AGO1-IP approach to small RNA target discovery in Arabidopsis
... nature of this mutation, as null alleles are embryonic-lethal. Use of conditional, as opposed to constitutive, expression of VSRs is thus an anticipated refinement of the method that might lead to much more tractable effects on target gene accumulation. The scope of the method might also be further ...
... nature of this mutation, as null alleles are embryonic-lethal. Use of conditional, as opposed to constitutive, expression of VSRs is thus an anticipated refinement of the method that might lead to much more tractable effects on target gene accumulation. The scope of the method might also be further ...
RNA Structure
... to a theory of how DNA codes for proteins. It took a few years to determine that the bases spell threeletter “words” called codons ...
... to a theory of how DNA codes for proteins. It took a few years to determine that the bases spell threeletter “words” called codons ...
Protein Synthesis (B7)
... What is the connection between DNA and protein? • Remember: DNA can’t leave the nucleus but protein synthesis occurs in the cytoplasm … How? • protein message must be carried from the nucleus cytoplasm ribosomes ...
... What is the connection between DNA and protein? • Remember: DNA can’t leave the nucleus but protein synthesis occurs in the cytoplasm … How? • protein message must be carried from the nucleus cytoplasm ribosomes ...
PROTEIN SYNTHESIS
... Takes place in the nucleus Part of DNA strand unzips mRNA nucleotides attach to DNA strand, forming a complementary strand (enzyme – RNA polymerase) mRNA detaches from the DNA strand DNA zips back together mRNA can now carry the instructions out of the nucleus ...
... Takes place in the nucleus Part of DNA strand unzips mRNA nucleotides attach to DNA strand, forming a complementary strand (enzyme – RNA polymerase) mRNA detaches from the DNA strand DNA zips back together mRNA can now carry the instructions out of the nucleus ...
RNA Tertiary Structure
... hnRNA - heterogeneous nuclear precursors & intermediates of mature mRNAs & other RNAs ...
... hnRNA - heterogeneous nuclear precursors & intermediates of mature mRNAs & other RNAs ...
Protein Synthesis
... The operator is the on/off switch The operon is a set of genes that code for enzymes involved in the same function RNA polymerase attached to DNA at the promoter and begins to transcribe It will continue until it reaches the repressor, a protein that binds the operator and blocks RNA polymer ...
... The operator is the on/off switch The operon is a set of genes that code for enzymes involved in the same function RNA polymerase attached to DNA at the promoter and begins to transcribe It will continue until it reaches the repressor, a protein that binds the operator and blocks RNA polymer ...
The Central Dogma of Biology states that DNA codes for RNA, and
... As polymerases passes over the strand the mRNA peels away and the DNA helix reforms. ...
... As polymerases passes over the strand the mRNA peels away and the DNA helix reforms. ...
Biogenesis of trans-acting siRNAs, endogenous
... generated by miR390 or 22 nt miRNA-containing RISCs is important for subsequent steps. The 5′ and 3′ miR173cleaved fragments accumulate more in the rdr6 mutant than in wild-type, while the 3′ fragments disappear and the 5′ fragments decrease in the sgs3 rdr6 double mutant similar to the sgs3 mutant ...
... generated by miR390 or 22 nt miRNA-containing RISCs is important for subsequent steps. The 5′ and 3′ miR173cleaved fragments accumulate more in the rdr6 mutant than in wild-type, while the 3′ fragments disappear and the 5′ fragments decrease in the sgs3 rdr6 double mutant similar to the sgs3 mutant ...
MicroRNAs as Oncogenes and Tumor Suppressors
... the RNase III endonuclease Drosha and its partner Pasha, a homologue of the human DiGeorge syndrome critical region gene 8 (DGCR8). The pre-microRNAs are then actively transported into the cytoplasm by exportin 5 and Ran-GTP and further processed into small RNA duplexes of approximately 22 nucleotid ...
... the RNase III endonuclease Drosha and its partner Pasha, a homologue of the human DiGeorge syndrome critical region gene 8 (DGCR8). The pre-microRNAs are then actively transported into the cytoplasm by exportin 5 and Ran-GTP and further processed into small RNA duplexes of approximately 22 nucleotid ...
Human microRNA target analysis and gene ontology clustering by
... microRNAS (miRNAs) are 20- to 23- nucleotide long single stranded RNAs that post-transcriptionally regulate gene expression [1,2]. miRNAs act as translation inhibitors of mRNA into protein and promote mRNA degradation. In this way, miRNAs play important role in various cell processes such as prolife ...
... microRNAS (miRNAs) are 20- to 23- nucleotide long single stranded RNAs that post-transcriptionally regulate gene expression [1,2]. miRNAs act as translation inhibitors of mRNA into protein and promote mRNA degradation. In this way, miRNAs play important role in various cell processes such as prolife ...
File
... A string of ribosomes carrying out multiple translation on the same mRNA strand is called a polyribosome ...
... A string of ribosomes carrying out multiple translation on the same mRNA strand is called a polyribosome ...
71071_Protein_synthesis
... the nucleus into the cytoplasm of the cell where it finds a ribosome • The ribosome is made of RNA and it will serve as a work bench for making proteins ...
... the nucleus into the cytoplasm of the cell where it finds a ribosome • The ribosome is made of RNA and it will serve as a work bench for making proteins ...
Unfinished Material - Answer Key
... What is RNA interference and what happens during this process? - RNA interference is a form of gene regulation that directly prevents mRNA from undergoing translation. - RNA polymerase is going to transcribe genes that code for RNAs that double back on themselves to form a hairpin structure. - The d ...
... What is RNA interference and what happens during this process? - RNA interference is a form of gene regulation that directly prevents mRNA from undergoing translation. - RNA polymerase is going to transcribe genes that code for RNAs that double back on themselves to form a hairpin structure. - The d ...
Gene Expression
... Transcription occurs in the cell's nucleus. RNA polymerase is the protein molecule that reads the DNA and creates the RNA intermediary. Transcription requires: DNA, RNA polymerase, ribonucleotides, and some ATP for energy. Uracil (U) is substituted for thymine (T) in RNA. Transcription initiation is ...
... Transcription occurs in the cell's nucleus. RNA polymerase is the protein molecule that reads the DNA and creates the RNA intermediary. Transcription requires: DNA, RNA polymerase, ribonucleotides, and some ATP for energy. Uracil (U) is substituted for thymine (T) in RNA. Transcription initiation is ...
Lecture 18
... iv. All of DNA is double stranded v. RNA can be double or single stranded vi. Evidence for model that RNA precedes DNA 1. RNA involved in synthesis of both itself and DNA 2. DNA cannot synthesize itself, it only provides the encoding 3. Diagram of templates 4. RNA ubiquitous in all DNA functions 5. ...
... iv. All of DNA is double stranded v. RNA can be double or single stranded vi. Evidence for model that RNA precedes DNA 1. RNA involved in synthesis of both itself and DNA 2. DNA cannot synthesize itself, it only provides the encoding 3. Diagram of templates 4. RNA ubiquitous in all DNA functions 5. ...
Methods S1.
... manufacturers’ instructions. The oligonucleotide primers used for LEP were 5’TTCTTGTGGCTTTGGCCCTA-3’ and 5’GGAGACTGACTGCGTGTGTG TGAA-3’, for MMP13 were 5'-CGCCAGAAGAATCTGTCTTTAAA-3', and 5'CCAAATTATGGAGGAGATGC-3', for IL1B were 5’-CAACCAACAAGTGAT ATTCTCCATG-3’ and 5’-GATCCACACTCTCCAGCTGCA-3’, for BM ...
... manufacturers’ instructions. The oligonucleotide primers used for LEP were 5’TTCTTGTGGCTTTGGCCCTA-3’ and 5’GGAGACTGACTGCGTGTGTG TGAA-3’, for MMP13 were 5'-CGCCAGAAGAATCTGTCTTTAAA-3', and 5'CCAAATTATGGAGGAGATGC-3', for IL1B were 5’-CAACCAACAAGTGAT ATTCTCCATG-3’ and 5’-GATCCACACTCTCCAGCTGCA-3’, for BM ...
RNA AND PROTEIN SYNTHESIS
... Intron - the waste segment of the mRNA that will be eliminated from the final strand. They don’t code for any part of the protein. Exon - the segment of the mRNA that will be included in final mRNA message sent to the ribosome. DISCUSS THE FOLLOWING: RNA: Discuss the structure of RNA. Include all th ...
... Intron - the waste segment of the mRNA that will be eliminated from the final strand. They don’t code for any part of the protein. Exon - the segment of the mRNA that will be included in final mRNA message sent to the ribosome. DISCUSS THE FOLLOWING: RNA: Discuss the structure of RNA. Include all th ...
Control of Gene Expression Control of Gene Expression Regulatory
... • Methylation (the addition of –CH3 to DNA or histone proteins) is associated with the control of gene expression. • Clusters of methylated cytosine nucleotides bind to a protein that prevents activators from binding to DNA. • Methylated histone proteins are associated with inactive regions of chrom ...
... • Methylation (the addition of –CH3 to DNA or histone proteins) is associated with the control of gene expression. • Clusters of methylated cytosine nucleotides bind to a protein that prevents activators from binding to DNA. • Methylated histone proteins are associated with inactive regions of chrom ...
DNA-binding motifs
... Eukaryotic Regulation • Controlling the expression of eukaryotic genes requires transcription factors. – general transcription factors are required for transcription initiation • required for proper binding of RNA polymerase to the DNA – specific transcription factors increase transcription in cert ...
... Eukaryotic Regulation • Controlling the expression of eukaryotic genes requires transcription factors. – general transcription factors are required for transcription initiation • required for proper binding of RNA polymerase to the DNA – specific transcription factors increase transcription in cert ...
Control of Gene Expression
... Eukaryotic Regulation • Controlling the expression of eukaryotic genes requires transcription factors. – general transcription factors are required for transcription initiation • required for proper binding of RNA polymerase to the DNA – specific transcription factors increase transcription in cert ...
... Eukaryotic Regulation • Controlling the expression of eukaryotic genes requires transcription factors. – general transcription factors are required for transcription initiation • required for proper binding of RNA polymerase to the DNA – specific transcription factors increase transcription in cert ...
Section 1.5 Name:
... ii. Also, RNA does not have thymine, instead it has the pyrimidine of _______________ iii. RNA is only a _________________ strand -‐ DNA is a double strand b. Types of RNA i. _____________________ RNA – ...
... ii. Also, RNA does not have thymine, instead it has the pyrimidine of _______________ iii. RNA is only a _________________ strand -‐ DNA is a double strand b. Types of RNA i. _____________________ RNA – ...
MicroRNA
A micro RNA (abbreviated miRNA) is a small non-coding RNA molecule (containing about 22 nucleotides) found in plants, animals, and some viruses, which functions in RNA silencing and post-transcriptional regulation of gene expression.Encoded by eukaryotic nuclear DNA in plants and animals and by viral DNA in certain viruses whose genome is based on DNA, miRNAs function via base-pairing with complementary sequences within mRNA molecules. As a result, these mRNA molecules are silenced by one or more of the following processes: 1) cleavage of the mRNA strand into two pieces, 2) destabilization of the mRNA through shortening of its poly(A) tail, and 3) less efficient translation of the mRNA into proteins by ribosomes. miRNAs resemble the small interfering RNAs (siRNAs) of the RNA interference (RNAi) pathway, except miRNAs derive from regions of RNA transcripts that fold back on themselves to form short hairpins, whereas siRNAs derive from longer regions of double-stranded RNA. The human genome may encode over 1000 miRNAs, which are abundant in many mammalian cell types and appear to target about 60% of the genes of humans and other mammals.miRNAs are well conserved in both plants and animals, and are thought to be a vital and evolutionarily ancient component of genetic regulation. While core components of the microRNA pathway are conserved between plants and animals, miRNA repertoires in the two kingdoms appear to have emerged independently with different primary modes of action. Plant miRNAs usually have near-perfect pairing with their mRNA targets, which induces gene repression through cleavage of the target transcripts. In contrast, animal miRNAs are able to recognize their target mRNAs by using as little as 6–8 nucleotides (the seed region) at the 5' end of the miRNA, which is not enough pairing to induce cleavage of the target mRNAs. Combinatorial regulation is a feature of miRNA regulation in animals. A given miRNA may have hundreds of different mRNA targets, and a given target might be regulated by multiple miRNAs.The first miRNA was discovered in the early 1990s. However, miRNAs were not recognized as a distinct class of biological regulators until the early 2000s. Since then, miRNA research has revealed different sets of miRNAs expressed in different cell types and tissuesand has revealed multiple roles for miRNAs in plant and animal development and in many other biological processes. Aberrant expression of miRNAs has been implicated in numerous disease states, and miRNA-based therapies are under investigation.Estimates of the average number of unique messenger RNAs that are targets for repression by a typical microRNA vary, depending on the method used to make the estimate, but several approaches show that mammalian miRNAs can have many unique targets. For example, an analysis of the miRNAs highly conserved in vertebrate animals shows that each of these miRNAs has, on average, roughly 400 conserved targets. Likewise, experiments show that a single miRNA can reduce the stability of hundreds of unique messenger RNAs, and other experiments show that a single miRNA may repress the production of hundreds of proteins, but that this repression often is relatively mild (less than 2-fold).