Download 1st Sem Bio Study Guide

First Semester Biology Study Guide
Introduction to Biology, Chemistry, Ecology, Cells, Nucleic Acids, Protein Synthesis and Genetics
1.
2.
3.
4.
5.
6.
What are the steps of the scientific method?
What are the rules associated with setting up a controlled experiment?
What is the difference between a hypothesis and a scientific theory?
What is biology?
What are the characteristics of life?
What is homeostasis?
Using the periodic table below, be able to answer the next two questions.
7. How many protons do the following atoms have in their nuclei: magnesium (Mg) gold (Au) and carbon
(C).
8. How many neutrons are in the nucleus of a lead (Pb) atom? Neon?
9. What is the difference between atomic number and atomic mass?
10. What is the difference between a solution, a solute and a solvent?
11. What is the pH scale, what’s acidic, neutral, and basic?
12. What are some special properties of water?
13. What is the HONC rule?
14. Explain the difference between organic and inorganic compounds.
15. What are the functions and structures of each of the following organic compounds: carbohydrates,
fats, proteins and nucleic acids? (be detailed)
16. What are enzymes? Explain some characteristics of enzymes.
17. Contrast the way energy and matter move through the biosphere.
18. How is energy transferred from one trophic level to the next in a food chain or energy pyramid?
19. What is succession? What are the two types? In which one do you find lichen as the pioneer species?
20. What are some biotic and abiotic factors in an ecosystem?
21. Describe the main parts of the carbon cycle, nitrogen cycle and the water cycle (terms associated with
the steps).
22. Describe how bacteria play a role in plants acquiring nitrogen.
1
23. If aquatic ecosystem receive a sudden influx of a limiting nutrient, name what occurs and describe
what happens.
24. Define the ecological terms: niche, biosphere, species, habitat, community, and population.
25. Describe the three different types of symbiotic relationships and give an example of each.
26. On the diagram below label the producers, herbivores, primary carnivores, secondary carnivores and
tertiary carnivores.
27. Describe the two types of population growth and under what conditions they occur.
28. Identify and understand the labeled components on the graph below. Define carrying capacity.
29. Draw a graph showing how predators and prey species affect each other.
30. What is biological magnification? Explain how DDT can be magnified in marine organisms.
31. Describe how human population has grown throughout most of history and how the Industrial
Revolution impacted it. How is human population growing today?
32. Describe some major environmental consequences of the presence of humans on our planet (think
land, water, air, etc.).
33. Know the differences between the terms CFCs, ozone, smog, and acid rain.
34. Describe biodiversity and why it is important.
35. Describe global climate change. What are the expectations of the changes that will occur in the near
future?
36. Label the parts of a microscope above and know the rules on how to use them.
37. What is field of view on a microscope?
2
38. How do you calculate total magnification?
39. What is cell theory?
40. What are the differences between prokaryotic and eukaryotic cells?
41. What are the differences between plant and animal cells?
42. Identify the labeled parts of the cell below and describe the functions of each labeled structure.
(Name and explain the job of each part.)
43. Identify the label structures on the diagram below.
44. What is the structure illustrated above and what is its function?
45. What is a phospholipid bilayer?
46. Explain the difference between osmosis and diffusion.
47. Define the terms isotonic, hypertonic and hypotonic.
48. Give an example of isotonic, hypertonic, and hypotonic solutions and which direction water will move
through a membrane.
49. Define active transport and what is required for it to happen?
50. What is the principle source of energy for all living things on our planet?
51. What is ATP and why is it important?
52. How is energy released and stored using ADP and ATP?
53. Write out the equations for photosynthesis and cellular respiration. Identify the reactants and
products for each equation.
54. Where does photosynthesis and cellular respiration occur?
55. How are aerobic respiration and anaerobic respiration different? Which produces more energy per
glucose molecule? What are the two types of anaerobic respiration called?
56. What organisms undergo photosynthesis? Cellular respiration?
57. How does CO2, water, temperature, and light intensity affect the rate of photosynthesis?
58. Draw and know what is happening at each stage of mitosis in order.
59. What are the differences between mitosis and meiosis?
60. If starting with one diploid cell, meiosis results in how many cells and of what genetic relationship?
61. What are homologous chromosomes?
3
62. What is the purpose of meiosis?
63. What is the difference between haploid and diploid?
64. Describe at least 3 important differences between meiosis and mitosis.
65. Why is crossing-over so important and when does it occur?
66. Who are Watson, Crick and Franklin, Mendel, and Schleiden and Schwann?
67. Draw and label the different parts of DNA.
68. What are Chargaff’s base pairing rules for DNA?
69. What are the differences between DNA and RNA?
70. What is a gene?
71. During protein synthesis, how does a ribosome know where to start and stop reading mRNA?
72. Using the chart of codons below, translate the mRNA into a polypeptide chain (a protein).
AUGGGCAAGCUAGCCUGUUAA
73. Describe examples of gene and chromosome mutations.
74. Explain why even though all your cells have the same DNA, there are different cell types with different
jobs.
4