Download Infant serotonin transporter (SLC6A4) promoter genotype is

Molecular Psychiatry (2008) 13, 65–73
& 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00
www.nature.com/mp
ORIGINAL ARTICLE
Infant serotonin transporter (SLC6A4) promoter genotype
is associated with adverse neonatal outcomes after
prenatal exposure to serotonin reuptake inhibitor
medications
TF Oberlander1, RJ Bonaguro2, S Misri3, M Papsdorf1, CJD Ross2 and EM Simpson2,3
1
Early Human Experience Unit, Department of Pediatrics, Centre for Community Child Health Research, University of British
Columbia, Vancouver, BC, Canada; 2Centre for Molecular Medicine and Therapeutics and Child & Family Research Institute,
Department of Medical Genetics, University of British Columbia, Vancouver, BC, Canada and 3Department of Psychiatry,
University of British Columbia, Vancouver, BC, Canada
Reduced Apgar scores and birth weight, increased risk of respiratory distress, jitteriness and
increased tone have been reported in up to 30% of neonates with prenatal exposure to
serotonin reuptake inhibitor (SRI) antidepressant medications. In adults, effects of these
medications may be related to the genotype for the serotonin transporter (SLC6A4) promoter.
In this study we investigated whether SLC6A4 genotype influences the risk for adverse
outcomes in neonates with prenatal SRI exposure. Neonatal outcomes including Apgar scores,
birth weight, gestational age at birth, symptoms of poor neonatal adaptation and genotype for
SLC6A4 were determined in 37 prenatally SRI exposed neonates and compared with 47 nonexposed neonates. Reduced 5 min Apgar scores were observed in exposed neonates and this
was moderated by the ss genotype (P < 0.001). Birth weight was lower in exposed ls neonates
(P = 0.008). Risk for respiratory symptoms (respiratory distress and rapid breathing) was higher
in exposed neonates with the ll genotype compared to non-exposed neonates (P < 0.05) and
risk for neuromotor symptoms increased in exposed ss neonates (P < 0.026). These relationships remained when controlling for maternal mood during pregnancy, length of gestational
medication exposure and gestational age at birth and cesarean section rate. Prenatal SRI
exposure was associated with adverse neonatal outcomes and these effects were moderated
by infant SLC6A4 genotype. Relationships between polymorphisms and specific outcomes
varied during the neonatal period, suggesting that beyond apparent gene-medication
interactions, multiple mechanisms contribute to adverse neonatal outcomes following prenatal
SRI exposure.
Molecular Psychiatry (2008) 13, 65–73; doi:10.1038/sj.mp.4002007; published online 22 May 2007
Keywords: serotonin transporter (SLC6A4) promoter; neonatal behavior; prenatal exposure to
serotonin reuptake inhibitor medications; prenatal maternal depression
Introduction
Mechanisms that explain why some infants experience poor neonatal outcomes after prenatal exposure
to serotonin reuptake inhibitor (SRI) antidepressant
medications (selective serotonin reuptake inhibitors
and serotonin norepinephrine reuptake inhibitors)
remain unclear. Prenatal exposure has been associated with respiratory distress, increased motor tone
and feeding/digestive disturbances in approximately
30% of exposed newborns.1 Some studies report
that third trimester exposure leads to reduced Apgar
scores2 and low birth weight, as well as increased
Correspondence: Dr TF Oberlander, Early Human Experience
Unit, Centre for Community Child Health Research, Room L408,
4480 Oak St., Vancouver, BC, Canada V6H 3V4.
E-mail: [email protected]
Received 24 October 2006; revised 7 February 2007; accepted 8
February 2007; published online 22 May 2007
rates of premature birth and increased risk for
admission to special care nurseries,3 while other
studies have not found similar outcomes.4,5 Concern
about these adverse outcomes led the US FDA6 (US
Food and Drug Administration) and Health Canada7
to issue warnings in 2004 regarding late pregnancy
use of SRIs. Compounding medication-related effects,
adverse neonatal behaviors have also been observed
following exposure to maternal depression alone8 and
therefore identifying SRI-related outcomes has been
challenged by the difficulty of distinguishing medication effects from the effects of the maternal disease
itself.9
A number of mechanisms have been proposed to
explain neonatal adverse outcomes associated with
prenatal SRI exposure, including prolonged prenatal
central neurotransmitter suppression,10 pharmacological toxicity,11 altered pulmonary vasculature,3
changes in central serotoninergic neurodevelop-
Serotonin reuptake inhibitor
TF Oberlander et al
66
ment12 and effects of exposure to maternal illness
itself.13 Given that SRIs block the reuptake of
serotonin (5HT) within the presynaptic cleft via the
serotonin transporter (5HTT), this transporter plays a
key role as a regulator of serotoninergic neurotransmission and modifier of SRIs effects. Differences in
transporter-dependent reuptake efficiency are related
to insertion/deletion polymorphisms in the promoter
region of the SLC6A4 gene (termed the 5HTT-linked
polymorphic region or 5HTTLPR), leading to differential transporter gene expression and clinical differences in SRI efficacy.14,15
SLC6A4 (OMIM16 182138; previous names: 5HTT;
serotonin transporter (SERT)) codes for a serotonin
reuptake transporter that plays a key role in the
regulation of serotoninergic neurotransmission.
SLC6A4 transporter 5HT into the presynaptic neuron
after serotonin release in brain synapses, which
terminates the synaptic actions of serotonin.15,17–19
SRI-mediated blockade of SLC6A4 leads to the
accumulation of serotonin in the synaptic cleft and
a clinical reduction in depressed mood. A 44 basepair insertion/deletion polymorphism in a region of
repetitive sequence in the proximal 50 regulatory
region of the SLC6A4 gene has been shown to alter
SLC6A4 transcription and activity19–21 leading to
differences in SRI efficacy.14,15 The short (s) variant
is associated with reduced transcription of SLC6A4
and approximately 50% reduction in serotonin
reuptake compared with the long (l) variant.20,22
The ll genotype is associated with significantly
better responses to paroxetine and fluoxetine compared with carriers of the ss genotype.14,23–25 Other
studies have found the opposite15 or no clinical
effect.26 The ss SLC6A4 genotype has also been
associated with increased paroxetine-related sideeffects in adults.24,25
Given that SRI clinical effects may vary with
SLC6A4 genotype, we sought to examine whether
such a relationship exists between this SLC6A4
polymorphism and the risk for adverse neonatal
outcomes after gestational SRI exposure. In particular,
we aimed to determine whether SLC6A4 genotype
moderates the association between SRI exposure and
adverse neonatal outcomes. We hypothesized that
prenatal SRI exposure would lead to increased risk for
adverse outcomes in neonates with two copies of the s
allele as a consequence of the reduced SLC6A4
transcription and activity and increased intrasynaptic
serotonin levels. Namely, an ss individual would in
effect be receiving a higher ‘effective’ dose since there
is less serotonin transporter that must be blocked by
the SRI leading to an increased incidence of symptoms of poor neonatal adaptation (PNA) and other
adverse neonatal outcomes.
Methods
Subjects
With approval from the University of British Columbia Research Ethics Board, Children’s and Women’s
Molecular Psychiatry
Health Centre of British Columbia Research Review
Committee, and informed parent consent, a cohort
(n = 98) of mothers was recruited in their early second
trimester as part of a study of psychotropic medication use during and following pregnancy. From this
cohort neonatal cord and maternal blood samples
were obtained for DNA analysis. Of the original 98
mothers approached samples from 14 mothers and
infants were not available for analysis because of
technical reasons (that is, subject withdrew for
personal reasons, inadequate DNA yield, infant blood
sample was not obtained at birth) leaving 47 mother–
infant samples in the non-medication group and 37
matched samples in the SRI-exposed group. One
mother had twins, but only one of the infants
participated in this study. None of the mothers
took other serotoninergic medications during their
pregnancies.
Mothers in the SRI treated group, with the exception of two who were started on medication during
their second trimester, were already on medication at
the time of recruitment and all continued on medication up to the time of delivery (Table 1). Outcomes
were compared with healthy mothers not using any
medication. Mothers were included if no other
psychotropic or antidepressant medications were
used during their pregnancy.
SLC6A4 genotyping
Genomic DNA was extracted from whole-venous
blood using the Flexigene DNA Blood Kit (Qiagen,
Valencia, CA, USA). The l and s alleles of SLC6A4
were identified as described previously.19 Briefly,
PCR was carried out with oligonucleotide primers
flanking the polymorphism (corresponding to the
nucleotide positions 1416 to 1397 (stpr5, 50 GGCGTTGCCGCTCTGAATGC) and 910 to 888
(stpr3, 50 -GAGGGACTGAGCTGGACAACCAC) of the
50 -flanking regulatory region of SLC6A4 to generate a
484- (s short allele) or 528-bp (l long allele) PCR
product. PCR amplification was carried out in a final
volume of 30 ml with 50 ng of genomic DNA, 2.5 mM
deoxyribonucleotides (dGTP/7-deaza-20 -dGTP = l/l),
0.1 mg of sense and antisense primers, 10 mM Tris–
HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 and 1 U of Taq
DNA polymerase. Annealing was carried out at 611C
for 30 s, extension at 721C for 1 min and denaturation
at 951C for 30 s for 35 cycles. As a quality control 5%
of samples were randomly chosen and retested and
their genotypes were consistent with previous results.
Neonatal health
Using previously reported outcomes3,11 neonatal outcomes during two distinct time periods were tabulated. From the immediate newborn period Apgar
scores at 1 and 5 min, birth weight, head circumference, length and gestational age at birth were
obtained. To distinguish these immediate birth outcomes from those in the later neonatal period, we
defined measures of PNA (extending from at least 2 h
from birth to time of discharge) as the presence or
Serotonin reuptake inhibitor
TF Oberlander et al
Table 1
67
Maternal and infant demographics characteristics
No
Exposure (n = 47)
mean (s.d.)
Maternal demographics characteristics
Maternal age at birth (years)
Maternal education (years)
Delivery (n: vaginal/c section)
Maternal mood 2nd trimester
HAM-A total score
HAM-D total score
Edinburgh Postnatal Depression Scale
Maternal mood 33 weeks
HAM-A total score
HAM-D total score
Edinburgh Postnatal Depression Scale
SRI third trimester dose (n) (median mg (range: min–max))
Paroxetine (18)
Fluoxetine (6)
Sertraline (5)
Venalfaxine (3)
Citalopram (5)
Maternal SLC6A4 genotype (n)
ll
ls
ss
Neonatal characteristics
Gestation age at birth (weeks)
Birth weight (grams)
Small for gestational age (X38 weeks and < 2500 g at birth) (n)
Birth length (cm)
Head circumference (cm)
Sex (M:F)
SRI exposure during pregnancy (no. of days)
Apgar score at 1 min
Apgar score at 5 min
Neonatal SLC6A4 genotype (n)
ll
ls
ss
SRI
Exposure (n = 37)
mean (s.d.)
32.70 (4.96)
17.38 (3.07)
35/18
31.84 (4.77)
15.3 (2.45)
26/15
7.30 (7.42)
6.33 (7.34)
5.86 (6.25)
14.16 (7.44)*
12.65 (6.48)*
10.41 (6.16)*
5.79 (4.93)
3.77 (4.44)
4.91 (4.79)
11.43 (7.50)*
9.43 (6.03)*
8.30 (4.53)
NA
NA
NA
NA
NA
13
26
8
40.14 (1.18)
3605.94 (517)
1
52.09 (2.95)
35.04 (1.30)
24:29
0.00 (0.00)
8.13 (1.36)
9.06 (0.48)
14
22
11
27.5
35
100
75
30
(2.5–45)
(10–50)
(50–175)
(37.5–150)
(20–40)
13
14
9
39.34 (1.49)*
3404.95 (506.77)
3
50.85 (2.52)
34.55 (1.34)
19:22
223.95 (74.67)
7.54 (1.46)
8.70 (0.85)*
14
16
7
Abbreviations: HAM-A, Hamilton Rating Scale for Anxiety; HAM-D, Hamilton Rating Scale for Depression; NA, not applicable;
s.d., standard deviation.
*P < 0.05 for differences between SRI and control groups.
absence of bradycardia ( < 100 b.p.m.), tachycardia
( > 160 b.p.m.), increased neuromuscular tone, jitteriness, respiratory distress (nasal flaring, indrawing, grunting), tachypnea ( > 60 min), hypoglycemia
( < 3.3 mmol/l) or hyperglycemia ( > 7.0 mmol/l).
While temperature instability has been previously
reported, it was not quantified as an outcome in
this study because of the lack of clear definitional
parameters in the literature.1,3 Occurrences of
these outcomes were obtained from a chart review
by two research nurses blinded to exposure group
status and genotype.
Maternal mood
During the pregnancy, maternal mood was assessed at
the time of study enrollment (approximately 26–28
weeks) and again at 33 weeks gestation using three
instruments. The Hamilton Rating Scale for Depression (HAM-D)27 is a 21-item clinician administered
scale that measures the severity of depression in
adults. Scores on this scale have a possible range of
0–63, with higher scores being associated with higher
levels of depression in the patient. Scores ranging
from 0 to 7 suggest no or minimal levels of depression, 8–17 indicate mild depression, 18–25 suggest
moderate depression, and scores of 26 and above are
associated with severe depression. The Hamilton
Rating Scale for Anxiety (HAM-A)28 is a 14-item
clinician administered scale that measures the severity of anxiety. Total scores on this scale have a
possible range of 0–56, with higher scores being
associated with higher levels of anxiety in the patient.
Scores ranging from 0 to 7 suggest no or minimal
levels of anxiety, 8 to 17 indicate mild anxiety,
Molecular Psychiatry
Serotonin reuptake inhibitor
TF Oberlander et al
68
18 to 25 suggest moderate anxiety and scores
of 26 and above are associated with severe anxiety.
The Edinburgh Postnatal Depression Scale,29 is a
10-item, patient-rated instrument used to assess
symptoms of depressed mood in both pre- and
postnatal settings.
Statistical analysis
Factorial analyses of variance were used to examine
group (exposed vs non-exposed) and genotype differences in outcomes, as well as the interaction between
exposure and genotype to assess the role of SLC6A4
genotype as a possible moderator of exposure. Data
are presented as raw data. w2 and hierarchical logistic
regression models were used to determine whether
adverse neonatal outcomes would be predicted by
SLC6A4 genotype. Effect sizes (Z2) were calculated
and are presented in the text below.
Results
Demographic characteristics
Maternal and neonatal demographic characteristics
and maternal SRI medication use are presented in
Table 1. In the SRI treatment group, levels of
depression and anxiety symptoms during pregnancy
were significantly higher (all P’s < 0.001). SLC6A4
genotype ratios were distributed according to Hardy–
Weinberg equilibrium for all 176 subjects (85 infant
and 91 maternal) together (allele frequency l = 56%
and s = 44%; and genotype frequency: ll = 32%,
ls = 47%, and ss = 20%), as well as mothers and
infants separately (Tables 1 and 2). As expected, the
allele frequency and genotype distribution was not
different between the exposed and non-exposed
mothers. Mean daily dose or length of prenatal SRI
Table 2
exposure did not vary significantly between genotypes (Table 2).
Immediate neonatal outcomes
SRI exposed infants were born earlier (F = 6.16,
P = 0.015, Z2 = 0.07) and had lower Apgar scores
at 1 (F = 4.79, P = 0.032, Z2 = 0.06) and at 5 min
(F = 11.23, P = 0.001, Z2 = 0.13) compared to nonexposed infants (Table 1). At 1 min, the association between SRI exposure and differences in Apgar
scores was not moderated by SLC6A4 genotype
(F = 2.25; P = 0.112, Z2 = 0.05), while at 5 min there
was a significant interaction between SRI exposure
and SLC6A4 genotype (F = 3.28, P = 0.043, Z2 = 0.08;
Figure 1).
Simple effects tests revealed that neonates with the
ss genotype had significantly lower 5 min scores, but
only when they had prenatal SRI exposure (F = 12.43,
P < 0.001, Z2 = 0.24), controlling for maternal mood
during pregnancy, cesarean section rate and gestational age at birth. Interestingly, reduced Apgar scores
were primarily due to reduced respiratory effort subscale scores at 1 and 5 min (exposure vs no exposure:
1.48 vs 1.72; P = 0.062 and 1.81 vs 1.99; P = 0.009,
at 1 and 5 min, respectively).
There was also a significant interaction between
SRI exposure and SLC6A4 genotype on birth weight,
such that exposed babies had a significantly lower
birth weight among neonates with the ls genotype
(F = 7.45, P = 0.008, Z2 = 0.19; Table 2). These effects
remained significant when controlling for gestational
age at birth, maternal pregnancy-related mood and
length of prenatal SRI exposure. Interestingly,
when controlling for gestational age, birth weight
was higher in ss exposed neonates compared with
non-exposed neonates (F = 4.50, P = 0.037, Z2 = 0.29).
Infant outcomes and SLC6A4 genotype: means (s.d.)
SLC6A4 genotype
Duration of prenatal SRI
exposure (days)
Maternal mean daily dose of
medication (z scorea)
Gestational age at birth (weeks)
Birth weight (g)
Birth length (cm)
Head circumference (cm)
Length of newborn stay in
hospitals (h)
ll
ls
ss
No
exposure
(n = 14)
SRI
exposure
(n = 14)
No
exposure
(n = 22)
SRI
exposure
(n = 16)
No
exposure
(n = 11)
SRI
exposure
(n = 7)
NA
240 (57)
NA
206 (92)
NA
231 (62)
NA
0.181 (0.138)
NA
0.299 (0.283)
NA
0.153 (0.101)
39.8
3583
52.3
34.8
51.0
(1.45)
(594)
(3.80)
(1.49)
(22.2)
39.4
3416
50.1
34.3
61.3
(1.48)
(509)
(2.27)
(1.34)
(27.9)
40.3
3691
51.9
35.2
48.6
(1.03)
(455)
(2.70)
(1.28)
(25.6)
39.3
3239
50.5
34.5
61.3
(1.61)
(549)*
(2.42)
(1.17)
(40.9)
40.3
3465
52.3
35.0
46.9
(1.09)
(545)
(2.40)
(1.14)
(27.6)
39.4
3763
53.1
35.2
62.1
(1.44)
(367)
(2.28)
(1.68)
(21.4)
Abbreviations: NA, not applicable; SRI, serotonin reuptake inhibitor.
*P < 0.05 for differences between exposure and non-exposure within genotypes.
a
A composite drug dosage ‘z score’ was tabulated for drug dosage to account for multiple drugs each with varying drug dose
ranges.
Molecular Psychiatry
Serotonin reuptake inhibitor
TF Oberlander et al
a
b
1 Minute Apgar
9.5
9
Apgar Score
9
Apgar Score
69
5 Minute Apgar
9.5
8.5
ll
ls
ss
8
7.5
7
8.5
*
ll
ls
ss
8
7.5
7
6.5
6.5
6
6
No exposure
No exposure
SRI exposure
SRI exposure
Figure 1 Apgar score, SLC6A4 genotype and SRI exposure. At 1 min Apgar (a) score was not moderated by SLC6A4
(F = 2.25, P = 0.112), while at 5 min, (b) there was a significant interaction between SRI exposure and SLC6A4 genotypes
*(F = 3.28, P = 0.043).
Proportions of Neonates with PNA symptoms
50
*
*
Proportions (%)
40
No exposure (n=47)
SRI exposure (n=37)
30
20
10
0
Tachycardia
(>160 bpm)
Bradycardia
(<100 bpm)
Tachypnia
(> 60 min)
Respiratory
Distress
Jitteriness
Increased
Motor Tone
Hypoglycemia Hyperglycemia
(< 3.3 mmol/l) (>7.0 mmol/l)
Neonatal Outcomes
*differences in proportions of SRI exposed symptomatic neonates compared with non
exposed neonates, Pearson’s X2 P < 0.05, controlling for 3rd trimester maternal mood
Figure 2
Proportions of neonates with symptoms of poor neonatal adaptation (PNA).
Gestational age at birth was not moderated by SLC6A4
genotype (P > 0.250).
Late neonatal outcomes
Beyond the immediate neonatal period (that is, at
least greater than 2 h of life), the incidence of
PNA were significantly increased in SRI exposed
infants as reflected by respiratory distress (indrawing,
tugging), jitteriness at rest and increased muscular
tone (Figure 2).
When maternal mood was included as a covariate
in logistic regression models, SRI exposure only
significantly predicted respiratory distress and jitteriness (both P’s < 0.010, odds ratios = 9.3 and 10.6,
respectively). Moreover, hierarchical w2 tests (see
Table 3) revealed that SLC6A4 genotype moderated
the effect of prenatal SRI exposure, as exposed infants
with an ll genotype were at increased risk for rapid
breathing ( > 60 min; w2 = 5.60, P = 0.018), respiratory
distress (w2 = 4.09, P = 0.043) and jitteriness (w2 = 6.09,
P = 0.014). Likewise, exposed infants with an ss
genotype were at increased risk for jitteriness
(w2 = 4.92, P = 0.026) and abnormal tone (w2 = 5.66,
P = 0.017), while those with an ls genotype were also
at increased risk for respiratory distress (w2 = 6.16,
P = 0.013) compared with non-exposed neonates with
the same genotypes. Cesarean delivery was not a
significant covariate.
Discussion
Prenatal SRI exposure was associated with adverse
neonatal outcomes, consistent with numerous previous reports;2,3,10,11 however, these effects were
moderated by infant SLC6A4 genotype. Specifically,
prenatal SRI exposure was associated with reduced 1
and 5 min APGAR scores, but only the latter was
associated with a genotype-SRI exposure interaction.
In the immediate newborn period lower 5 min Apgar
Molecular Psychiatry
Serotonin reuptake inhibitor
TF Oberlander et al
70
Table 3
Frequency (%) of PNA symptoms by SLC6A4 genotype and SRI exposure
SLC6A4 genotype
Tachycardia ( > 160 bpm)
Bradycardia HR ( < 100 bpm)
Tachypnea breathing ( > 60 min)
Respiratory distress
Jitteriness
Increased motor tone
Hypoglycemia ( < 3.3 mmol/l)
Hyperglycemia ( > 7.0 mmol/l)
ll
ls
ss
No
exposure
(n = 14)
SRI
exposure
(n = 14)
No
exposure
(n = 22)
SRI
exposure
(n = 16)
No
exposure
(n = 11)
SRI
exposure
(n = 7)
14.3
7.1
14.3
14.3
0.0
0.0
7.1
0.0
57.1
0.0
57.1*
50.0*
35.7*
14.3
21.4
7.1
13.6
4.5
13.6
9.1
9.1
0.0
9.1
0.0
25.0
0.0
25.0
43.8*
25.0
0.0
25.0
0.0
27.3
0.0
27.3
9.1
9.1
0.0
9.1
0.0
14.3
0.0
14.3
42.9
57.1*
42.9*
14.3
14.3
Abbreviations: PNA, poor neonatal adaptation; SRI, serotonin reuptake inhibitor.
*Compared with no exposure on Pearson’s w2 (all P < 0.05).
scores were observed in exposed neonates with the ss
SLC6A4 genotype. Lower birth weight was observed
in exposed neonates with the ls genotype, while an
increased birth weight was also observed in exposed
ss neonates, even when accounting for gestational age
at birth. In the later neonatal period, neonates with ll
genotype carried an increased risk for respiratory
distress and tachypnea, while the ss neonates had an
increased risk for jitteriness and increased muscular
tone. Neither head circumference nor the incidence of
hypo/hyperglycemia or tachycardia was affected by
SRI exposure or SLC6A4 genotype. Moreover none
these outcomes were related to the effects of exposure
to depressed or anxious prenatal maternal mood,
having a cesarean delivery, gestational age at birth or
length of prenatal medication exposure. The number
of infants with a given medication exposure was
small and therefore we were not able to determine
whether risk for a particular gene exposure interaction was associated with a specific SRI. Further, birth
weight was also affected, particularly in ls and ss
exposed neonates. While reduced birth weights have
been reported following prenatal exposure (consistent
with the ls genotype), the increased birth weight in
ss neonates is a new finding with no mechanism
apparent and will have to be studied further. It
remains possible that an increased risk for respiratory
distress was also associated with the ss allele, but due
to our small sample size of ss neonates we may have
lacked the power to demonstrate this relationship.
Importantly, the SRI dosage in the treatment group
was consistent with typical doses used in clinical
practice,30 and was assumed to be adequate given the
maternal mood ratings during the second and third
trimesters.
A number of pharmacological and neurotransmitter
related mechanisms have been proposed that may
account for poor neonatal outcomes following prenatal SRI exposure. These include pharmacological
factors related to varying half lives, pharmacologiMolecular Psychiatry
cally active metabolites31 and possible competitive
inhibition with other medications.11 Paroxetine’s
high potency for inhibition of 5HT reuptake and
affinity for muscarinic receptors may lead to adverse
neonatal outcomes once medication exposure ceases,
suggesting a ‘discontinuity condition’ as proposed by
Moses-Kolko.1 Alternatively some of our findings
could also represent a condition analogous to the
‘serotonin syndromes’ observed in adults32 associated
with increased intrasynaptic serotonin (leading to
increased postsynaptic serotonin receptor stimulation), resulting in nausea, diarrhea, agitation and
insomnia.32–34 Possible altered regulation of noradrenergic and dopaminergic systems have also been
suggested.35 While many of these processes have not
been confirmed as a mechanism in prenatally exposed neonates, there are reports of symptoms that
might support some of these as possible mechanisms
in exposed neonates.3,10,36,37
Our findings appear to illustrate a biphasic pattern
of adverse outcomes that may reflect the presence of
both a ‘discontinuation’ and a ‘serotonin syndrome’
condition depending on neonate genotype and the
time interval from birth during which the infant
symptom was observed, as well as the specific
symptom itself. In the immediate postnatal period
(reflecting prenatal conditions) we observed reduced
Apgars at 1 and 5 min (primarily driven by reduced 1
and 5 min respiratory effort scores), particularly
in ss neonates. Such neonates would have experienced long-term blockade of 5HT reuptake, leading
to chronic high levels of intrasynaptic serotonin
(Figure 3a) and coupled with increased postsynaptic
receptor sensitivity could lead to a condition analogous to a ‘serotonin syndrome’ condition as observed
in adults.32,33 It is conceivable that during this
immediate newborn time, the combination of SRIinduced 5HT transporter blockade (leading to reduced neuronal 5HT and increased intrasynaptic 5HT),
and a less efficient ss genotype (that is, reduced
Serotonin reuptake inhibitor
TF Oberlander et al
a
71
Possible effects of prolonged prenatal SRI exposure
Presynaptic neuron
5HT Transporter
(intramembrane)
Intrasynaptic 5HT
reuptake via transporter
SRI exposure:
blocks 5HT
reuptake
5HT
5HT Transporter
blockade leading to
chronically high
prenatal
intrasynaptic 5HT
levels
5HT
5HT
5HT
5HT
5HT
5HT
5HT
Postsynaptic neuron
5HT postsynaptic
receptors
b
Possible increased postsynaptic
5HT receptor sensitivity following
prolonged prenatal SRI exposure
Immediate Newborn Period:
Continued SRI exposure and SLC6A4 genotype and neonatal behavior
ll genotype:
(Efficient gene transcription)
ss genotype:
(Inefficient gene transcription)
SRI blocked
5HT reuptake
5HT Transporter
(intramembrane)
5HT
SRI blocked
5HT reuptake
5HT
5HT
5HT
“Typical” Apgar Scores
(ll genotype):
“relative” abundance of 5HT
transporter able to
”compensate” for increased
intrasynaptic 5HT secondary
to SRI exposure and
increased post synaptic 5HT
receptor sensitivity
c
5HT
5HT
Increased 5HT
postsynaptic receptor
sensitivity
Reduced Apgar Score
(ss genotype):
“reduced” 5HT transporter
leads to less 5HT reuptake, an
“overabundance” of
intrasynaptic 5HT and
increased post synaptic 5HT
receptor sensitivity
Later Newborn Period (> 2 hrs of life):
Diminishing SRI exposure, SLC6A4 genotype and neonatal
behavior
ll genotype:
(Efficient gene transcription)
ss genotype:
(Inefficient gene transcription)
Diminishing SRI
levels and 5HT
reuptake blockade
5HT Transporter
(intramembrane)
5HT
Diminishing SRI
levels and 5HT
reuptake blockade
5HT
5HT
5HT
Respiratory Distress
(ll genotype):
“relative” abundance of 5HT
transporter transcription leads to
relative''deficiency'' of
intrasynaptic 5HT, but with
continuing increased post synaptic
5HT receptor sensitivity could still
lead to respiratory symptoms
Figure 3
5HT
5HT
5HT
5HT
5HT
5HT
5HT
Increased 5HT
postsynaptic receptor
sensitivity
5HT
5HT
Neuromotor irritability
(ss genotype):
reduced 5HT transporter
transcription leads to less 5HT
reuptake and relative
“overabundance” of intrasynaptic
5HT, and coupled with continued
increased post synaptic 5HT
receptor sensitivity, could lead to
increased neuromotor symptoms
Hypothetical schema for possible interactions between SLC6A4, 5HT, SRI and neonatal outcomes.
expression of the transporter gene and less 5HT
reuptake), could result in even greater intrasynaptic
5HT levels (Figure 3b). Namely, there would be less
‘target’ serotonin for SRI-mediated blockade, leading
to reduced 5HT removal and relatively increased 5HT
in the synapse. Alternatively, the increased efficiency
Molecular Psychiatry
Serotonin reuptake inhibitor
TF Oberlander et al
72
associated with the SLC6A4 ll genotype might
‘compensate’ for the effects of increased intrasynaptic 5HT, thereby ‘protecting’ the neonate from the
effects of excess intrasynaptic 5HT associated with
prenatal exposure. This might be analogous to the
improved clinical responsiveness to paroxetine and
fluoxetine in adults with the ll genotype25 compared
to those with the ss genotype.14,23–25 Other studies
have found the opposite15 or no clinical effect at all.26
Moreover, Murphy et al. (2004) reported that adults
with the ss genotype experienced significantly more
severe adverse events and tolerated lower doses of
paroxetine.24,25
In contrast, during the later postnatal period (at
least 2 h from birth) we observed a variety of
symptoms characterized by respiratory distress and
increased neuromotor tone. During this time SRI
exposure and suppression of 5HT reuptake presumably diminishes resulting in relative decreased levels
of intrasynaptic 5HT. However, such decreased 5HT
coupled with continued supersensitive upregulated
postsynaptic receptors could lead to a situation
reflecting a ‘discontinuation’ condition seen in
adults.38 In the exposed ll neonate, where there
might be a relative abundance of transporter (that is,
efficient SLC6A4 transcription), leading to improved
neonatal reuptake and possibly more ‘normalizing’
levels of intrasynaptic 5HT. However in the continued
presence of increased postsynaptic 5HT receptor
sensitivity this might still lead to increased risk for
respiratory distress. In contrast, the neonate with ss
genotype and SRI exposure, may be unable to
‘efficiently’ uptake 5HT presynaptically, resulting in
a ‘relative excess’ of intrasynaptic 5HT leading to
increased risk for jitteriness and muscle tone. However, precise mechanisms that account for each
condition remain a matter for future studies.
Reduction of Apgar scores, birth weight and an
increased risk for symptoms of PNA have been
observed in approximately 30% of neonates with
prenatal SRI exposure.1 In this study such adverse
neonatal outcomes appear to be to some extent
moderated by SLC6A4 genotype, suggesting a gene–
environment interaction that may account for why
some neonates are affected and others are not. The
evidence that the SLC6A4 variants moderate the effect
of SRI exposure remains ambiguous. Poor neonatal
outcomes in this setting are multifactoral and may
also reflect a multigenetic process and the gene–
environment interaction studied here may be one of
many interdependent factors that explain the risk in
this setting. In this study infant SLC6A4 genotype
appeared to account for some, but not all of the
adverse outcomes following prenatal SRI exposure.
There are numerous other factors that possibly
influence neonatal health in this setting including
other transporter regularity related genes, variable
number of tandem repeats,39 drug-related metabolism
(that is, genotype for CYP450 isoenzymes40), differences in pharmacological properties of the medications themselves41 and other transporter molecules.42
Molecular Psychiatry
This study’s sample size was small and further
studies are needed to confirm our findings, explore
the role of concurrent pharmacological factors and
further our understanding of the long-term consequences of reduced 5 min Apgar scores and PNA
symptoms in exposed neonates.
These findings may help elucidate a component of
the mechanisms that underlie PNA and may reflect
increased or selective teratogenicity, following prenatal SRI exposure. In turn, these factors contribute
to the development of empiric, evidence-based approaches for SRI treatment of persistent maternal
mental illness during pregnancy. Pregnancy is a time
of highest vulnerability in the reproductive period in
a woman’s life for developing complex mental illness
and in women with moderate to severe symptoms,
pharmacologic treatment may be warranted for stability of maternal mood as depressed mood have
predictable long-term consequences for mothers and
their children.13,43 Further study is needed to identify
the right ‘fit’ between a pharmacological agent and
maternal and neonatal genetic factors, which together
contribute to successful management of maternal
mental illness while minimizing adverse neonatal
outcomes.
Acknowledgments
This research was funded by March of Dimes
Foundation (USA) (No. 12-FY01-30), the Canadian
Institutes of Health Research (CIHR No. MOP 54490
and 57837) and HELP, UBC (Human Early Learning
Partnership). TFO is supported by a HELP, Senior
Career Award and has the R Howard Webster
Professorship in Child Development (UBC, Faculty
of Graduate Studies). CJDR is supported by CIHR and
Michael Smith Foundation for Health Research
Fellowships. This work was also supported by a
grant from the CIHR and Canada Research Chair in
Genetics and Behaviour to EMS. We are grateful to the
mothers and their infants who participated and
contributed to this work, as well as to Colleen
Fitzgerald and Ursula Brain for their contributions
organizing and facilitating this research program. We
also gratefully acknowledge the thoughtful comments
provided by Ursula Brain and Tracey Weir and the
manuscript reviewers from Molecular Psychiatry.
References
1 Moses-Kolko EL, Bogen D, Perel J, Bregar A, Uhl K, Levin B et al.
Neonatal signs after late in utero exposure to serotonin reuptake
inhibitors: literature review and implications for clinical applications. JAMA 2005; 18, 293 2372–2383.
2 Casper RC, Fleisher BE, Lee-Ancajas JC, Gilles A, Gaylor E,
DeBattista A et al. Follow-up of children of depressed mothers
exposed or not exposed to antidepressant drugs during pregnancy.
J Pediatr 2003; 142: 402–408.
3 Chambers CD, Johnson KA, Dick LM, Felix RJ, Jones KL. Birth
outcomes in pregnant women taking fluoxetine. N Engl J Med
1996; 335: 1010–1015.
Serotonin reuptake inhibitor
TF Oberlander et al
4 Costei AM, Ho T, Kozer E, Ito S, Koren G. Perinatal outcome
following third trimester exposure to paroxetine. Pediatric
Research 2002; 51: 66A.
5 Malm H, Klaukka T, Neuvonen PJ. Risks associated with selective
serotonin reuptake inhibitors in pregnancy. Obstet Gynecol 2005;
106: 1289–1296.
6 US Food Drug Administration. FDA Medwatch Drug Alert on
Effexor (venlafaxine HCI) and Effexor XR (venlafaxine HCI). 2004
Jun 3. www.fda.gov/medwatch/safety/2004/safety04.htm#effexor
(Accessed 26 January 2007).
7 Health Canada. Health Canada advises of potential adverse effects of
SSRIs and other anti-depressants on newborns. 2004 Jul 9. http://
www.hc-sc.gc.ca/english/protection/warnings/2004/2004_44.htm
(Accessed 26 January 2007).
8 Bonari L, Pinto N, Ahn E, Einarson A, Steiner M, Koren G.
Perinatal risks of untreated depression during pregnancy. Can
J Psychiatry 2004; 49: 726–735.
9 Oberlander TF, Warburton W, Misri S, Aghajanian J, Hertzman C.
Neonatal outcomes after prenatal exposure to selective serotonin
reuptake inhibitor antidepressants and maternal depression using
population-based linked health data. Arch Gen Psychiatry 2006;
63: 898–906.
10 Laine K, Heikkinen T, Ekblad U, Kero P. Effects of exposure to
selective serotonin reuptake inhibitors during pregnancy on
serotonergic symptoms in newborns and cord blood monoamine
and prolactin concentrations. Arch Gen Psychiatry 2003; 60:
720–726.
11 Oberlander TF, Misri S, Fitzgerald CE, Kostaras X, Rurak D, Riggs
W. Pharmacologic factors associated with transient neonatal
symptoms following prenatal psychotropic medication exposure.
J Clin Psychiatry 2004; 65: 230–237.
12 Maciag D, Simpson KL, Coppinger D, Lu Y, Wang Y, Lin RC et al.
Neonatal antidepressant exposure has lasting effects on behavior and
serotonin circuitry. Neuropsychopharmacology 2006; 31: 47–57.
13 Weissman MM, Wickramaratne P, Nomura Y, Warner V, Pilowsky
D, Verdeli H. Offspring of depressed parents: 20 years later.
Am J Psychiatry 2006; 163: 1001–1008.
14 Pollock BG, Ferrell RE, Mulsant BH, Mazumdar S, Miller M, Sweet
RA et al. Allelic variation, in the serotonin transporter promoter
affects onset of paroxetine treatment response in late-life depression. Neuropsychopharmacology 2000; 23: 587–590.
15 Kim DK, Lim SW, Lee S, Sohn SE, Kim S, Hahn CG et al. Serotonin
transporter gene polymorphism and antidepressant response.
Neuroreport 2001; 11: 215–219.
16 Online mendelian inheritance in man (OMIM). http://
www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id = 182138.
2006.
Available at URL: http://www.ncbi.nlm.nih.gov/entrez/dispomim.
cgi?id = 182138 (Accessed 26 January 2007).
17 Ramamoorthy S, Bauman AL, Moore KR, Han H, Yang-Feng T,
Chang AS et al. Antidepressant- and cocaine-sensitive human
serotonin transporter: molecular cloning, expression, and
chromosomal localization. Proc Natl Acad Sci USA 1993; 90:
2542–2546.
18 Lesch KP, Wolozin BL, Estler HC, Murphy DL, Riederer P. Isolation
of a cDNA-encoding the human brain-serotonin transporter.
J Neural Transm-Gen Sect 1993; 91: 67–72.
19 Lesch KP, Bengel D, Heils A, Sabol SZ, Greenberg BD, Petri S et al.
Association of anxiety-related traits with a polymorphism in the
serotonin transporter gene regulatory region. Science 1996; 274:
1527–1531.
20 Heils A, Teufel A, Petri S, Stober G, Riederer P, Bengel D et al.
Allelic variation of human serotonin transporter gene expression.
J Neurochem 1996; 66: 2621–2624.
21 Lesch KP, Mossner R. Genetically driven variation in serotonin
uptake: is there a link to affective spectrum, neurodevelop
mental, and neurodegenerative disorders? Biol Psychiatry 1998; 44:
179–192.
22 Collier DA, Stober G, Li T, Heils A, Catalano M, Di Bella D et al.
A novel functional polymorphism within the promoter of the
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
serotonin transporter gene: possible role in susceptibility to
affective disorders. Mol Psychiatry 1996; 1: 453–460.
Yu YW, Tsai SJ, Chen TJ, Lin CH, Hong CJ. Association study of the
serotonin transporter promoter polymorphism and symptomatology and antidepressant response in major depressive disorders.
Mol Psychiatry 2002; 7: 1115–1119.
Murphy Jr GM, Hollander SB, Rodrigues HE, Kremer C, Schatzberg
AF. Effects of the serotonin transporter gene promoter polymorphism on mirtazapine and paroxetine efficacy and adverse
events in geriatric major depression. Arch Gen Psychiatry 2004;
61: 1163–1169.
Rausch JL, Johnson ME, Fei YJ, Li JQ, Shendarkar N, Hobby HM et
al. Initial conditions of serotonin transporter kinetics and
genotype: influence on SSRI treatment trial outcome. Biol
Psychiatry 2002; 51: 723–732.
Smeraldi E, Zanardi R, Benedetti F, Di BD, Perez J, Catalano M.
Polymorphism within the promoter of the serotonin transporter
gene and antidepressant efficacy of fluvoxamine. Mol Psychiatry
1998; 3: 508–511.
Hamilton M. A rating scale for depression. J Neurol Neurosurg
Psychiatry 1960; 23: 56–62.
Hamilton M. The assessment of anxiety states by rating. Br J Med
Psychol 1959; 32: 50–55.
Cox JL, Holden JM, Sagovsky R. Detection of postnatal depression.
Development of the 10-item Edinburgh Postnatal Depression
Scale. Br J Psychiatry 1987; 150: 782–786.
Gentile S. SSRIs in pregnancy and lactation: emphasis on
neurodevelopmental outcome. CNS Drugs 2005; 19: 623–633.
Kim J, Riggs KW, Misri S, Kent N, Oberlander TF, Grunau RE et al.
Stereoselective disposition of fluoxetine and norfluoxetine during
pregnancy and breast-feeding. Br J Clin Pharmacol 2006; 61:
155–163.
Lane R, Baldwin D. Selective serotonin reuptake inhibitor-induced
serotonin syndrome: review. J Clin Psychopharmacol 1997; 17:
208–221.
Boyer EW, Shannon M. The serotonin syndrome. N Engl J Medi
2005; 352: 1112–1120.
Haddad PM. Antidepressant discontinuation syndromes. Drug Saf
2001; 24: 183–197.
Lejoyeux M, Ades J. Antidepressant discontinuation: a review of
the literature. J Clin Psychiatry 1997; 58(Suppl 7): 11–15.
Nordeng H, Lindemann R, Perminov KV, Reikvam A. Neonatal
withdrawal syndrome after in utero exposure to selective
serotonin reuptake inhibitors. Acta Paediatr 2001; 90: 288–291.
Isbister GK, Dawson A, Whyte IM, Prior FH, Clancy C, Smith AJ.
Neonatal paroxetine withdrawal syndrome or actually serotonin
syndrome? Arch Dis Child 2001; 85: F147–F148.
Schatzberg AF, Haddad P, Kaplan EM, Lejoyeux M, Rosenbaum JF,
Young AH et al. Possible biological mechanisms of the serotonin
reuptake inhibitor discontinuation syndrome. Discontinuation
consensus panel. J Clin Psychiatry 1997; 58(Suppl 7): 23–27.
Lesch KP, Balling U, Gross J, Strauss K, Wolozin BL, Murphy DL
et al. Organization of the human serotonin transporter gene.
J Neural Transm-Gen Sect 1994; 95: 157–162.
Grasmader K, Verwohlt PL, Rietschel M, Dragicevic A, Muller M,
Hiemke C et al. Impact of polymorphisms of cytochrome-P450
isoenzymes 2C9, 2C19 and 2D6 on plasma concentrations and
clinical effects of antidepressants in a naturalistic clinical setting.
Eur J Clin Pharmacol 2004; 60: 329–336.
Stahl SM. Mechanism of action of serotonin selective reuptake
inhibitors. Serotonin receptors and pathways mediate therapeutic
effects and side effects. J Affect Disord 1998; 51: 215–235.
Iversen L. Neurotransmitter transporters and their impact on the
development of psychopharmacology. Br J Pharmacol 2006;
147(Suppl 1): S82–S88.
Cohen LS, Altshuler LL, Harlow BL, Nonacs R, Newport DJ,
Viguera AC et al. Relapse of major depression during pregnancy in
women who maintain or discontinue antidepressant treatment.
JAMA 2006; 295: 499–507.
73
Molecular Psychiatry