Download From Molecules to Mating Success: Integrative Biology of Muscle

AMER. ZOOL., 38:528-544 (1998)
From Molecules to Mating Success: Integrative
Biology of Muscle
Maturation in a Dragonfly1
JAMES H. MARDEN, 2 GAIL H. FITZHUGH, AND MELISANDE R. W O L F
Department of Biology, 208 Mueller Laboratory, The Pennsylvania State University, University Park,
Pennsylvania 16802
Dragonflies begin adult life as comparatively weak fliers, then mature to
become one of nature's ultimate flying machines. This ontogenetic transition provides
an opportunity to investigate the relationship between life history, phenotypic plasticity, and changing ecological demands on organismal performance. Here we present
an overview of a wide-ranging study of dragonfly muscle maturation that reveals i)
ecological changes in the need for efficient versus high-performance flight, ii) organism-level changes in performance, thermal physiology, locomotor mechanics, and energy efficiency, iii) tissue-level changes in muscle ultrastructure and sensitivity to activation by calcium, and iv) molecular-level changes in the Lsoform composition of a
calcium regulatory protein in flight muscle (troponin-T). We discuss how these phenomena may be causally related, and thereby begin to show linkages across many
levels of biological organization. In particular, we suggest that alternative splicing of
troponin-T mRNA is an important component of the "gearing" of muscle contractile
function for developmental changes in wingbeat frequency and ecological demands on
flight performance. Age-variable gearing of muscle function allows energetically economical flight during early adult growth, whereas power output is maximized at maturity when aerial competition determines success during territoriality and mating.
SYNOPSIS.
INTRODUCTION
" . . . the ideal, but only infrequently
practical, solution would be to take the
analysis of phenomena all the way from
the ecosystem to the molecule." G. A.
Bartholomew, 1987
" . . . the ultimate goals of 'molecular biology' are clearly to explain the consequences of lower-level variation for higher-level (i.e. organismal) function. Accordingly, 'molecular biology' and at
least the mechanistic aspects of physiological ecology ought to resonate strongly with one another. Currently, they seldom do, more for cultural than for scientific reasons." M. E. Feder & B. A.
Block, 1991
The first entire sequence of a eukaryotic
genome was recently completed (Goffeau et
1
From the Symposium Responses of Terrestrial Arthropods to Variation in the Thermal and Hydric Environment: Molecular, Organismal, and Evolutionary
Approaches presented at the Annual Meeting of the
Society for Integrative and Comparative Biology, 2630 December 1996, at Albuquerque, New Mexico.
2
E-mail: [email protected]
ah, 1996), thus attaining one of the "holy
grails" of reductionist biology. To herald
this event, a celebratory tone might have
been expected, however the authors tersely
reported that much of the work "was carried out in large sequencing centers by
highly specialized scientists and technicians
who may never have seen a yeast outside
of a bottle of doubly fermented beer." Molecular biology has thus converged upon a
chronic concern of organismal biology, the
realization that our discipline has in part
been delegated to "technicians" who may
have little knowledge or appreciation of socalled "real biology." Molecular biologists
are reawakening to the need to relate data
across all levels of biological organization,
to the extent that efforts to understand "living organisms as a whole" are now being
hailed as biology's next frontier (Weissenbach, 1996).
Known relationships between molecular
level variation and whole organism physiology and ecology are scattered widely
across the biological sciences (e.g., Hochachka and Somero, 1984; Hochachka and
Mommsen, 1995; Bijlsma and Loeschcke,
528
DRAGONFLY MUSCLE MATURATION
1997). Muscle function is an especially fertile area for such integrative studies {e.g.,
Block, 1994; Hochachka, 1994, Powers and
Schulte, 1996), as muscle cells are well
characterized, and muscle function is both
readily assayed and important for various
aspects of organismal performance. Following in this tradition, we have for the past
five years been studying muscle contractile
function and organismal performance of
dragonflies, with the ultimate goal of understanding a free-living organism "as a
whole." Although this project is far from
complete, an overview at this time will help
to crystallize the connections between studies that are presented in a more piece-meal
fashion in the primary literature. Our presentation of this material begins at the ecological and organismal levels, then proceeds to explore candidates for underlying
cellular and molecular mechanisms.
529
changes in the amount and vigor of flight,
as relatively sedentary, weak-flying tenerals
transform into extremely active and aerobatic mature adults. Thus, we sought to determine how muscle contractile physiology
changes with age, and how these changes
affect the mechanics and ecology of flight.
We anticipated that these findings might
have broad significance because striated
muscle is a nearly ubiquitous tissue in animals, most of whom undergo ontogenetic
changes in size, locomotion, behavior, and
ecology.
ECOLOGICAL DEMANDS ON TENERAL VERSUS
MATURE LIBELLULID DRAGONFLIES
Libellulid dragonflies forage by visually
scanning the airspace surrounding elevated
perches. They make brief flights to capture
tiny prey that average <0.1 mg dry mass
and are easy to catch (success rate of predation flights = 65-93% depending on conLIFE HISTORY OF ADULT DRAGONFLIES
ditions and sampling methods; Baird,
Life history of dragonflies follows the 1991). Because they feed on easily caught
ancestral pattern for insects, progressing prey that yield a low energetic return, and
from eggs to sexually mature adults via a flight is an extraordinarily expensive form
series of imaginal moults; there is no qui- of locomotion, survival and growth rate
escent pupal stage. The final moult, which may be highest for teneral Libellulid dragrequires about 1 hour, transforms an aquatic onflies that minimize energy expenditures,
nymph into a flying adult (see photos in and maximize their flight efficiency.
Marden, 1995).
We are presently performing mark-recapAfter inflation and hardening of the ture field studies aimed at determining
wings, the "teneral" adult is ready to fly. growth rates of teneral Libellulid dragonDuring its first 5-10 days, the teneral feeds flies. During the summer of 1996, we capon flying insects while its cuticle continues tured, weighed, marked, and released 182
to harden and develop mature pigmentation. Libellula lydia (syn. Plathemis lydia) tenerUpon maturation, behavior changes mark- als, then revisited the same field sites on
edly, as dragonflies periodically forsake for- subsequent days. We recaptured 22 individaging and return to ponds where they en- uals, of whom 11 had lost body mass and
gage in territoriality and mating (Fried and 11 had gained body mass (Fig. 2; Rowan
and Marden, in preparation). Three of the
May, 1983).
Maturational changes that affect the ex- "gainers" were recaptured on a third day,
ternal appearance of dragonflies are com- and each had again gained body mass.
mon knowledge, however little research has Three other "gainers" had attained a maexamined maturational variation of internal ture body mass by the time of their initial
physiological traits. Our interest in matur- recapture (>400 mg; note that the Pennsylational physiology of Libellulid dragonflies vania population of L. lydia is somewhat
was stimulated by the simple observation smaller than the more northerly population
that these insects approximately double in whose body masses are shown in Fig. 1).
body mass during adult maturation (Fig. 1), None of the "losers" were recaptured a
with changes in the size, color, and ultra- third time, and no losers attained mature
structure of their flight musculature (Mar- body mass. We have now replicated this exden, 1989). Concurrently, there are striking periment with a larger sample of L. pul-
530
J. H. MARDEN ETAL.
Males
Females
ovipositing
*
Thorax
Abdomen
Head
Wings
Legs
200
300
400
500
200
300
Body mass (mg)
400
r
500
T
600
FIG. 1. Distribution of body mass among body regions during adult maturation in L. lydia dragonflies, as
inferred from cumulative data for 138 males and 33 females, each sampled destructively at one body mass
(Marden, 1989). The majority of growth in males occurs in the thorax (flight muscle), whereas most female
mass increase consists of maturing ovaries in the abdomen.
SCOO)
Losers
N=11
Gainers
N=11
s
200- fev 0
4
Time (days)
12
FIG. 2. Changes in body mass over time for marked
and recaptured L. lydia tenerals in the field during the
summer of 1996.
chella during the summer of 1997; losers
outnumber gainers, and a sample of losers
measured for fat content show starvationlevel energy reserves (mean = 1.6% body
fat) that are much lower than the fat reserves of newly emerged L. pulchella
(mean = 4% body fat; Anholt et al, 1991).
These data show that teneral Libellulid
dragonflies are frequently on a negative energy budget, from which they apparently do
not often recover. Traits that influence energy efficiency are therefore likely to be important for determining gainers versus losers, and thus under strong natural selection.
Mature Libellulid dragonflies appear to
have a much greater need for high performance flight than do tenerals. Mature males
use highly escalated aerial contests to es-
531
DRAGONFLY MUSCLE MATURATION
•
•
O
o
mature, high exertion
mature, routine flight
teneral I
45-
eratu
D
40-
Q.
•
E
acic te
tablish and defend mating territories (Pezalla, 1979). Mating involves high-speed
chases of females by one or more territorial
males. The male that succeeds in grasping
and copulating with a female then releases
her within his territory and hovers above
her while she oviposits. Other males frequently intrude (they disrupted 53% of ovipositions in a study of L. lydia; Marden,
1989), attempting to rush in and grasp, copulate with, and abduct ovipositing females
to their own territories. The male guarding
an ovipositing female responds with darting
flights to block onrushing males. Females
are not passive participants in mating; they
frequently use high-performance flight maneuvers to evade males attempting to copulate or disrupt oviposition.
Our subjective impression that extraordinary flight effort occurs during territoriality and mating is corroborated by field
studies of thermoregulation in L. pulchella
(Marden et al., 1996). Thoracic temperatures recorded from mature males engaged
in aerial copulation, mate guarding, or escalated territorial contests were compared
against concurrently sampled individuals
engaged in routine patrolling flight. Males
engaged in high-exertion behaviors showed
an average 1.3°C increase in Tth, with a Tth
as high as 45°C recorded from a male engaged in an escalated territorial contest.
These high-exertion behaviors are brief and
do not expose dragonflies to a different ambient temperature or light regime; increased
Tlh must therefore be caused by an increase
in metabolic heat production, the byproduct
of intense effort.
In a previous study of male mating success in L. lydia (Marden, 1989), males with
the highest ratio of flight muscle mass to
total body mass had the highest relative
mating success among groups of competing
males. A subset of males carrying small,
experimentally applied weight loads (613% of unladen mass) had poor territorial
and mating success when they were competing against unweighted males. These results demonstrate that flight performance is
a key aspect of reproductive success for
mature Libellulid dragonflies.
o
H
o
35- o
O
o
^ ^ ^
^
°
^
o
o
o
^ *
30-
o
15
20
25
30
35
Ambient temperature fC)
FIG. 3. Thoracic temperature of mature and teneral
(newly emerged) L. pulchella dragonflies captured during activity in the field. Statistics and detailed methods
are presented in Marden et ai, 1996.
THERMOREGULATION AND ACTIVITY IN THE
FIELD
Mature L. pulchella dragonflies flying in
nature tightly regulate high thoracic temperatures (Tth = 38 to 45°C; Fig. 3). In contrast, tenerals show weak regulation of relatively cool Tths (29 to 40°C). Maturational
differences in body temperature are a result
of both physiological and behavioral factors. Tenerals attain a lower equilibrium Tth
during basking, and they cool more rapidly
(Marden et al., 1996). Tenerals are much
less active, spending an average of only 2%
of their time flying (SD = 2), with flight
durations averaging only 3 sec (SD = 1).
Territorial matures are much more active,
spending an average of 32% of the time flying (SD = 33.5), with an average flight duration of 82 sec (SD = 1 5 5 ; Marden et al.,
1996). This increase in the frequency and
duration of flights raises the rate of endogenous heat production within the flight
muscles of matures, which undoubtedly
contributes to their higher thoracic temperatures.
WHOLE ORGANISM LOCOMOTOR
PERFORMANCE
To quantify flight capacity at known thoracic temperatures, dragonflies can be at-
532
J. H. MARDEN ET AL.
60- Teneral
scl
CD
40-
3
E 200Z^
ton
CO
80-
Mature
60-
rtic
CO
40-
CO
200
20
30
40
50
Thoracic temperature (°C)
FIG. 4. Traces outlining the upper limit of vertical
force production as a function of thoracic temperature
for 12 teneral and 12 mature L. pulchella dragonflies.
These curves are based on an average of 223 flight
attempts per individual (Marden, 1995).
tached to the horizontal stylus of a force
transducer and stimulated to attempt to fly
(Marden, 1995). By measuring the mean
vertical force produced during hundreds of
flight attempts over a broad range of thoracic temperatures, it is possible to obtain a
thermal sensitivity curve (Huey and Stevenson, 1979) for maximal flight performance.
Maximal lift forces obtained using this
method agree closely with maximal lift
forces generated in free-flight by dragonflies carrying experimentally applied loads
(Marden, 1987), thus indicating that short
bursts of tethered flight in dragonflies are a
reasonable approximation of free flight.
Results of these experiments reveal that
L. pulchella dragonflies undergo a striking
change in maximal flight performance and
thermal sensitivity of performance during
adult maturation (Fig. 4). Tenerals show a
broad plateau of near-peak performance
(ca. 40 N vertical force per kg flight muscle), first attained at cool thoracic temperatures (typically 28-34°C) and maintained
up to thoracic temperatures of 40-45°C
(mean optimal thoracic temperature [OTT]
= 34.6°C). In contrast, fully mature adults
show narrow thermal sensitivity curves,
wherein peak performance (ca. 60 N vertical force per kg flight muscle) is approached only within a few degrees of the
thermal optimum, which invariably occurs
at hot thoracic temperatures (38-50°C;
mean OTT = 43.5°C). Comparing these
thermal optima to thoracic temperatures
regulated in the field (Fig. 3), reveals a tight
correspondence between the thoracic temperatures that are best for flight and the
temperatures that each age group experiences in nature.
Adult emergence in L. pulchella occurs
over a period of about 2 months (June and
July in northeastern U.S.), during which
mature adults are present at nearly all times.
Thus, teneral and mature adults are not separated seasonally, and there is no evidence
to suggest that maturational changes in
thermal physiology result from acclimation
to seasonal changes in the thermal environment (Marden, 1995). Thus, it appears that
L. pulchella dragonflies undergo a genetically triggered change in locomotor physiology, which results in a 1.5-fold increase
in peak performance and a 9°C increase in
optimal body temperature, in the absence of
directional change in the external thermal
environment.
In order to generate 50% more muscle
mass-specific lift, mature dragonflies must
be doing something different with their
wings. In order to examine maturational
changes in wing kinematics, we have begun
experiments that use a laser distance sensor
(LDS 80, DynaVision, Vancouver; 1 kHz
sampling) to continuously monitor wing
position during tethered flight attempts.
Matures achieve dramatically higher wing
velocities and wingbeat amplitudes than do
tenerals (Fig. 5), and they operate at a much
higher frequency (ca. 37 Hz in matures versus a variable pattern of either 19 or 27 Hz
in tenerals).
ENERGY EFFICIENCY
Increasing the contraction frequency of a
set of antagonistic muscles has important
effects on work input and output. In the absence of compensatory changes in the kinetics of muscle activation and/or deactivation, cycling at a higher frequency can
533
DRAGONFLY MUSCLE MATURATION
1
20
40
60
Wing position (degrees)
FIG. 5. Wing angular velocity as a function of wing
position (angle in relation to a 0-degree horizontal)
during a continuous series of 10 wingbeats from a mature and teneral L. pulchella dragonfly, each using single neural stimuli at T,,, of 30°C. This pattern is highly
replicable both within and among individuals, as matures consistently have higher wing velocity and stroke
amplitude than tenerals. This pattern changes when
tenerals use compound neural stimuli (Fig. 9).
result in incomplete relaxation of the muscle during the start of the lengthening phase
(i.e., the muscle is being stretched while the
cross-bridges are active and generating
forces that oppose stretching). Thus, as
wingbeat frequency increases, an increasing
"U*^fen •
o
2 0.06-
Efficier
•
•
•
0.08-
•-Mat
0.04-
•
0.02o
1
0.030.02« 0.01-
1
0-
11
-0.01-0.02-
o
i
proportion of the work performed by downstroke muscles must be expended to stretch
the upstroke muscles, and vice versa (Josephson, 1981). For muscles that do not
vary greatly in total twitch duration, this
"wasted work" (inefficiency) must increase
with increasing wingbeat frequency. Accordingly, we can predict that the higher
wingbeat frequencies used by mature L.
pulchella dragonflies should be less energyefficient than the motor pattern used by tenerals.
We have begun experiments that test this
prediction. By measuring vertical force production by tethered dragonflies in an openflow respirometry system (Sable Systems),
we are able to determine the energetic cost
of induced power output (the useful component of aerodynamic power). Induced
power output can be estimated from lift
data (Marden, 1990; Ellington, 1991; Lehmann and Dickinson, 1997), then divided
by metabolic power input to yield an estimate of efficiency (note that this is not a
complete measure of efficiency because it
neglects the component of power output required to overcome aerodynamic drag on
the wings). Results of this experiment (Fig.
6) show that relative lift, temperature, and
age (teneral versus mature) all have signif-
i
i
i
i
r
0.6 0.8 1.0 1.2 1.4 1.6 1.8
Relative Lift (N/N body weight)
-0.03-
24
T
T
T
28
32
36
Temperature (°C)
40
FIG. 6. Flight efficiency, computed as induced power output (W; calculated using lift data and a modified
actuator disk model [Ellington, 1991] for dragonflies with an average wingbeat amplitude of 50 degrees) divided
by metabolic power input (W; using CO2 emission data and a measured RQ of 1.0) as a function of relative lift
and thoracic temperature. The vertical axis of the plot on the right uses residuals from regression lines shown
in the plot on the left. Error bars show ± 1 SD. Data are from 4 matures and 4 tenerals. A split plot ANOVA
model that accounts for random differences among individuals shows that age (teneral vs. mature; P < 0.03),
temperature (P < 0.001), and relative lift (P < 0.0004) each have significant effects on efficiency.
534
J. H. MARDEN ETAL.
icant effects on the efficiency of induced
power output. In particular, it is interesting
to note that tenerals have higher efficiency
at the thoracic temperatures that they typically maintain in nature (28-36°C), whereas
matures have relatively low efficiency at
their typical field thoracic temperatures
(>36°C).
CELLULAR MECHANISMS FOR
MATURATIONAL CHANGE IN LOCOMOTOR
PERFORMANCE
As shown above, mature L. pulchella
dragonflies achieve dramatically higher
wing velocities and wingbeat amplitudes
than do tenerals (Fig. 5). Much of this difference can be explained by the simple mechanical effect of larger mature muscles
working to beat wings that are nearly constant across age in their length and mass.
Thus, mature flight muscles are contracting
against relatively small inertial loads compared to tenerals {i.e., a different place on
their force-velocity curve). This purely mechanical factor could, by itself, cause the
increased wingbeat amplitude and velocity
of matures. However, striated muscle is a
remarkably malleable tissue, and therefore
we wondered if maturational changes in
short-burst tethered flight performance and
wingbeat kinematics might also be due in
part to changes in the contractile proteins
of the flight muscles. Thus, we set out to
examine two fundamentally different aspects of muscle contractile physiology: 1)
actin-myosin cross-bridge kinetics, as evidenced by shortening velocity and tetanic
tension of intact muscle, and 2) contractile
regulation by thin filament proteins, as evidenced by calcium sensitivity of skinned
muscle fibers.
Shortening velocity, tetanic tension, and
instantaneous power output were measured
from in situ preparations of individual mechanically isolated L. pulchella flight muscles (Fitzhugh and Marden, 1997). In these
experiments the muscle was stimulated with
a prolonged series of high-frequency electrical pulses, thus preventing resequestration of intracellular calcium by the sarcoplasmic reticulum. This experiment provides a measure of cross-bridge cycling
activity (ATP-dependent actin-myosin in-
teractions) that is largely free from effects
of calcium transients. Maximum shortening
velocity, tetanic tension, and instantaneous
power output during isotonic contraction
did not vary as a function of age, temperature, or age-temperature interaction (Fitzhugh and Marden, 1997), which demonstrates that there are no significant age-related changes in cross-bridge kinetics.
In a living dragonfly, flight muscles are
activated and deactivated in a rapid cyclical
manner by single neural impulses {i.e.,
twitch contractions). Thus, even though
cross-bridge cycling kinetics are age-invariant, any changes in the signalling pathway between nerves and cross-bridges
could affect muscle and organismal performance. Indeed, skinned fibers (demembranated muscle in which the sarcoplasmic reticulum [SR] is removed, thereby permitting direct experimental control of the Ca2+
concentration in fluid surrounding the otherwise intact contractile filaments) of mature L. pulchella flight muscle are up to
thirteen times more sensitive to activation
by calcium than skinned fibers from teneral
muscle, and their calcium sensitivity is
more strongly affected by temperature (Fig.
7; Fitzhugh and Marden, 1997).
Maturational changes in calcium sensitivity of muscle activation should affect in
vivo muscle performance in the following
manner. Mechanics of twitch contractions
depend on the time course of intracellular
changes in Ca2+ concentration and how the
muscle responds to those changes. Resting
muscle has a very low Ca2+ concentration
(10~8 M), which changes rapidly when a
single neural impulse causes calcium release from the SR, thereby creating a wave
of Ca2+ that spreads rapidly through the
myoplasm, reaching peak concentrations of
~10 4 M. Resequestration of Ca2+ by soluble Ca2+-binding proteins and by active
transport pumps in the membrane of the SR
causes a rapid return of intracellular free
Ca2+ to resting levels. The rise and fall of
intracellular Ca2+ during a twitch occurs
over a time scale of a few milliseconds
(Tsugorka et al., 1995; Rome et al., 1996).
Because transitions in intracellular Ca2+
concentration during a twitch are not instantaneous and do not saturate binding
DRAGONFLY MUSCLE MATURATION
100-1
g
80-
I 60E
Teneral
3
§ 4020-
0.01
0.1
1
10
100
Calcium concentration (uM)
Mature
O
a.
5H
I
15
Teneral
I
20
I
I
I
25
30
35
Temperature (°C)
I
40
FIG. 7. Calcium sensitivity of L. pulchella skinned
fibers. Upper plot shows means (±1 SD) for relative
tension of fibers from 6 matures and 6 tenerals at 35°C.
Lower plot shows thermal sensitivity of muscle activation, as revealed by a plot of pCa50 (negative log of
the calcium concentration producing half maximal tension) versus temperature for a total of 6 tenerals and
7 matures. Detailed methods and statistical analyses
are given in Fitzhugh and Marden, 1997.
535
muscles (Fig. 8; Fitzhugh and Marden,
1997). Mature muscles reach peak tension
more rapidly, relax more slowly, and generate greater tension. The high Ca2+ sensitivity of mature muscle at temperatures
above 35°C (Fig. 7) results in twitch tension
reaching ca. 90% of tetanic tension (Fig. 8),
i.e., nearly the full tension-production capacity of the muscle.
Neural activation of the flight muscles
also changes during maturation, in a fashion that accommodates changes in mechanical loading and calcium sensitivity of
muscle activation. Simultaneous recordings of muscle extracellular electrical potentials (EMGs) and wing position show
that mature L. pulchella dragonflies
achieve a large wing stroke amplitude (a
50—60° arc) as a result of single neural
stimuli (Fig. 9). In contrast, tenerals
achieve only about half of the mature wing
stroke amplitude when using single neural
stimuli, but they frequently switch to multiple stimuli in order to achieve a stroke
amplitude similar to matures (Fig. 9).
Thus, tenerals have a "two-gear" motor
that can produce either shallow-amplitude
wingbeats of intermediate frequency (ca.
27 Hz), or large-amplitude, slow (ca. 19
Hz) wingbeats. Matures have a one-gear
motor, operating only at a high frequency
(ca. 37 Hz; note however that matures can
adjust wingbeat amplitude by varying the
recruitment of motor units within their
muscles; they are a one-gear motor only in
terms of frequency). These differences in
the way wing position responds to muscle
activity are presumably caused by the
combined effects of maturational change in
muscle loading and calcium sensitivity of
muscle activation.
sites on troponin C (Cannell and Allen,
1984), changes in Ca2+ sensitivity of muscle activation and deactivation will necessarily bring about changes in the time
course and magnitude of twitch tension.
Thus, we predicted that the increased Ca2+
sensitivity of mature muscle would result in
MOLECULAR MECHANISMS FOR
more rapid force generation in response to
MATURATIONAL CHANGES IN CALCIUM
a Ca2+ transient, more delayed relaxation,
SENSITIVITY OF MUSCLE ACTIVATION
and greater twitch tension because the muscle is activated for a greater amount of time
The dramatic maturational change in cal(readers can visualize these effects by trac- cium sensitivity of muscle activation in L.
ing the changes in % maximal tension of pulchella flight muscle led us to examine
different aged fibers as Ca2+ concentration the isoform composition of calcium regurises and falls along the horizontal axis of latory proteins. One-dimensional SDSthe upper plot in Fig. 7). These predictions PAGE gels of contractile proteins, and
were confirmed by measurements of twitch Western blots of troponins (Fig. 10; Fitzcontraction kinetics for individual flight hugh and Marden, 1997) reveal a matura-
536
J. H. M A R D E N ETAL.
1 40|35£ 30^25
|20J
2 15E 10\
r
i
15 20 25
i
i
i i
30 35 40 45
50
15 20
Temperature (°C)
10
8
E
o
25 30 35 40
45 50
Temperature (°C)
18°C
30°C
Mature
Teneral
38°C
Mature
Teneral
Mature
Teneral
6-
CD
%
4
20-
r
40
80
I
0
'
I
•
40
Time (ms)
I
80
FIG. 8. Twitch contraction kinetics of L. pulchella flight muscle, as characterized by the time to peak tension
(TTP) and time to half-relaxation (THR). Graphs show means (±1 SD) for 5 tenerals and 7 matures. Lower
plots show the time course of isometric tension during representative twitches. Age and temperature are statistically significant factors (P < 0.02 in all cases) affecting variation in TTP, THR, and twitch tension (Fitzhugh
and Marden, 1997).
tional change in the isoform composition of
troponin-t. Other troponins show no apparent maturational change in motility on our
1-D gels, which suggests that they are probably age-invariant (1-D gels have consistently detected isoform shifts in troponins
C and I in previous studies; Martin et al,
1991; Reiser et al, 1992; Sasse et al,
1993).
The change in isoform expression of troponin-t (TnT) provides a strong candidate
for the mechanism underlying the dramatic
change in calcium sensitivity of muscle activation between teneral and mature L. pul-
chella dragonflies. Previous studies of avian
and mammalian striated muscle have shown
that changes in calcium sensitivity are tightly correlated with changes in TnT isoform
expression (Akella et al., 1995; McAuliffe
et al, 1990; Nassar et al, 1991; Potter et
al, 1995; Reiser et al, 1992; Schachat et
al, 1987; Schaertl et al, 1995; Tobacman
and Lee, 1987). Experimental manipulation
of TnT isoform composition in fibers or actomyosin solutions have confirmed that
TnT isoform shifts cause changes in calcium sensitivity of muscle activation (Tobacman, 1988; Wu et al, 1995).
DRAGONFLY MUSCLE MATURATION
537
EMG
Wing
Position
50°
Teneral
EMG
Wing
Position
0.1s
FIG. 9. Simultaneous recordings of EMG activity in a downstroke muscle and wing position (monitored at 1
kHz with a laser distance sensor). Matures employ highly regular trains of single neural stimuli, whereas tenerals
frequently shift between multiple stimuli (first three wingbeats shown here) and single stimuli. Both traces were
GENETIC BASES FOR TROPONIN-T ISOFORM
DIVERSITY
Changes in isoform expression of muscle
proteins are known to occur by either of
two mechanisms; differential expression of
separate genes (i.e., multi-gene families, for
example, myosin heavy chains; Bandman,
1992) or alternative splicing of a single
gene (Andreadis et al., 1987). The latter
mechanism, alternative splicing, is responsible for isoform diversity in TnT. Mammals can potentially produce 64 TnT isoforms from a single gene (Breitbart et al.,
1985), and birds can potentially produce
128 (Smillie et al., 1988), making TnT the
most variable product of a single gene outside of the immune system. Despite this intriguing molecular diversity, the organismlevel significance of alternative splicing of
TnT has not previously been examined (Nadal-Ginard et al., 1991; Malhotra, 1994).
To determine the molecular mechanisms
responsible for TnT isoform shifts in dragonflies, we isolated mRNA from L. pulchella flight muscle and constructed a
mixed-age cDNA library. We then screened
538
ISO
J. H. MARDEN ETAL.
have not yet performed the analyses required to determine age-specific expression
patterns of these splice variants, but from
our protein gels (Fig. 10) and previous studies of vertebrate TnT splicing (Jin and Lin
1989; Jin et al, 1992.), we can predict that
L. pulchella tenerals express TnT isoforms
containing the alternative exons (i.e., the
larger apparent molecular weights on the
gel), whereas matures express TnT in which
the alternative exons are absent.
FUNCTIONAL ATTRIBUTES OF TNT SPLICE
VARIANTS
Activation of striated muscle occurs
when calcium binds with troponin-C, which
in turn causes a conformational change in
the shape and/or position of troponin-I and
tropomyosin, thereby allowing the myosin
Tropoain-C
head to bind to the actin filament and initiate a cross-bridge cycle (Tobacman,
1996). TnT serves to anchor troponins C
and I to tropomyosin, and also plays an important functional role by affecting the molecular cooperativity of calcium activation.
Binding of calcium to a troponin-C molecule can trigger an activated state in 5-6
neighboring troponin complexes; this cooperativity is mediated by the N-terminal reFIG. 10. Silver-stained SDS-PAGE of the contractile gion of TnT (Potter et al, 1995; Schaertl et
protein fraction of L. pulchella flight muscle (Fitzhugh al., 1995). Thus, TnT functions as the
and Marden, 1997). Note the shift in isoform expres"gain" setting in the signal transduction
sion of the calcium regulatory protein troponin T between tenerals (lanes 1, 2) and matures (lanes 3, 4), pathway that activates striated muscle, via
which is confirmed by a Western blot (teneral in lane a mechanism that is presently unknown.
5; mature in lane 6). Bands corresponding to troponins
Previous researchers have invariably apH, I, and C do not change with age. Three separate
blots (TnT; TnC; and a combined Tnl & TnH [which proached the problem of TnT mediated
share an epitope]) have been overlaid digitally to form cooperativity by thinking in terms of molanes 5 and 6. Antibodies used in the Western blot lecular interactions occurring along the
were generously donated by B. Bullard. Numbers on
length of a single thin filament (i.e., the
the left show apparent molecular mass (KDaltons).
"linear lattice model"; Willadsen et al.,
1992; Tobacman, 1996). However, despite
an expression library with TnT antibody in considerable effort, it remains unclear how
order to isolate clones containing the TnT linearly-arranged troponins interact with
gene. To date, we have sequenced 4 TnT each other. Recent electromicroscopy imcDNAs from this library; these contain two ages of insect flight muscle in which the
combinations of 3 alternatively spliced ex- troponin complex was labeled with goldons near the 5' end (Fig. 11; Wolf and Mar- conjugated antibodies (Reedy et al., 1994)
den, in preparation) but are otherwise near- have stimulated us to pose an alternative
ly identical (i.e., these are splice variants model. These micrographs show that trofrom a single gene). These cDNAs show ca. ponin complexes on adjacent thin filaments
70% nucleotide identity with TnT cDNA are arranged in a regular diagonal array
from Drosophila (Fyrberg et al, 1990). We (Fig. 12a), wherein cross-filament interac-
539
DRAGONFLY MUSCLE MATURATION
Nucleotide sequences of 2 cDNA's
with alternatively spliced exons
5"
1
2
3
4
31
5
. .ATGTCGGACGAGGAGGAGTACT. . .AQGAGGAGGAGGAGGTGAAGG
GAGAAAAGGGAGAT.
N- and C-terminal sequences of troponin-T protein
N-terminal
Drosophila
L.
m
10
30
• L
44
4
40
50
60
H3DPEFIKRQDQKRSDIJaX>IKEYTIEWRKQR
Msl )KKK'irQE;h:Kkh:\7K7yTS;K'K'—
340
Drosophila
L pulchella
on
20
4
350
360
370
C-terminal
EEIJAKADEDIVEIIJEEVEEEWEEEDEEDEEDEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
EEEAKAG
ftWKl
n <T .KKt* I •
FIG. 11. Partial sequence data for the L. pulchella troponin-T gene. The upper box shows nucleotide sequences
for the variably spliced region of 2 cDNAs that have a different combination of alternatively spliced exons.
Each sequence shows an invariant region near the 5' end (ATGTCGGACGAGGAGGAGTACT) and in the 3'
direction of the variable region (GAGAAAAGGGAGAT..). Between these invariable regions are combinations
of 3 alternatively spliced exons. The lower box shows an alignment of the N- and C-terminal regions of the
deduced amino acid sequence for TnT protein in L. pulchella and D. melanogaster (Fyrberg et al., 1990).
Alternatively spliced exons are framed by arrows. Note the preponderance of negatively charged residues (E,
D) in the alternatively spliced exons and in the C-terminal.
tions among troponin complexes might be
the avenue for cooperative activation.
A combination of molecular and morphological data from our dragonfly research
supports this model. Teneral isoforms of
TnT carry strong negative charges (glutamic acid residues) at or near each end of the
rod-shaped molecule (Fig. 11); these charge
groups may repel each other and thereby
reduce cooperative interactions among
neighboring TnTs (Fig. 12c), which in turn
reduces calcium sensitivity of muscle activation. Mature isoforms of TnT, lacking the
glutamic acid-rich alternative exons, have
instead an N-terminal that is slightly positive in its net charge. A positively charged
N-terminal could interact with the string of
glutamic acid residues at the C-terminal,
forming head-to-tail charge interactions
among the troponin complexes on adjacent
thin filaments, thereby increasing cooperativity of calcium activation.
This model is supported by ultrastructural changes that accompany the maturational
change in TnT isoform expression. Electron
micrographs of cross-sections of L. pulchella teneral muscle show an irregular spa-
tial arrangement of the myofilaments,
whereas mature muscle shows the nearly
crystaline arrangement typical of mature insect flight muscle (Fig. 12c, d). Expression
of mature isoforms of TnT might be one of
the final steps in myogenesis, wherein adjacent thin filaments are "zipped" together
by charge interactions that also establish the
cooperativity during calcium activation. Interestingly, a recent study has shown that
rod-like synthetic molecules with divergently composed ends (hydrophilic versus
hydrophobic) can self-assemble into structures that are, in certain ways, strikingly
similar to muscle (Stupp et al., 1997). Testing the role of troponin-t splice variants in
the structure-function relationships of insect
muscle is one of the main goals of our ongoing work.
PUTTING THE PIECES TOGETHER TO ARRIVE
AT AN INTEGRATIVE MODEL
Modern biology provides tools to study
organisms at all levels of biological organization, from molecules to ecosystems, yet
relatively few investigators take advantage
of this opportunity. Our study of muscle
540
J. H. MARDEN ET AL.
FIG. 12. A: Electron micrograph (from Reedy et al.,
1994) of Lethocerus flight muscle with gold immunolabeling of TnT. The sarcomere's Z band is at the
bottom of the frame; only the I-band is visible. Note
the diagonal array of troponins on adjacent thin filaments. B: Our hypothesis for head-to-tail charge interactions of TnT molecules on adjacent thin filaments.
C: Electron micrographs of cross-sections of flight
muscle from teneral (left) and mature (right) L. pulchella dragonflies. Each image includes a small portion
of mitochondria and sarcoplasmic reticulum. Compare
the irregular spacing of myofibrils in the teneral versus
the nearly crystalline array of myofibrils in the mature.
Scale bar at bottom center (100 nM) refers to panels
C and D only.
maturation in a dragonfly has begun to integrate the following phenomena: i) molecular-level changes in the isoform composition of a calcium regulatory protein (TnT),
ii) tissue-level changes in muscle ultrastructure and contractile function, iii) organismlevel changes in locomotor mechanics, performance, and efficiency, and iv) ecological
changes in the need for efficient versus
high-performance flight, manifested by
population-level processes of growth, survival, and mating success. In a nutshell, it
appears that alternative splicing of the calcium regulatory protein troponin-T is one
component of a process that changes the
"gearing" muscle contractile function in
accordance with developmental changes in
mechanical loading and the need for economical versus high-performance flight
(Fig. 13).
We have evidence of varying strength for
all of these isolated phenomena (i.e., the
boxes in the diagram; Fig. 13), whereas the
causational linkages between phenomena
(arrows in Fig. 13) are primarily untested
hypotheses that require further experimentation. In many cases we have been able to
make a successful prediction regarding how
variation at one level will affect processes
at another level (i.e., how calcium sensitivity affects twitch contraction kinetics; Fitzhugh and Marden, 1997), however alternate
hypotheses abound (i.e., perhaps the kinetics of calcium release and resequestration
by the SR is age-variable and causes the
changes in twitch contraction kinetics). We
are presently engaged in testing two key
links in the hypothesized chain of causality;
i) the role of TnT protein variants in determining calcium sensitivity of muscle activation (which we plan to test using recombinant troponins to extract and replace native troponins in skinned fibers), and ii) the
importance of matching age-variable contraction kinetics with age-variable contraction frequency (which we are testing by
performing work-loop experiments [Josephson, 1985]).
Developmental and maturational changes
in the form and function of muscle appear
to be ubiquitous in motile organisms. For
example, other hemimetabolous insects
(lacking a pupal stage) show similar maturational changes in flight muscle size, mitochondrial density, contraction kinetics,
and myofilament organization, which are
related to changing functional demands
(Ready and Najm, 1985; Ready, 1986;
Novicki and Josephson, 1987; Novicki,
1989; Stokes et al, 1994). Thus, Libellulid
dragonflies do not possess a novel system
for varying their muscle properties with
age. Rather, they demonstrate how an apparent "developmental constraint" (i.e., an
unavoidable transitional period in muscle
541
DRAGONFLY MUSCLE MATURATION
Understanding muscle physiology
of Libellula pulchella dragonflies
at multiple levels of biological organization
Alternative splicing
of Troponin-t
gene
Changes in
muscle loading
Age-specific
expression of
Tn-t protein
isoforms
Changes
in calcium
release &
uptake?
Changes in
sarcomere
structure
Changes
in calcium
sensitivity
of muscle
activation
Changes in
neural stimulation
andwingbeat
kinematics
Changes in thermal
sensitivity of
flight performance
Changes in maximal
flight performance
Changes in
flight efficiency
and energetics
Changes in kinetics
of force generation
Changes in
amount and vigor
of flight
Changes in
thermoregulation
and the need to
tolerate high
thoracic
temperature
Natural Selection
Selection for
maximum growth rate
in tenerals
Selection for maxium
flight performance in
matures
FIG. 13. An integrative model of locomotor physiology and ecology of Libellulid dragonflies during adult
maturation. We do not mean to imply that alternative splicing of troponin-t is the sole cause of phenomena
observed at higher levels, but rather that it is one factor in what is certainly a much more complex suite of
interactions than is shown here.
development following a change in lifestyle) may actually be used adaptively in
the context of a specific life history.
Broad flexibility in the deployment and
effect of the molecular toolbox that animals
use to generate muscle plasticity is revealed
by comparison of dragonflies with more
distantly related organisms. For example,
the mammalian heart beats at a considerably higher frequency in early life than at
maturity, thus a reverse of the dragonfly
pattern of increasing muscle contraction
frequency with age. Fetal and neonatal
mammals have a different isoform of cardiac TnT than do adults, which causes neonatal cardiac muscle to have a higher calcium sensitivity (Tobacman and Lee, 1987;
McAuliffe et al, 1990; Nassar et al, 1991).
Alternative splicing of mammalian cardiac
TnT follows a pattern that is virtually identical to that of dragonflies, as N-terminal
glutamic acid-rich residues are present in
the fetal/neonatal isoforms but are absent at
maturity (Jin and Lin, 1989; Jin et al,
1992). This would seem to conflict with our
model of cooperativity and calcium sensitivity being determined by head-to-tail
charge interactions, however the C-terminal
of mammalian cardiac TnT lacks the string
of glutamic acids present in insect TnT,
containing instead a weakly positive net
charge. Thus, the head-to-tail charge polarity of mammalian cardiac TnT decreases
during maturation, which in agreement with
542
J. H. MARDEN ETAL.
our model, coincides with a decrease in calcium sensitivity. This comparison of dragonfly and mammalian muscle reveals that
TnT has both conserved and novel elements, which are apparently used to tune
muscle contraction to different patterns of
age-variable mechanical demands, with
dragonflies showing but one variation on a
possibly widespread theme.
Finally, it is worth noting that our curiosity-driven, basic research on dragonfly
muscle may yield information that has
considerable clinical interest. Changes in
TnT expression have been correlated with
human heart failure from dilated cardiomyopathy, primary pulmonary hypertension,
ischaemic heart disease (Townsend et al.,
1995), and diabetes (Hofmann et al.,
1995). Mutations in human cardiac TnT
are responsible for about 15% of all familial hypertrophic cardiomyopathies
(Watkins et al., 1995Z?). Patients with cardiac TnT mutations have a higher incidence of death before age 30 and a significantly higher proportion of sudden death
than those with (3 cardiac myosin heavychain mutations (Watkins et al., 1995a).
Dilated cardiomyopathy has an estimated
prevalence of nearly 40 per 100,000 individuals and is the most common cause of
cardiac transplantation in the U.S. (Durand
et al., 1995). How TnT variable expression
and mutations affect human cardiac pathology is not presently understood. The
important effect may be on sarcomere
structure, or it may be that cardiac muscle
with lower calcium sensitivity accomplishes less stroke work, thus triggering cardiac
hypertrophy (Watkins et al., 1996). By developing an organismal model for assessing the structural and functional effects of
variable TnT expression, we may be able
to contribute in important ways to an understanding and eventual ability to treat
certain forms of heart disease. We raise
this point not for self-promotion, but to explicitly demonstrate once again (mostly for
the sake of those who would question it)
the potential societal benefits of curiositydriven basic research on diverse organisms, and the potential synergism between
basic biology and applied biomedical research.
ACKNOWLEDGMENTS
Thanks to B. Rowan, M. Kramer, T.
Spear, and J. Frisch for their contributions
to collecting the field data. B. Bullard generously provided the anti-troponin antibodies, without which much of this project
would not have been possible. C. Hass provided extensive assistance in cloning, library construction and library screening.
Comments from two anonymous reviewers
greatly improved the manuscript. Supported
by NSF grants IBN-9317969 and IBN9600840.
REFERENCES
Akella, A. B., X.-L. Ding, R. Cheng, and J. Gulati.
1995. Diminished calcium sensitivity of skinned
cardiac muscle contractility coincident with troponin T-band shifts in the diabetic rat. Circ. Res.
76:600-606.
Andreadis, A., M. E. Gallego, and B. Nadal-Ginard.
1987. Generation of protein isoform diversity by
alternative splicinga: Mechanistic and biological
implications. Ann. Rev. Cell Biol. 3:207-242.
Anholt, B. R., J. H. Marden, and D. M. Jenkins. 1991.
Patterns of mass gain and sexual dimorphism in
adult dragonflies (Insecta: Odonata). Can. J. Zool.
69:1156-1163.
Baird, J. M. 1991. Behavioral ecology of foraging in
Pachidiplax longipennis (Odonata, Libellulidae)
(Energetics, agonistic behavior, prey availability).
Ph.D. Diss., Rutgers University.
Bandman, E. 1992. Contractile protein isoforms in
muscle development. Dev. Biol. 154:273-283.
Bartholomew, G. A. 1987. Quotation from group discussion of "Multidisciplinary studies of populations" In M. E. Feder, A. F. Bennett, R. B. Huey,
and W. Burggren (eds.), New directions in ecological physiology, p. 134. Cambridge Univ. Press,
Cambridge.
Bijlsma, R. and V. Loeschcke. 1997. Stress, adaptation, and evolution. Birkhauser Verlag, Basel.
Block, B. A. 1994. Thermogenesis in muscle. Ann.
Rev. Physiol. 56:535-577.
Breitbart, R. E., H. T. Nguyen, R. M. Medford, A. T.
Destree, V. Mahdavi, and B. Nadal-Ginard. 1985.
Intricate combinatorial patterns of exon splicing
generate multiple regulated troponin-t isoforms
from a single gene. Cell 41:67-82.
Cannell, M. B. and D. G. Allen. 1984. Model of calcium movements during activation in the sarcomere of frog skeletal muscle. Biophys. J. 45:913925.
Ellington, C. P. 1991. Limitations on animal flight performance. J. Exp. Biol. 160:71-91.
Feder, M. E. and B. A. Block. 1991. On the future of
physiological ecology. Func. Ecol. 5:136—144.
Fitzhugh, G. H. and J. H. Marden. 1997. Maturational
changes in troponin T expression, calcium sensitivity, and twitch contraction kinetics in dragonfly
DRAGONFLY MUSCLE MATURATION
flight muscle. In revision, J. Exp. Biol. 200:14731482.
Fried, C. S. and M. L. May. 1983. Energy expenditure
and food intake of territorial male Pachydiplax
longipennis (Odonata: Libellulidae). Ecol. Entomol. 8:283-292.
Fyrberg, E., C. C. Fyrberg, C. Beall, and D. L. Saville.
1990. Drosophila melanogaster troponin-T mutations engender three distinct syndromes of myofibrillar abnormalities. J. Mol. Biol. 216:657-675.
Goffeau, A. et al. (15 coauthors) 1996. Life with 6000
genes. Science 274:546-567.
Hochachka, Peter W. 1994. Muscles as molecular and
metabolic machines. CRC Press, Boca Raton.
Hochachka, P. W. and G. N. Somero. 1984. Biochemical adaptation. Princeton University Press.
Hochachka, P. W. and T. P. Mommsen. 1995. Environmental and ecological biochemistry. Elsevier,
New York.
Hofmann, P. A., Menon, and K. E Gannaway. 1995.
Effects of diabetes on isometric tension as a function of [Ca2+] and pH in rat skinned cardiac myocytes. Am J. Physiol. 269: H1656-H1663.
Huey, R. B. and R. D. Stevenson. 1979. Integrating
thermal physiology and ecology of ectotherms: A
discussion of approaches. Araer. Zool. 19:357366.
Jin, J.-P. and J. J.-C. Lin. 1989. Isolation and characterization of cDNA clones encoding embryonic
and adult isoforms of rat cardiac troponin T. J.
Biol. Chem. 264:14471-14477.
Jin, J.-R, Q. Q. Huang, H. I. Yeh, and J. J. Lin. 1992.
Complete nucleotide sequence and structural organization of rat cardiac troponin T gene: A single
gene generates embryonic and adult isoforms via
developmentally regulated alternative splicing. J.
Mol. Biol. 227:269-276.
Josephson, R. K. 1981. Temperature and the mechanical performance of insect flight muscle. In B.
Heinrich (ed.), Insect thermoregulation, pp. 1944. John Wiley & Sons, New York.
Josephson, R. K. 1985. Mechanical power output from
striated muscle during cyclic contraction. J. Exp.
Biol. 114:493-512.
Lehmann, F-O. and M. H. Dickinson. 1997. The
changes in power requirements and muscle efficiency during elevated force production in the
fruit fly, Drosophila melanogaster. J. Exp. Biol.
200:1133-1143.
Malhotra, A. 1994. Role of regulatory proteins (troponin-tropomyosin) in pathologic states. Mol.
Cell. Biochem. 135:43-50.
Marden, J. H. 1987. Maximum lift production during
takeoff in flying animals. J. exp. Biol. 130:235258.
Marden, J. H. 1989. Bodybuilding dragonflies: Costs
and benefits of maximizing flight muscle. Physiol.
Zool. 62:505-521.
Marden, J. H. 1990. Maximum load-lifting and power
output by Harris' Hawks are general functions of
flight muscle mass. J. exp. Biol. 149:511-514.
Marden, J. H. 1995. Large-scale changes in thermal
sensitivity of flight performance during adult mat-
543
uration in a dragonfly. J. exp. Biol. 198:20952102.
Marden, J. H., M. G. Kramer, and J. Frisch. 1996. Agerelated variation in body temperature, thermoregulation and activity in a thermally polymorphic
dragonfly. J. exp. Biol. 199:529-535.
Martin, A. E, K. Ball, L. Gao, P. Kumar, and R. J.
Solaro. 1991. Identification and functional significance of troponin I isoforms in neonatal rat heart
myofibrils. Circ. Res. 69:1244-1252.
McAuliffe, J. I., L. Gao, and R. J. Solaro. 1990.
Changes in myofibrillar activation and troponin C
Ca2+ binding associated with troponin T isoform
switching in developing rabbit heart. Circ. Res.
66:1204-1216.
Nadal-Ginard, B., C. W. Smith, J. G. Patton, and R. E.
Brietbart. 1991. Alternative splicing is an efficient
mechanism for the generation of protein diversity:
Contractile proteins genes as a model system.
Adv. Enz. Regul. 31:261-286.
Nassar, R., N. N. Malouf, M. B. Kelly, A. E. Oakeley,
and P. A. W. Anderson. 1991. Force-pCa relation
and troponin T isoforms of rabbit myocardium.
Circ. Res. 69:1470-1475.
Novicki, A. 1989. Control of growth and ultrastructural maturation of a cricket flight muscle. J. Exper. Zool. 250:263-272.
Novicki, A. and Josephson. 1987. Innervation is necessary for the development of fast contraction kinetics of singing muscles in a katydid. J. Exper.
Zool. 242:309-315.
Pezalla, V. M. 1979. Behavioral ecology of the dragonfly Libellula pulchella Drury (Odonata: Anisoptera). Am. Midi. Nat. 102:1-22.
Potter, J. D., Z. Sheng, B. Pan, and J. Zhao. 1995. A
direct regulatory role for troponin-t and a dual role
for troponin-c in the Ca2+ regulation of muscle
contraction. J. Biol. Chem. 270:2557-2562.
Powers, D. A. and P. M. Schulte. 1996. A molecular
approach to the selectionist/neutralist controversy.
In J. D. Ferraris and S. R. Palumbi (eds.), Molecular zoology: Advances, strategies, and protocols,
pp. 327-352. Wiley-Liss, New York.
Ready, N. E. 1986. Development of fast singing muscles in a katydid. J. Exper. Zool. 238:43-54.
Ready, N. E. and R. E. Najm. 1985. Structural and
functional development of cricket wing muscles.
J. Exper. Zool. 233:35-50.
Reedy, M. C. et al. 1994. Gold/Fab immuno electron
microscopy localization of troponin H and troponin T in Lethocerus flight muscle. J. Mol. Biol.
239:52-67.
Reiser, P. J., M. L. Greaser, and R. L. Moss. 1992.
Developmental changes in troponin T isoform expression and tension production in chicken single
skeletal muscle fibres. J. Physiol. (Lond) 449:573588.
Rome, L. C , D. A. Syme, S. Hollingworth, S. L. Linestedt, and S. M. Baylor. 1996. The whistle and the
rattle: The design of sound producing muscles.
Proc. Natl. Acad. Sci. U.S.A. 93:8095-8100.
Sasse, S., N. J. Brand, P. Kyprianou, G. K. Dhoot, R.
Wade, M. Arai, M. Periasamy, M. H. Yacoub, and
P. J. R. Barton. 1993. Troponin I gene expression
544
J. H. MARDEN ETAL.
during human cardiac development and in endstage heart failure. Circ. Res. 72:932-938.
Schachat, E H., M. S. Diamond, and P. W. Brandt.
1987. Effect of different troponin T-tropomyosin
combinations on thin filament activation. J. Mol.
Biol. 198:551.
Schaertl, S., S. S. Lehrer, and M. A. Geeves. 1995.
Separation and characterization of the two functional regions of troponin involved in muscle thin
filament regulation. Biochem. 34:15890-15894.
Smillie, L. B., K. Golosinska, and F. C. Reinach. 1988.
Sequences of complete cDNAs encoding four variants of chicken skeletal muscle troponin T. J.
Biol. Chem. 263:18816-18820.
Stokes, D. R., J. G. Malamud, and D. A. Schreihofer.
1994. Gender specific developmental transformation of a cockroach bifunctional muscle. J. Exper.
Zool. 268:364-376.
Stupp, S. I., V. LeBonheur, K. Walker, L. S. Li, K. E.
Huggins, M. Keser, and A. Amstutz. 1997. Supramolecular materials: Self-organized nanostructures. Science 276, 384-389.
Tobacman, L. S. 1996. thin filament-mediated regulation of cardiac contraction. Annu. Rev. Physiol.
58:447-481.
Tobacman, L. S. 1988. Structure-function studies of
the amino-terminal region of bovine cardiac troponin T. J. Biol. Chem. 263:2668-2672.
Tobacman, L. S. and R. Lee. 1987. Isolation and functional comparison of bovine cardiac troponin-t
isoforms. J. Biol. Chem. 262:4059-4064.
Townsend, P. J., P. J. Barton, M. H. Yacoub, and H.
Farza. 1995. Molecular cloning of human cardiac
troponin T isoforms: Expression in developing
and failing heart. J. Mol. Cardiol. 27:2223-2236.
Tsugorka, A., E. Rios, and L. A. Blatter. 1995. Imaging
elementary events of calcium release in skeletal
muscle cells. Science 269:1723-1726.
Watkins, H., W. J. McKenna, L. Thierfelder, H. J. Suk,
R. Anan, A. O'Donoghue, P. Spirito, A. Matsumori, C. S. Moravec and J. G. Seidman. 1995a.
Mutations in the genes for cardiac troponin T and
alpha-tropomyosin in hypertrophic cardiomyopathy. N. Engl. J. Med. 332: 1058-1064.
Watkins, H., J. G. Seidman, and C. E. Seidman. 19956.
Familial hypertrophic cardiomyopathy: A genetic
model of cardiac hypertrophy. Hum. Mol. Genet.
4: 1721-1727.
Watkins, H., C. Seidman, J. G. Seidman, H. S. Feng,
and H. L. Sweeney. 1996. Expression and functional assessment of a truncated cardiac troponin
T that causes hypertrophic cardiomyopathy. J.
Clinical Invest. 98:2456-2461.
Weissenbach, J. 1996. Landing on the genome. Science 274:479.
Willadsen, K. A., C. A. Butters, L. E. Hill, and L. S.
Tobacman. 1992. Effects of the Amino-terminal
regions of tropomyosin and troponin T on thin
filament assembly. J. Biol. Chem. 267:2374623752.
Wu, Q.L., P. K. Jha, Y. Du, P. C. Leavis, and S. Sarkar.
1995. Overproduction and rapid purification of
human fast skeletal beta troponin T using E. coli
expression vectors: Functional differences between the alpha and beta isoforms. Gene 155:225—
230.