Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
AMER. ZOOL., 38:528-544 (1998) From Molecules to Mating Success: Integrative Biology of Muscle Maturation in a Dragonfly1 JAMES H. MARDEN, 2 GAIL H. FITZHUGH, AND MELISANDE R. W O L F Department of Biology, 208 Mueller Laboratory, The Pennsylvania State University, University Park, Pennsylvania 16802 Dragonflies begin adult life as comparatively weak fliers, then mature to become one of nature's ultimate flying machines. This ontogenetic transition provides an opportunity to investigate the relationship between life history, phenotypic plasticity, and changing ecological demands on organismal performance. Here we present an overview of a wide-ranging study of dragonfly muscle maturation that reveals i) ecological changes in the need for efficient versus high-performance flight, ii) organism-level changes in performance, thermal physiology, locomotor mechanics, and energy efficiency, iii) tissue-level changes in muscle ultrastructure and sensitivity to activation by calcium, and iv) molecular-level changes in the Lsoform composition of a calcium regulatory protein in flight muscle (troponin-T). We discuss how these phenomena may be causally related, and thereby begin to show linkages across many levels of biological organization. In particular, we suggest that alternative splicing of troponin-T mRNA is an important component of the "gearing" of muscle contractile function for developmental changes in wingbeat frequency and ecological demands on flight performance. Age-variable gearing of muscle function allows energetically economical flight during early adult growth, whereas power output is maximized at maturity when aerial competition determines success during territoriality and mating. SYNOPSIS. INTRODUCTION " . . . the ideal, but only infrequently practical, solution would be to take the analysis of phenomena all the way from the ecosystem to the molecule." G. A. Bartholomew, 1987 " . . . the ultimate goals of 'molecular biology' are clearly to explain the consequences of lower-level variation for higher-level (i.e. organismal) function. Accordingly, 'molecular biology' and at least the mechanistic aspects of physiological ecology ought to resonate strongly with one another. Currently, they seldom do, more for cultural than for scientific reasons." M. E. Feder & B. A. Block, 1991 The first entire sequence of a eukaryotic genome was recently completed (Goffeau et 1 From the Symposium Responses of Terrestrial Arthropods to Variation in the Thermal and Hydric Environment: Molecular, Organismal, and Evolutionary Approaches presented at the Annual Meeting of the Society for Integrative and Comparative Biology, 2630 December 1996, at Albuquerque, New Mexico. 2 E-mail: [email protected] ah, 1996), thus attaining one of the "holy grails" of reductionist biology. To herald this event, a celebratory tone might have been expected, however the authors tersely reported that much of the work "was carried out in large sequencing centers by highly specialized scientists and technicians who may never have seen a yeast outside of a bottle of doubly fermented beer." Molecular biology has thus converged upon a chronic concern of organismal biology, the realization that our discipline has in part been delegated to "technicians" who may have little knowledge or appreciation of socalled "real biology." Molecular biologists are reawakening to the need to relate data across all levels of biological organization, to the extent that efforts to understand "living organisms as a whole" are now being hailed as biology's next frontier (Weissenbach, 1996). Known relationships between molecular level variation and whole organism physiology and ecology are scattered widely across the biological sciences (e.g., Hochachka and Somero, 1984; Hochachka and Mommsen, 1995; Bijlsma and Loeschcke, 528 DRAGONFLY MUSCLE MATURATION 1997). Muscle function is an especially fertile area for such integrative studies {e.g., Block, 1994; Hochachka, 1994, Powers and Schulte, 1996), as muscle cells are well characterized, and muscle function is both readily assayed and important for various aspects of organismal performance. Following in this tradition, we have for the past five years been studying muscle contractile function and organismal performance of dragonflies, with the ultimate goal of understanding a free-living organism "as a whole." Although this project is far from complete, an overview at this time will help to crystallize the connections between studies that are presented in a more piece-meal fashion in the primary literature. Our presentation of this material begins at the ecological and organismal levels, then proceeds to explore candidates for underlying cellular and molecular mechanisms. 529 changes in the amount and vigor of flight, as relatively sedentary, weak-flying tenerals transform into extremely active and aerobatic mature adults. Thus, we sought to determine how muscle contractile physiology changes with age, and how these changes affect the mechanics and ecology of flight. We anticipated that these findings might have broad significance because striated muscle is a nearly ubiquitous tissue in animals, most of whom undergo ontogenetic changes in size, locomotion, behavior, and ecology. ECOLOGICAL DEMANDS ON TENERAL VERSUS MATURE LIBELLULID DRAGONFLIES Libellulid dragonflies forage by visually scanning the airspace surrounding elevated perches. They make brief flights to capture tiny prey that average <0.1 mg dry mass and are easy to catch (success rate of predation flights = 65-93% depending on conLIFE HISTORY OF ADULT DRAGONFLIES ditions and sampling methods; Baird, Life history of dragonflies follows the 1991). Because they feed on easily caught ancestral pattern for insects, progressing prey that yield a low energetic return, and from eggs to sexually mature adults via a flight is an extraordinarily expensive form series of imaginal moults; there is no qui- of locomotion, survival and growth rate escent pupal stage. The final moult, which may be highest for teneral Libellulid dragrequires about 1 hour, transforms an aquatic onflies that minimize energy expenditures, nymph into a flying adult (see photos in and maximize their flight efficiency. Marden, 1995). We are presently performing mark-recapAfter inflation and hardening of the ture field studies aimed at determining wings, the "teneral" adult is ready to fly. growth rates of teneral Libellulid dragonDuring its first 5-10 days, the teneral feeds flies. During the summer of 1996, we capon flying insects while its cuticle continues tured, weighed, marked, and released 182 to harden and develop mature pigmentation. Libellula lydia (syn. Plathemis lydia) tenerUpon maturation, behavior changes mark- als, then revisited the same field sites on edly, as dragonflies periodically forsake for- subsequent days. We recaptured 22 individaging and return to ponds where they en- uals, of whom 11 had lost body mass and gage in territoriality and mating (Fried and 11 had gained body mass (Fig. 2; Rowan and Marden, in preparation). Three of the May, 1983). Maturational changes that affect the ex- "gainers" were recaptured on a third day, ternal appearance of dragonflies are com- and each had again gained body mass. mon knowledge, however little research has Three other "gainers" had attained a maexamined maturational variation of internal ture body mass by the time of their initial physiological traits. Our interest in matur- recapture (>400 mg; note that the Pennsylational physiology of Libellulid dragonflies vania population of L. lydia is somewhat was stimulated by the simple observation smaller than the more northerly population that these insects approximately double in whose body masses are shown in Fig. 1). body mass during adult maturation (Fig. 1), None of the "losers" were recaptured a with changes in the size, color, and ultra- third time, and no losers attained mature structure of their flight musculature (Mar- body mass. We have now replicated this exden, 1989). Concurrently, there are striking periment with a larger sample of L. pul- 530 J. H. MARDEN ETAL. Males Females ovipositing * Thorax Abdomen Head Wings Legs 200 300 400 500 200 300 Body mass (mg) 400 r 500 T 600 FIG. 1. Distribution of body mass among body regions during adult maturation in L. lydia dragonflies, as inferred from cumulative data for 138 males and 33 females, each sampled destructively at one body mass (Marden, 1989). The majority of growth in males occurs in the thorax (flight muscle), whereas most female mass increase consists of maturing ovaries in the abdomen. SCOO) Losers N=11 Gainers N=11 s 200- fev 0 4 Time (days) 12 FIG. 2. Changes in body mass over time for marked and recaptured L. lydia tenerals in the field during the summer of 1996. chella during the summer of 1997; losers outnumber gainers, and a sample of losers measured for fat content show starvationlevel energy reserves (mean = 1.6% body fat) that are much lower than the fat reserves of newly emerged L. pulchella (mean = 4% body fat; Anholt et al, 1991). These data show that teneral Libellulid dragonflies are frequently on a negative energy budget, from which they apparently do not often recover. Traits that influence energy efficiency are therefore likely to be important for determining gainers versus losers, and thus under strong natural selection. Mature Libellulid dragonflies appear to have a much greater need for high performance flight than do tenerals. Mature males use highly escalated aerial contests to es- 531 DRAGONFLY MUSCLE MATURATION • • O o mature, high exertion mature, routine flight teneral I 45- eratu D 40- Q. • E acic te tablish and defend mating territories (Pezalla, 1979). Mating involves high-speed chases of females by one or more territorial males. The male that succeeds in grasping and copulating with a female then releases her within his territory and hovers above her while she oviposits. Other males frequently intrude (they disrupted 53% of ovipositions in a study of L. lydia; Marden, 1989), attempting to rush in and grasp, copulate with, and abduct ovipositing females to their own territories. The male guarding an ovipositing female responds with darting flights to block onrushing males. Females are not passive participants in mating; they frequently use high-performance flight maneuvers to evade males attempting to copulate or disrupt oviposition. Our subjective impression that extraordinary flight effort occurs during territoriality and mating is corroborated by field studies of thermoregulation in L. pulchella (Marden et al., 1996). Thoracic temperatures recorded from mature males engaged in aerial copulation, mate guarding, or escalated territorial contests were compared against concurrently sampled individuals engaged in routine patrolling flight. Males engaged in high-exertion behaviors showed an average 1.3°C increase in Tth, with a Tth as high as 45°C recorded from a male engaged in an escalated territorial contest. These high-exertion behaviors are brief and do not expose dragonflies to a different ambient temperature or light regime; increased Tlh must therefore be caused by an increase in metabolic heat production, the byproduct of intense effort. In a previous study of male mating success in L. lydia (Marden, 1989), males with the highest ratio of flight muscle mass to total body mass had the highest relative mating success among groups of competing males. A subset of males carrying small, experimentally applied weight loads (613% of unladen mass) had poor territorial and mating success when they were competing against unweighted males. These results demonstrate that flight performance is a key aspect of reproductive success for mature Libellulid dragonflies. o H o 35- o O o ^ ^ ^ ^ ° ^ o o o ^ * 30- o 15 20 25 30 35 Ambient temperature fC) FIG. 3. Thoracic temperature of mature and teneral (newly emerged) L. pulchella dragonflies captured during activity in the field. Statistics and detailed methods are presented in Marden et ai, 1996. THERMOREGULATION AND ACTIVITY IN THE FIELD Mature L. pulchella dragonflies flying in nature tightly regulate high thoracic temperatures (Tth = 38 to 45°C; Fig. 3). In contrast, tenerals show weak regulation of relatively cool Tths (29 to 40°C). Maturational differences in body temperature are a result of both physiological and behavioral factors. Tenerals attain a lower equilibrium Tth during basking, and they cool more rapidly (Marden et al., 1996). Tenerals are much less active, spending an average of only 2% of their time flying (SD = 2), with flight durations averaging only 3 sec (SD = 1). Territorial matures are much more active, spending an average of 32% of the time flying (SD = 33.5), with an average flight duration of 82 sec (SD = 1 5 5 ; Marden et al., 1996). This increase in the frequency and duration of flights raises the rate of endogenous heat production within the flight muscles of matures, which undoubtedly contributes to their higher thoracic temperatures. WHOLE ORGANISM LOCOMOTOR PERFORMANCE To quantify flight capacity at known thoracic temperatures, dragonflies can be at- 532 J. H. MARDEN ET AL. 60- Teneral scl CD 40- 3 E 200Z^ ton CO 80- Mature 60- rtic CO 40- CO 200 20 30 40 50 Thoracic temperature (°C) FIG. 4. Traces outlining the upper limit of vertical force production as a function of thoracic temperature for 12 teneral and 12 mature L. pulchella dragonflies. These curves are based on an average of 223 flight attempts per individual (Marden, 1995). tached to the horizontal stylus of a force transducer and stimulated to attempt to fly (Marden, 1995). By measuring the mean vertical force produced during hundreds of flight attempts over a broad range of thoracic temperatures, it is possible to obtain a thermal sensitivity curve (Huey and Stevenson, 1979) for maximal flight performance. Maximal lift forces obtained using this method agree closely with maximal lift forces generated in free-flight by dragonflies carrying experimentally applied loads (Marden, 1987), thus indicating that short bursts of tethered flight in dragonflies are a reasonable approximation of free flight. Results of these experiments reveal that L. pulchella dragonflies undergo a striking change in maximal flight performance and thermal sensitivity of performance during adult maturation (Fig. 4). Tenerals show a broad plateau of near-peak performance (ca. 40 N vertical force per kg flight muscle), first attained at cool thoracic temperatures (typically 28-34°C) and maintained up to thoracic temperatures of 40-45°C (mean optimal thoracic temperature [OTT] = 34.6°C). In contrast, fully mature adults show narrow thermal sensitivity curves, wherein peak performance (ca. 60 N vertical force per kg flight muscle) is approached only within a few degrees of the thermal optimum, which invariably occurs at hot thoracic temperatures (38-50°C; mean OTT = 43.5°C). Comparing these thermal optima to thoracic temperatures regulated in the field (Fig. 3), reveals a tight correspondence between the thoracic temperatures that are best for flight and the temperatures that each age group experiences in nature. Adult emergence in L. pulchella occurs over a period of about 2 months (June and July in northeastern U.S.), during which mature adults are present at nearly all times. Thus, teneral and mature adults are not separated seasonally, and there is no evidence to suggest that maturational changes in thermal physiology result from acclimation to seasonal changes in the thermal environment (Marden, 1995). Thus, it appears that L. pulchella dragonflies undergo a genetically triggered change in locomotor physiology, which results in a 1.5-fold increase in peak performance and a 9°C increase in optimal body temperature, in the absence of directional change in the external thermal environment. In order to generate 50% more muscle mass-specific lift, mature dragonflies must be doing something different with their wings. In order to examine maturational changes in wing kinematics, we have begun experiments that use a laser distance sensor (LDS 80, DynaVision, Vancouver; 1 kHz sampling) to continuously monitor wing position during tethered flight attempts. Matures achieve dramatically higher wing velocities and wingbeat amplitudes than do tenerals (Fig. 5), and they operate at a much higher frequency (ca. 37 Hz in matures versus a variable pattern of either 19 or 27 Hz in tenerals). ENERGY EFFICIENCY Increasing the contraction frequency of a set of antagonistic muscles has important effects on work input and output. In the absence of compensatory changes in the kinetics of muscle activation and/or deactivation, cycling at a higher frequency can 533 DRAGONFLY MUSCLE MATURATION 1 20 40 60 Wing position (degrees) FIG. 5. Wing angular velocity as a function of wing position (angle in relation to a 0-degree horizontal) during a continuous series of 10 wingbeats from a mature and teneral L. pulchella dragonfly, each using single neural stimuli at T,,, of 30°C. This pattern is highly replicable both within and among individuals, as matures consistently have higher wing velocity and stroke amplitude than tenerals. This pattern changes when tenerals use compound neural stimuli (Fig. 9). result in incomplete relaxation of the muscle during the start of the lengthening phase (i.e., the muscle is being stretched while the cross-bridges are active and generating forces that oppose stretching). Thus, as wingbeat frequency increases, an increasing "U*^fen • o 2 0.06- Efficier • • • 0.08- •-Mat 0.04- • 0.02o 1 0.030.02« 0.01- 1 0- 11 -0.01-0.02- o i proportion of the work performed by downstroke muscles must be expended to stretch the upstroke muscles, and vice versa (Josephson, 1981). For muscles that do not vary greatly in total twitch duration, this "wasted work" (inefficiency) must increase with increasing wingbeat frequency. Accordingly, we can predict that the higher wingbeat frequencies used by mature L. pulchella dragonflies should be less energyefficient than the motor pattern used by tenerals. We have begun experiments that test this prediction. By measuring vertical force production by tethered dragonflies in an openflow respirometry system (Sable Systems), we are able to determine the energetic cost of induced power output (the useful component of aerodynamic power). Induced power output can be estimated from lift data (Marden, 1990; Ellington, 1991; Lehmann and Dickinson, 1997), then divided by metabolic power input to yield an estimate of efficiency (note that this is not a complete measure of efficiency because it neglects the component of power output required to overcome aerodynamic drag on the wings). Results of this experiment (Fig. 6) show that relative lift, temperature, and age (teneral versus mature) all have signif- i i i i r 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Relative Lift (N/N body weight) -0.03- 24 T T T 28 32 36 Temperature (°C) 40 FIG. 6. Flight efficiency, computed as induced power output (W; calculated using lift data and a modified actuator disk model [Ellington, 1991] for dragonflies with an average wingbeat amplitude of 50 degrees) divided by metabolic power input (W; using CO2 emission data and a measured RQ of 1.0) as a function of relative lift and thoracic temperature. The vertical axis of the plot on the right uses residuals from regression lines shown in the plot on the left. Error bars show ± 1 SD. Data are from 4 matures and 4 tenerals. A split plot ANOVA model that accounts for random differences among individuals shows that age (teneral vs. mature; P < 0.03), temperature (P < 0.001), and relative lift (P < 0.0004) each have significant effects on efficiency. 534 J. H. MARDEN ETAL. icant effects on the efficiency of induced power output. In particular, it is interesting to note that tenerals have higher efficiency at the thoracic temperatures that they typically maintain in nature (28-36°C), whereas matures have relatively low efficiency at their typical field thoracic temperatures (>36°C). CELLULAR MECHANISMS FOR MATURATIONAL CHANGE IN LOCOMOTOR PERFORMANCE As shown above, mature L. pulchella dragonflies achieve dramatically higher wing velocities and wingbeat amplitudes than do tenerals (Fig. 5). Much of this difference can be explained by the simple mechanical effect of larger mature muscles working to beat wings that are nearly constant across age in their length and mass. Thus, mature flight muscles are contracting against relatively small inertial loads compared to tenerals {i.e., a different place on their force-velocity curve). This purely mechanical factor could, by itself, cause the increased wingbeat amplitude and velocity of matures. However, striated muscle is a remarkably malleable tissue, and therefore we wondered if maturational changes in short-burst tethered flight performance and wingbeat kinematics might also be due in part to changes in the contractile proteins of the flight muscles. Thus, we set out to examine two fundamentally different aspects of muscle contractile physiology: 1) actin-myosin cross-bridge kinetics, as evidenced by shortening velocity and tetanic tension of intact muscle, and 2) contractile regulation by thin filament proteins, as evidenced by calcium sensitivity of skinned muscle fibers. Shortening velocity, tetanic tension, and instantaneous power output were measured from in situ preparations of individual mechanically isolated L. pulchella flight muscles (Fitzhugh and Marden, 1997). In these experiments the muscle was stimulated with a prolonged series of high-frequency electrical pulses, thus preventing resequestration of intracellular calcium by the sarcoplasmic reticulum. This experiment provides a measure of cross-bridge cycling activity (ATP-dependent actin-myosin in- teractions) that is largely free from effects of calcium transients. Maximum shortening velocity, tetanic tension, and instantaneous power output during isotonic contraction did not vary as a function of age, temperature, or age-temperature interaction (Fitzhugh and Marden, 1997), which demonstrates that there are no significant age-related changes in cross-bridge kinetics. In a living dragonfly, flight muscles are activated and deactivated in a rapid cyclical manner by single neural impulses {i.e., twitch contractions). Thus, even though cross-bridge cycling kinetics are age-invariant, any changes in the signalling pathway between nerves and cross-bridges could affect muscle and organismal performance. Indeed, skinned fibers (demembranated muscle in which the sarcoplasmic reticulum [SR] is removed, thereby permitting direct experimental control of the Ca2+ concentration in fluid surrounding the otherwise intact contractile filaments) of mature L. pulchella flight muscle are up to thirteen times more sensitive to activation by calcium than skinned fibers from teneral muscle, and their calcium sensitivity is more strongly affected by temperature (Fig. 7; Fitzhugh and Marden, 1997). Maturational changes in calcium sensitivity of muscle activation should affect in vivo muscle performance in the following manner. Mechanics of twitch contractions depend on the time course of intracellular changes in Ca2+ concentration and how the muscle responds to those changes. Resting muscle has a very low Ca2+ concentration (10~8 M), which changes rapidly when a single neural impulse causes calcium release from the SR, thereby creating a wave of Ca2+ that spreads rapidly through the myoplasm, reaching peak concentrations of ~10 4 M. Resequestration of Ca2+ by soluble Ca2+-binding proteins and by active transport pumps in the membrane of the SR causes a rapid return of intracellular free Ca2+ to resting levels. The rise and fall of intracellular Ca2+ during a twitch occurs over a time scale of a few milliseconds (Tsugorka et al., 1995; Rome et al., 1996). Because transitions in intracellular Ca2+ concentration during a twitch are not instantaneous and do not saturate binding DRAGONFLY MUSCLE MATURATION 100-1 g 80- I 60E Teneral 3 § 4020- 0.01 0.1 1 10 100 Calcium concentration (uM) Mature O a. 5H I 15 Teneral I 20 I I I 25 30 35 Temperature (°C) I 40 FIG. 7. Calcium sensitivity of L. pulchella skinned fibers. Upper plot shows means (±1 SD) for relative tension of fibers from 6 matures and 6 tenerals at 35°C. Lower plot shows thermal sensitivity of muscle activation, as revealed by a plot of pCa50 (negative log of the calcium concentration producing half maximal tension) versus temperature for a total of 6 tenerals and 7 matures. Detailed methods and statistical analyses are given in Fitzhugh and Marden, 1997. 535 muscles (Fig. 8; Fitzhugh and Marden, 1997). Mature muscles reach peak tension more rapidly, relax more slowly, and generate greater tension. The high Ca2+ sensitivity of mature muscle at temperatures above 35°C (Fig. 7) results in twitch tension reaching ca. 90% of tetanic tension (Fig. 8), i.e., nearly the full tension-production capacity of the muscle. Neural activation of the flight muscles also changes during maturation, in a fashion that accommodates changes in mechanical loading and calcium sensitivity of muscle activation. Simultaneous recordings of muscle extracellular electrical potentials (EMGs) and wing position show that mature L. pulchella dragonflies achieve a large wing stroke amplitude (a 50—60° arc) as a result of single neural stimuli (Fig. 9). In contrast, tenerals achieve only about half of the mature wing stroke amplitude when using single neural stimuli, but they frequently switch to multiple stimuli in order to achieve a stroke amplitude similar to matures (Fig. 9). Thus, tenerals have a "two-gear" motor that can produce either shallow-amplitude wingbeats of intermediate frequency (ca. 27 Hz), or large-amplitude, slow (ca. 19 Hz) wingbeats. Matures have a one-gear motor, operating only at a high frequency (ca. 37 Hz; note however that matures can adjust wingbeat amplitude by varying the recruitment of motor units within their muscles; they are a one-gear motor only in terms of frequency). These differences in the way wing position responds to muscle activity are presumably caused by the combined effects of maturational change in muscle loading and calcium sensitivity of muscle activation. sites on troponin C (Cannell and Allen, 1984), changes in Ca2+ sensitivity of muscle activation and deactivation will necessarily bring about changes in the time course and magnitude of twitch tension. Thus, we predicted that the increased Ca2+ sensitivity of mature muscle would result in MOLECULAR MECHANISMS FOR more rapid force generation in response to MATURATIONAL CHANGES IN CALCIUM a Ca2+ transient, more delayed relaxation, SENSITIVITY OF MUSCLE ACTIVATION and greater twitch tension because the muscle is activated for a greater amount of time The dramatic maturational change in cal(readers can visualize these effects by trac- cium sensitivity of muscle activation in L. ing the changes in % maximal tension of pulchella flight muscle led us to examine different aged fibers as Ca2+ concentration the isoform composition of calcium regurises and falls along the horizontal axis of latory proteins. One-dimensional SDSthe upper plot in Fig. 7). These predictions PAGE gels of contractile proteins, and were confirmed by measurements of twitch Western blots of troponins (Fig. 10; Fitzcontraction kinetics for individual flight hugh and Marden, 1997) reveal a matura- 536 J. H. M A R D E N ETAL. 1 40|35£ 30^25 |20J 2 15E 10\ r i 15 20 25 i i i i 30 35 40 45 50 15 20 Temperature (°C) 10 8 E o 25 30 35 40 45 50 Temperature (°C) 18°C 30°C Mature Teneral 38°C Mature Teneral Mature Teneral 6- CD % 4 20- r 40 80 I 0 ' I • 40 Time (ms) I 80 FIG. 8. Twitch contraction kinetics of L. pulchella flight muscle, as characterized by the time to peak tension (TTP) and time to half-relaxation (THR). Graphs show means (±1 SD) for 5 tenerals and 7 matures. Lower plots show the time course of isometric tension during representative twitches. Age and temperature are statistically significant factors (P < 0.02 in all cases) affecting variation in TTP, THR, and twitch tension (Fitzhugh and Marden, 1997). tional change in the isoform composition of troponin-t. Other troponins show no apparent maturational change in motility on our 1-D gels, which suggests that they are probably age-invariant (1-D gels have consistently detected isoform shifts in troponins C and I in previous studies; Martin et al, 1991; Reiser et al, 1992; Sasse et al, 1993). The change in isoform expression of troponin-t (TnT) provides a strong candidate for the mechanism underlying the dramatic change in calcium sensitivity of muscle activation between teneral and mature L. pul- chella dragonflies. Previous studies of avian and mammalian striated muscle have shown that changes in calcium sensitivity are tightly correlated with changes in TnT isoform expression (Akella et al., 1995; McAuliffe et al, 1990; Nassar et al, 1991; Potter et al, 1995; Reiser et al, 1992; Schachat et al, 1987; Schaertl et al, 1995; Tobacman and Lee, 1987). Experimental manipulation of TnT isoform composition in fibers or actomyosin solutions have confirmed that TnT isoform shifts cause changes in calcium sensitivity of muscle activation (Tobacman, 1988; Wu et al, 1995). DRAGONFLY MUSCLE MATURATION 537 EMG Wing Position 50° Teneral EMG Wing Position 0.1s FIG. 9. Simultaneous recordings of EMG activity in a downstroke muscle and wing position (monitored at 1 kHz with a laser distance sensor). Matures employ highly regular trains of single neural stimuli, whereas tenerals frequently shift between multiple stimuli (first three wingbeats shown here) and single stimuli. Both traces were GENETIC BASES FOR TROPONIN-T ISOFORM DIVERSITY Changes in isoform expression of muscle proteins are known to occur by either of two mechanisms; differential expression of separate genes (i.e., multi-gene families, for example, myosin heavy chains; Bandman, 1992) or alternative splicing of a single gene (Andreadis et al., 1987). The latter mechanism, alternative splicing, is responsible for isoform diversity in TnT. Mammals can potentially produce 64 TnT isoforms from a single gene (Breitbart et al., 1985), and birds can potentially produce 128 (Smillie et al., 1988), making TnT the most variable product of a single gene outside of the immune system. Despite this intriguing molecular diversity, the organismlevel significance of alternative splicing of TnT has not previously been examined (Nadal-Ginard et al., 1991; Malhotra, 1994). To determine the molecular mechanisms responsible for TnT isoform shifts in dragonflies, we isolated mRNA from L. pulchella flight muscle and constructed a mixed-age cDNA library. We then screened 538 ISO J. H. MARDEN ETAL. have not yet performed the analyses required to determine age-specific expression patterns of these splice variants, but from our protein gels (Fig. 10) and previous studies of vertebrate TnT splicing (Jin and Lin 1989; Jin et al, 1992.), we can predict that L. pulchella tenerals express TnT isoforms containing the alternative exons (i.e., the larger apparent molecular weights on the gel), whereas matures express TnT in which the alternative exons are absent. FUNCTIONAL ATTRIBUTES OF TNT SPLICE VARIANTS Activation of striated muscle occurs when calcium binds with troponin-C, which in turn causes a conformational change in the shape and/or position of troponin-I and tropomyosin, thereby allowing the myosin Tropoain-C head to bind to the actin filament and initiate a cross-bridge cycle (Tobacman, 1996). TnT serves to anchor troponins C and I to tropomyosin, and also plays an important functional role by affecting the molecular cooperativity of calcium activation. Binding of calcium to a troponin-C molecule can trigger an activated state in 5-6 neighboring troponin complexes; this cooperativity is mediated by the N-terminal reFIG. 10. Silver-stained SDS-PAGE of the contractile gion of TnT (Potter et al, 1995; Schaertl et protein fraction of L. pulchella flight muscle (Fitzhugh al., 1995). Thus, TnT functions as the and Marden, 1997). Note the shift in isoform expres"gain" setting in the signal transduction sion of the calcium regulatory protein troponin T between tenerals (lanes 1, 2) and matures (lanes 3, 4), pathway that activates striated muscle, via which is confirmed by a Western blot (teneral in lane a mechanism that is presently unknown. 5; mature in lane 6). Bands corresponding to troponins Previous researchers have invariably apH, I, and C do not change with age. Three separate blots (TnT; TnC; and a combined Tnl & TnH [which proached the problem of TnT mediated share an epitope]) have been overlaid digitally to form cooperativity by thinking in terms of molanes 5 and 6. Antibodies used in the Western blot lecular interactions occurring along the were generously donated by B. Bullard. Numbers on length of a single thin filament (i.e., the the left show apparent molecular mass (KDaltons). "linear lattice model"; Willadsen et al., 1992; Tobacman, 1996). However, despite an expression library with TnT antibody in considerable effort, it remains unclear how order to isolate clones containing the TnT linearly-arranged troponins interact with gene. To date, we have sequenced 4 TnT each other. Recent electromicroscopy imcDNAs from this library; these contain two ages of insect flight muscle in which the combinations of 3 alternatively spliced ex- troponin complex was labeled with goldons near the 5' end (Fig. 11; Wolf and Mar- conjugated antibodies (Reedy et al., 1994) den, in preparation) but are otherwise near- have stimulated us to pose an alternative ly identical (i.e., these are splice variants model. These micrographs show that trofrom a single gene). These cDNAs show ca. ponin complexes on adjacent thin filaments 70% nucleotide identity with TnT cDNA are arranged in a regular diagonal array from Drosophila (Fyrberg et al, 1990). We (Fig. 12a), wherein cross-filament interac- 539 DRAGONFLY MUSCLE MATURATION Nucleotide sequences of 2 cDNA's with alternatively spliced exons 5" 1 2 3 4 31 5 . .ATGTCGGACGAGGAGGAGTACT. . .AQGAGGAGGAGGAGGTGAAGG GAGAAAAGGGAGAT. N- and C-terminal sequences of troponin-T protein N-terminal Drosophila L. m 10 30 • L 44 4 40 50 60 H3DPEFIKRQDQKRSDIJaX>IKEYTIEWRKQR Msl )KKK'irQE;h:Kkh:\7K7yTS;K'K'— 340 Drosophila L pulchella on 20 4 350 360 370 C-terminal EEIJAKADEDIVEIIJEEVEEEWEEEDEEDEEDEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEAKAG ftWKl n <T .KKt* I • FIG. 11. Partial sequence data for the L. pulchella troponin-T gene. The upper box shows nucleotide sequences for the variably spliced region of 2 cDNAs that have a different combination of alternatively spliced exons. Each sequence shows an invariant region near the 5' end (ATGTCGGACGAGGAGGAGTACT) and in the 3' direction of the variable region (GAGAAAAGGGAGAT..). Between these invariable regions are combinations of 3 alternatively spliced exons. The lower box shows an alignment of the N- and C-terminal regions of the deduced amino acid sequence for TnT protein in L. pulchella and D. melanogaster (Fyrberg et al., 1990). Alternatively spliced exons are framed by arrows. Note the preponderance of negatively charged residues (E, D) in the alternatively spliced exons and in the C-terminal. tions among troponin complexes might be the avenue for cooperative activation. A combination of molecular and morphological data from our dragonfly research supports this model. Teneral isoforms of TnT carry strong negative charges (glutamic acid residues) at or near each end of the rod-shaped molecule (Fig. 11); these charge groups may repel each other and thereby reduce cooperative interactions among neighboring TnTs (Fig. 12c), which in turn reduces calcium sensitivity of muscle activation. Mature isoforms of TnT, lacking the glutamic acid-rich alternative exons, have instead an N-terminal that is slightly positive in its net charge. A positively charged N-terminal could interact with the string of glutamic acid residues at the C-terminal, forming head-to-tail charge interactions among the troponin complexes on adjacent thin filaments, thereby increasing cooperativity of calcium activation. This model is supported by ultrastructural changes that accompany the maturational change in TnT isoform expression. Electron micrographs of cross-sections of L. pulchella teneral muscle show an irregular spa- tial arrangement of the myofilaments, whereas mature muscle shows the nearly crystaline arrangement typical of mature insect flight muscle (Fig. 12c, d). Expression of mature isoforms of TnT might be one of the final steps in myogenesis, wherein adjacent thin filaments are "zipped" together by charge interactions that also establish the cooperativity during calcium activation. Interestingly, a recent study has shown that rod-like synthetic molecules with divergently composed ends (hydrophilic versus hydrophobic) can self-assemble into structures that are, in certain ways, strikingly similar to muscle (Stupp et al., 1997). Testing the role of troponin-t splice variants in the structure-function relationships of insect muscle is one of the main goals of our ongoing work. PUTTING THE PIECES TOGETHER TO ARRIVE AT AN INTEGRATIVE MODEL Modern biology provides tools to study organisms at all levels of biological organization, from molecules to ecosystems, yet relatively few investigators take advantage of this opportunity. Our study of muscle 540 J. H. MARDEN ET AL. FIG. 12. A: Electron micrograph (from Reedy et al., 1994) of Lethocerus flight muscle with gold immunolabeling of TnT. The sarcomere's Z band is at the bottom of the frame; only the I-band is visible. Note the diagonal array of troponins on adjacent thin filaments. B: Our hypothesis for head-to-tail charge interactions of TnT molecules on adjacent thin filaments. C: Electron micrographs of cross-sections of flight muscle from teneral (left) and mature (right) L. pulchella dragonflies. Each image includes a small portion of mitochondria and sarcoplasmic reticulum. Compare the irregular spacing of myofibrils in the teneral versus the nearly crystalline array of myofibrils in the mature. Scale bar at bottom center (100 nM) refers to panels C and D only. maturation in a dragonfly has begun to integrate the following phenomena: i) molecular-level changes in the isoform composition of a calcium regulatory protein (TnT), ii) tissue-level changes in muscle ultrastructure and contractile function, iii) organismlevel changes in locomotor mechanics, performance, and efficiency, and iv) ecological changes in the need for efficient versus high-performance flight, manifested by population-level processes of growth, survival, and mating success. In a nutshell, it appears that alternative splicing of the calcium regulatory protein troponin-T is one component of a process that changes the "gearing" muscle contractile function in accordance with developmental changes in mechanical loading and the need for economical versus high-performance flight (Fig. 13). We have evidence of varying strength for all of these isolated phenomena (i.e., the boxes in the diagram; Fig. 13), whereas the causational linkages between phenomena (arrows in Fig. 13) are primarily untested hypotheses that require further experimentation. In many cases we have been able to make a successful prediction regarding how variation at one level will affect processes at another level (i.e., how calcium sensitivity affects twitch contraction kinetics; Fitzhugh and Marden, 1997), however alternate hypotheses abound (i.e., perhaps the kinetics of calcium release and resequestration by the SR is age-variable and causes the changes in twitch contraction kinetics). We are presently engaged in testing two key links in the hypothesized chain of causality; i) the role of TnT protein variants in determining calcium sensitivity of muscle activation (which we plan to test using recombinant troponins to extract and replace native troponins in skinned fibers), and ii) the importance of matching age-variable contraction kinetics with age-variable contraction frequency (which we are testing by performing work-loop experiments [Josephson, 1985]). Developmental and maturational changes in the form and function of muscle appear to be ubiquitous in motile organisms. For example, other hemimetabolous insects (lacking a pupal stage) show similar maturational changes in flight muscle size, mitochondrial density, contraction kinetics, and myofilament organization, which are related to changing functional demands (Ready and Najm, 1985; Ready, 1986; Novicki and Josephson, 1987; Novicki, 1989; Stokes et al, 1994). Thus, Libellulid dragonflies do not possess a novel system for varying their muscle properties with age. Rather, they demonstrate how an apparent "developmental constraint" (i.e., an unavoidable transitional period in muscle 541 DRAGONFLY MUSCLE MATURATION Understanding muscle physiology of Libellula pulchella dragonflies at multiple levels of biological organization Alternative splicing of Troponin-t gene Changes in muscle loading Age-specific expression of Tn-t protein isoforms Changes in calcium release & uptake? Changes in sarcomere structure Changes in calcium sensitivity of muscle activation Changes in neural stimulation andwingbeat kinematics Changes in thermal sensitivity of flight performance Changes in maximal flight performance Changes in flight efficiency and energetics Changes in kinetics of force generation Changes in amount and vigor of flight Changes in thermoregulation and the need to tolerate high thoracic temperature Natural Selection Selection for maximum growth rate in tenerals Selection for maxium flight performance in matures FIG. 13. An integrative model of locomotor physiology and ecology of Libellulid dragonflies during adult maturation. We do not mean to imply that alternative splicing of troponin-t is the sole cause of phenomena observed at higher levels, but rather that it is one factor in what is certainly a much more complex suite of interactions than is shown here. development following a change in lifestyle) may actually be used adaptively in the context of a specific life history. Broad flexibility in the deployment and effect of the molecular toolbox that animals use to generate muscle plasticity is revealed by comparison of dragonflies with more distantly related organisms. For example, the mammalian heart beats at a considerably higher frequency in early life than at maturity, thus a reverse of the dragonfly pattern of increasing muscle contraction frequency with age. Fetal and neonatal mammals have a different isoform of cardiac TnT than do adults, which causes neonatal cardiac muscle to have a higher calcium sensitivity (Tobacman and Lee, 1987; McAuliffe et al, 1990; Nassar et al, 1991). Alternative splicing of mammalian cardiac TnT follows a pattern that is virtually identical to that of dragonflies, as N-terminal glutamic acid-rich residues are present in the fetal/neonatal isoforms but are absent at maturity (Jin and Lin, 1989; Jin et al, 1992). This would seem to conflict with our model of cooperativity and calcium sensitivity being determined by head-to-tail charge interactions, however the C-terminal of mammalian cardiac TnT lacks the string of glutamic acids present in insect TnT, containing instead a weakly positive net charge. Thus, the head-to-tail charge polarity of mammalian cardiac TnT decreases during maturation, which in agreement with 542 J. H. MARDEN ETAL. our model, coincides with a decrease in calcium sensitivity. This comparison of dragonfly and mammalian muscle reveals that TnT has both conserved and novel elements, which are apparently used to tune muscle contraction to different patterns of age-variable mechanical demands, with dragonflies showing but one variation on a possibly widespread theme. Finally, it is worth noting that our curiosity-driven, basic research on dragonfly muscle may yield information that has considerable clinical interest. Changes in TnT expression have been correlated with human heart failure from dilated cardiomyopathy, primary pulmonary hypertension, ischaemic heart disease (Townsend et al., 1995), and diabetes (Hofmann et al., 1995). Mutations in human cardiac TnT are responsible for about 15% of all familial hypertrophic cardiomyopathies (Watkins et al., 1995Z?). Patients with cardiac TnT mutations have a higher incidence of death before age 30 and a significantly higher proportion of sudden death than those with (3 cardiac myosin heavychain mutations (Watkins et al., 1995a). Dilated cardiomyopathy has an estimated prevalence of nearly 40 per 100,000 individuals and is the most common cause of cardiac transplantation in the U.S. (Durand et al., 1995). How TnT variable expression and mutations affect human cardiac pathology is not presently understood. The important effect may be on sarcomere structure, or it may be that cardiac muscle with lower calcium sensitivity accomplishes less stroke work, thus triggering cardiac hypertrophy (Watkins et al., 1996). By developing an organismal model for assessing the structural and functional effects of variable TnT expression, we may be able to contribute in important ways to an understanding and eventual ability to treat certain forms of heart disease. We raise this point not for self-promotion, but to explicitly demonstrate once again (mostly for the sake of those who would question it) the potential societal benefits of curiositydriven basic research on diverse organisms, and the potential synergism between basic biology and applied biomedical research. ACKNOWLEDGMENTS Thanks to B. Rowan, M. Kramer, T. Spear, and J. Frisch for their contributions to collecting the field data. B. Bullard generously provided the anti-troponin antibodies, without which much of this project would not have been possible. C. Hass provided extensive assistance in cloning, library construction and library screening. Comments from two anonymous reviewers greatly improved the manuscript. Supported by NSF grants IBN-9317969 and IBN9600840. REFERENCES Akella, A. B., X.-L. Ding, R. Cheng, and J. Gulati. 1995. Diminished calcium sensitivity of skinned cardiac muscle contractility coincident with troponin T-band shifts in the diabetic rat. Circ. Res. 76:600-606. Andreadis, A., M. E. Gallego, and B. Nadal-Ginard. 1987. Generation of protein isoform diversity by alternative splicinga: Mechanistic and biological implications. Ann. Rev. Cell Biol. 3:207-242. Anholt, B. R., J. H. Marden, and D. M. Jenkins. 1991. Patterns of mass gain and sexual dimorphism in adult dragonflies (Insecta: Odonata). Can. J. Zool. 69:1156-1163. Baird, J. M. 1991. Behavioral ecology of foraging in Pachidiplax longipennis (Odonata, Libellulidae) (Energetics, agonistic behavior, prey availability). Ph.D. Diss., Rutgers University. Bandman, E. 1992. Contractile protein isoforms in muscle development. Dev. Biol. 154:273-283. Bartholomew, G. A. 1987. Quotation from group discussion of "Multidisciplinary studies of populations" In M. E. Feder, A. F. Bennett, R. B. Huey, and W. Burggren (eds.), New directions in ecological physiology, p. 134. Cambridge Univ. Press, Cambridge. Bijlsma, R. and V. Loeschcke. 1997. Stress, adaptation, and evolution. Birkhauser Verlag, Basel. Block, B. A. 1994. Thermogenesis in muscle. Ann. Rev. Physiol. 56:535-577. Breitbart, R. E., H. T. Nguyen, R. M. Medford, A. T. Destree, V. Mahdavi, and B. Nadal-Ginard. 1985. Intricate combinatorial patterns of exon splicing generate multiple regulated troponin-t isoforms from a single gene. Cell 41:67-82. Cannell, M. B. and D. G. Allen. 1984. Model of calcium movements during activation in the sarcomere of frog skeletal muscle. Biophys. J. 45:913925. Ellington, C. P. 1991. Limitations on animal flight performance. J. Exp. Biol. 160:71-91. Feder, M. E. and B. A. Block. 1991. On the future of physiological ecology. Func. Ecol. 5:136—144. Fitzhugh, G. H. and J. H. Marden. 1997. Maturational changes in troponin T expression, calcium sensitivity, and twitch contraction kinetics in dragonfly DRAGONFLY MUSCLE MATURATION flight muscle. In revision, J. Exp. Biol. 200:14731482. Fried, C. S. and M. L. May. 1983. Energy expenditure and food intake of territorial male Pachydiplax longipennis (Odonata: Libellulidae). Ecol. Entomol. 8:283-292. Fyrberg, E., C. C. Fyrberg, C. Beall, and D. L. Saville. 1990. Drosophila melanogaster troponin-T mutations engender three distinct syndromes of myofibrillar abnormalities. J. Mol. Biol. 216:657-675. Goffeau, A. et al. (15 coauthors) 1996. Life with 6000 genes. Science 274:546-567. Hochachka, Peter W. 1994. Muscles as molecular and metabolic machines. CRC Press, Boca Raton. Hochachka, P. W. and G. N. Somero. 1984. Biochemical adaptation. Princeton University Press. Hochachka, P. W. and T. P. Mommsen. 1995. Environmental and ecological biochemistry. Elsevier, New York. Hofmann, P. A., Menon, and K. E Gannaway. 1995. Effects of diabetes on isometric tension as a function of [Ca2+] and pH in rat skinned cardiac myocytes. Am J. Physiol. 269: H1656-H1663. Huey, R. B. and R. D. Stevenson. 1979. Integrating thermal physiology and ecology of ectotherms: A discussion of approaches. Araer. Zool. 19:357366. Jin, J.-P. and J. J.-C. Lin. 1989. Isolation and characterization of cDNA clones encoding embryonic and adult isoforms of rat cardiac troponin T. J. Biol. Chem. 264:14471-14477. Jin, J.-R, Q. Q. Huang, H. I. Yeh, and J. J. Lin. 1992. Complete nucleotide sequence and structural organization of rat cardiac troponin T gene: A single gene generates embryonic and adult isoforms via developmentally regulated alternative splicing. J. Mol. Biol. 227:269-276. Josephson, R. K. 1981. Temperature and the mechanical performance of insect flight muscle. In B. Heinrich (ed.), Insect thermoregulation, pp. 1944. John Wiley & Sons, New York. Josephson, R. K. 1985. Mechanical power output from striated muscle during cyclic contraction. J. Exp. Biol. 114:493-512. Lehmann, F-O. and M. H. Dickinson. 1997. The changes in power requirements and muscle efficiency during elevated force production in the fruit fly, Drosophila melanogaster. J. Exp. Biol. 200:1133-1143. Malhotra, A. 1994. Role of regulatory proteins (troponin-tropomyosin) in pathologic states. Mol. Cell. Biochem. 135:43-50. Marden, J. H. 1987. Maximum lift production during takeoff in flying animals. J. exp. Biol. 130:235258. Marden, J. H. 1989. Bodybuilding dragonflies: Costs and benefits of maximizing flight muscle. Physiol. Zool. 62:505-521. Marden, J. H. 1990. Maximum load-lifting and power output by Harris' Hawks are general functions of flight muscle mass. J. exp. Biol. 149:511-514. Marden, J. H. 1995. Large-scale changes in thermal sensitivity of flight performance during adult mat- 543 uration in a dragonfly. J. exp. Biol. 198:20952102. Marden, J. H., M. G. Kramer, and J. Frisch. 1996. Agerelated variation in body temperature, thermoregulation and activity in a thermally polymorphic dragonfly. J. exp. Biol. 199:529-535. Martin, A. E, K. Ball, L. Gao, P. Kumar, and R. J. Solaro. 1991. Identification and functional significance of troponin I isoforms in neonatal rat heart myofibrils. Circ. Res. 69:1244-1252. McAuliffe, J. I., L. Gao, and R. J. Solaro. 1990. Changes in myofibrillar activation and troponin C Ca2+ binding associated with troponin T isoform switching in developing rabbit heart. Circ. Res. 66:1204-1216. Nadal-Ginard, B., C. W. Smith, J. G. Patton, and R. E. Brietbart. 1991. Alternative splicing is an efficient mechanism for the generation of protein diversity: Contractile proteins genes as a model system. Adv. Enz. Regul. 31:261-286. Nassar, R., N. N. Malouf, M. B. Kelly, A. E. Oakeley, and P. A. W. Anderson. 1991. Force-pCa relation and troponin T isoforms of rabbit myocardium. Circ. Res. 69:1470-1475. Novicki, A. 1989. Control of growth and ultrastructural maturation of a cricket flight muscle. J. Exper. Zool. 250:263-272. Novicki, A. and Josephson. 1987. Innervation is necessary for the development of fast contraction kinetics of singing muscles in a katydid. J. Exper. Zool. 242:309-315. Pezalla, V. M. 1979. Behavioral ecology of the dragonfly Libellula pulchella Drury (Odonata: Anisoptera). Am. Midi. Nat. 102:1-22. Potter, J. D., Z. Sheng, B. Pan, and J. Zhao. 1995. A direct regulatory role for troponin-t and a dual role for troponin-c in the Ca2+ regulation of muscle contraction. J. Biol. Chem. 270:2557-2562. Powers, D. A. and P. M. Schulte. 1996. A molecular approach to the selectionist/neutralist controversy. In J. D. Ferraris and S. R. Palumbi (eds.), Molecular zoology: Advances, strategies, and protocols, pp. 327-352. Wiley-Liss, New York. Ready, N. E. 1986. Development of fast singing muscles in a katydid. J. Exper. Zool. 238:43-54. Ready, N. E. and R. E. Najm. 1985. Structural and functional development of cricket wing muscles. J. Exper. Zool. 233:35-50. Reedy, M. C. et al. 1994. Gold/Fab immuno electron microscopy localization of troponin H and troponin T in Lethocerus flight muscle. J. Mol. Biol. 239:52-67. Reiser, P. J., M. L. Greaser, and R. L. Moss. 1992. Developmental changes in troponin T isoform expression and tension production in chicken single skeletal muscle fibres. J. Physiol. (Lond) 449:573588. Rome, L. C , D. A. Syme, S. Hollingworth, S. L. Linestedt, and S. M. Baylor. 1996. The whistle and the rattle: The design of sound producing muscles. Proc. Natl. Acad. Sci. U.S.A. 93:8095-8100. Sasse, S., N. J. Brand, P. Kyprianou, G. K. Dhoot, R. Wade, M. Arai, M. Periasamy, M. H. Yacoub, and P. J. R. Barton. 1993. Troponin I gene expression 544 J. H. MARDEN ETAL. during human cardiac development and in endstage heart failure. Circ. Res. 72:932-938. Schachat, E H., M. S. Diamond, and P. W. Brandt. 1987. Effect of different troponin T-tropomyosin combinations on thin filament activation. J. Mol. Biol. 198:551. Schaertl, S., S. S. Lehrer, and M. A. Geeves. 1995. Separation and characterization of the two functional regions of troponin involved in muscle thin filament regulation. Biochem. 34:15890-15894. Smillie, L. B., K. Golosinska, and F. C. Reinach. 1988. Sequences of complete cDNAs encoding four variants of chicken skeletal muscle troponin T. J. Biol. Chem. 263:18816-18820. Stokes, D. R., J. G. Malamud, and D. A. Schreihofer. 1994. Gender specific developmental transformation of a cockroach bifunctional muscle. J. Exper. Zool. 268:364-376. Stupp, S. I., V. LeBonheur, K. Walker, L. S. Li, K. E. Huggins, M. Keser, and A. Amstutz. 1997. Supramolecular materials: Self-organized nanostructures. Science 276, 384-389. Tobacman, L. S. 1996. thin filament-mediated regulation of cardiac contraction. Annu. Rev. Physiol. 58:447-481. Tobacman, L. S. 1988. Structure-function studies of the amino-terminal region of bovine cardiac troponin T. J. Biol. Chem. 263:2668-2672. Tobacman, L. S. and R. Lee. 1987. Isolation and functional comparison of bovine cardiac troponin-t isoforms. J. Biol. Chem. 262:4059-4064. Townsend, P. J., P. J. Barton, M. H. Yacoub, and H. Farza. 1995. Molecular cloning of human cardiac troponin T isoforms: Expression in developing and failing heart. J. Mol. Cardiol. 27:2223-2236. Tsugorka, A., E. Rios, and L. A. Blatter. 1995. Imaging elementary events of calcium release in skeletal muscle cells. Science 269:1723-1726. Watkins, H., W. J. McKenna, L. Thierfelder, H. J. Suk, R. Anan, A. O'Donoghue, P. Spirito, A. Matsumori, C. S. Moravec and J. G. Seidman. 1995a. Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy. N. Engl. J. Med. 332: 1058-1064. Watkins, H., J. G. Seidman, and C. E. Seidman. 19956. Familial hypertrophic cardiomyopathy: A genetic model of cardiac hypertrophy. Hum. Mol. Genet. 4: 1721-1727. Watkins, H., C. Seidman, J. G. Seidman, H. S. Feng, and H. L. Sweeney. 1996. Expression and functional assessment of a truncated cardiac troponin T that causes hypertrophic cardiomyopathy. J. Clinical Invest. 98:2456-2461. Weissenbach, J. 1996. Landing on the genome. Science 274:479. Willadsen, K. A., C. A. Butters, L. E. Hill, and L. S. Tobacman. 1992. Effects of the Amino-terminal regions of tropomyosin and troponin T on thin filament assembly. J. Biol. Chem. 267:2374623752. Wu, Q.L., P. K. Jha, Y. Du, P. C. Leavis, and S. Sarkar. 1995. Overproduction and rapid purification of human fast skeletal beta troponin T using E. coli expression vectors: Functional differences between the alpha and beta isoforms. Gene 155:225— 230.