Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
DNA Computer Review I. Mitosis vs Meiosis a. Go to http://www.pbs.org/wgbh/nova/miracle/divide.html b. Click on “Go to mitosis vs. meiosis” c. Define: i. Centrioles; ii. Spindle Fibers d. Work through the animation and fill in the chart: Mitosis Meiosis Where does it occur Starts with Ends with Chromosome # (beginning vs end) Genetic Variation? e. Looking at the full processes, how does meiosis look different than mitosis? II. DNA Structure/Replication a. Go to http://library.med.utah.edu/NetBiochem/pupyr/pp.htm b. What are the 3 parts of a nucleotide? ______________________________ c. Which of the 4 nitrogen bases are purines? Pyrimidines? d. Adenine bonds with? ____________ Cytosine bonds with? ______ e. What holds the nitrogen bases together? f. Go to http://nobelprize.org/educational_games/medicine/dna_double_helix/ g. Click on “Play the DNA-doube heix game” h. What needs to happen first for DNA replication to occur? i. When does DNA replication occur? j. Give the complementary DNA strand for the following: ATCACTGGACTGACTGACCC III. DNA vs RNA a. Go to http://academic.brooklyn.cuny.edu/biology/bio4fv/page/molecular%20biology/dnastructure.html b. Go to http://www.accessexcellence.org/RC/VL/GG/rna2.php c. List 3-4 differences that DNA and RNA have d. Go to http://library.thinkquest.org/04apr/00217/en/biology/rna/index.html e. List the function of each type of RNA i. mRNA ii. tRNA iii. rRNA IV. Replication vs Transcription a. Go to http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/dna_replication.htm b. Go to http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/transcription.htm V. Transcription a. Go to http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html b. What happens during transcription? ______________________________ ____________________________________________________________ c. Where does transcription occur? d. Transcribe the following DNA strand: ATCGATTTGCAACCAGGAAG VI. Translation a. Go to http://www.courses.fas.harvard.edu/~biotext/animations/TRANSLATE20b.swf b. What do tRNA’s do? c. What part of the tRNA binds to the codons of the mRNA? d. Go to http://learn.genetics.utah.edu/content/begin/dna/transcribe/ e. Go to http://www.biostudio.com/demo_freeman_protein_synthesis.htm f. Go to http://library.thinkquest.org/20465/g_DNATranscription.html g. Go to http://www.wisc-online.com/objects/index_tj.asp?objID=AP1302 h. Give the following information based on this DNA strand: DNA: TAC-GGG-CAT-CGC-AAC-ACG-TTA-TAG-ATT i. mRNA: ii. tRNA’s: iii. protein: i. What type of bond holds amino acids together in a protein? j. Where does translation occur? VII. Mutations a. Go to http://highered.mcgrawhill.com/sites/0072556781/student_view0/chapter11/animation_quiz_3.html b. Go to http://highered.mcgrawhill.com/sites/0072556781/student_view0/chapter11/animation_quiz_4.html c. Go to http://staff.jccc.net/PDECELL/evolution/mutations/mutation.html d. Define the following: i. Missense mutations: ii. Nonsense mutations: iii. Silent mutations: iv. Substitution mutations: v. Frameshift mutations: vi. Translocations: