a mutated tetR gene. Conclusion: Over expression of TetR from the strong Ptac promoter might result in inappropriately high levels of TetR, thus explaining lack of induction and off target repression of dTom. 1. Miller, J. F., Mekalanos, J. J., & Falkow, S. (1989). Coordinate regulation and sensory transduction in the control of bacterial virulence. Science, 243(4893), 916. 2. Bertram R, Hillen W. The application of Tet repressor in prokaryotic gene regulation and expression. Microbial Biotechnology. 2008;1:2–16. Acknowledgements Thank you to everyone in the Guillemin lab, my mentor Travis Wiles. Peter O’Day, Marilyn Drennan, all of the SPUR interns, and everyone else involved in SPUR. Thank you to the National Science foundation Research Experience for Undergraduates Site Program in Molecular Biosciences at the University of Oregon (NSF DBI/BIO 1460735) and the National Institute of Diabetes and Digestive and Kidney Diseases (Grant #1R01DK101314) for funding this project.