• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Epigenetic Regulation ofbdnfGene Transcription in the
Epigenetic Regulation ofbdnfGene Transcription in the

... Long-term memory formation requires selective changes in gene expression. Here, we determined the contribution of chromatin remodeling to learning-induced changes in brain-derived neurotrophic factor (bdnf) gene expression in the adult hippocampus. Contextual fear learning induced differential regul ...
Introduction to Genetics
Introduction to Genetics

... had first been located in 1979; however, because of secrecy surrounding the tsar’s execution, the location of the graves was not made public until the breakup of the Soviet government in 1989. The skeletons were eventually recovered and examined by a team of forensic anthropologists, who concluded t ...
Transcriptomic and Reverse Genetic Analyses of Branched
Transcriptomic and Reverse Genetic Analyses of Branched

... have taken a comparative genomic approach to identify critical enzymatic steps followed by gene silencing and metabolite analysis in S. pennellii and Nicotiana benthamiana. Our study verified the existence of distinct mechanisms of acyl sugar synthesis in Solanaceae. From microarray analyses, genes ...
Exam Questions from Exam 1 – Basic Genetic Tests
Exam Questions from Exam 1 – Basic Genetic Tests

... Next you isolate a mutant strain of yeast that cannot grow on medium lacking leucine. This strain contains a single mutation you call leu1–. The leu1– mutation is near to drk1– on the same chromosome. When the leu1– mutant is mated to wild-type yeast, the resulting diploids cannot grow on medium lac ...
Characterisation of interstitial duplications and triplications of
Characterisation of interstitial duplications and triplications of

... their abnormal phenotypes. FISH and/or PCR analysis also showed that, in all cases, the duplications and triplications involved the PWACR and were not pseudogene expansions. Retrospective cytogenetic analysis in families 7 and 13 did not identify these duplications clearly. The size of the pericentr ...
The DUET gene is necessary for chromosome
The DUET gene is necessary for chromosome

... There is limited information on the control of meiotic progression in plants. Arabidopsis mutants that affect meiotic progression have been described (Siddiqi et al., 2000; Magnard et al., 2001) and several genes have also been characterized at the molecular level. The ASK1 gene is required for homo ...
14 Chromosomes
14 Chromosomes

... The members of each matching pair of chromosomes, such as the two number-5 chromosomes, are said to be homologous. Nonmatching chromosomes, such as a number-5 chromosome and a number-14 chromosome are said to be nonhomologous. nonhomologous At a particular location along its length, each chromosome ...
Glutathione production by efficient ATP
Glutathione production by efficient ATP

... Collection made it possible to identify, on a genome-wide basis, the genes involved in ATP generation in E. coli (Hara et al., 2009). As a result, the deletion of genes, identified as suppressors of ATP generation, caused an increase in the rate of cellular ATP synthetic activity. These results are ...
Creative Activities in Music – A Genome
Creative Activities in Music – A Genome

... genetic predispositions but they may also share some common features [8]. Compositional processes have been studied, and composition research has been based on various theoretical foundations (for a review, see Pohjannoro [9]). However, to our knowledge there are no widely used tests to measure comp ...
Genetic Polymorphisms of Cytochromes P450: CYP2C9, CYP2C19
Genetic Polymorphisms of Cytochromes P450: CYP2C9, CYP2C19

... be performed to allow a 99% sensitive prediction of poor or ultrarapid metabolizers in the clinical routine. The polymorphism in CYP2C family is important because these enzymes act on some very important drugs: anticonvulsants, antidiabetics, anticoagulants, antidepressants, antimalarial, nonsteroid ...
Pathways to abscisic acid-regulated gene expression
Pathways to abscisic acid-regulated gene expression

... studies. What emerges is a cell-biological model of overlapping tissue-specific stress (e.g. drought, salt and cold) and developmental (e.g. sugars and other hormones) response pathways that integrate into responses mediated by ABA, including but not limited to seed maturation, dormancy, inhibition ...
My Genetics project
My Genetics project

... one gene. In 7th grade, we are not required to talk about concepts such as incomplete dominance, codominance, and polygenic traits, but they are pretty interesting. All traits that involve color and pigment are polygenic and quite complicated. However, we thought you would want to estimate the skin, ...
Association of KCNQ1, KCNE1, KCNH2 and SCN5A Polymorphisms
Association of KCNQ1, KCNE1, KCNH2 and SCN5A Polymorphisms

... frequent in the group of subjects with the longest QTc, which confirm the initial association described in a German population18. We found that allele SCN5A IVS24+116 A was more frequent in the group of subjects with the shortest QTc. In the initial study, Aydin et al (2005) reported an association ...
De novo mutations in human genetic disease
De novo mutations in human genetic disease

... whole-genome sequencing studies have shown that, on average, 74 germ­line single-nucleotide variants (SNVs) occur de novo in an individual’s genome2, a number that is remarkably close to estimates from the pre-genomesequencing era3,4. However, considerable technological improvements are required to ...
Trichothiodystrophy: Update on the sulfur
Trichothiodystrophy: Update on the sulfur

... cancers in patients with TTD has been observed. Genetically, 3 complementation groups have been characterized among photosensitive patients with TTD. Most patients exhibit mutations on the two alleles of the XPD gene. Rarely, mutated XPB gene or an unidentified TTD-A gene may result in TTD. In UVsen ...
Distortion of quantitative genomic and expression
Distortion of quantitative genomic and expression

... regarding reproducibility of these techniques have been raised by cross-validation studies in different laboratories (1–5). Strategies to mitigate variability in the results obtained from replicate studies have focused on standardizing technical factors, such as array production, RNA synthesis, labe ...
Mycoplasma genitalium: a brief review
Mycoplasma genitalium: a brief review

... (816 kb), it has been shown that M. genitalium contains some subsets of M. pneumoniae’s genomic complement and that the coding genes in the M. genitalium genome correspond to certain sequences of M. pneumoniae’s genome.14 The small genome of M. genitalium gives a good indication of the minimal set o ...
X-Chromosome dosage compensation
X-Chromosome dosage compensation

... 2. Genes encoding the dosage compensation machinery In C. elegans, the processes of dosage compensation and sex determination are coordinately regulated by a group of genes that respond to the primary sex-determination signal. Following this common step of regulation, sex determination and dosage co ...
Design considerations for highly specific and efficient
Design considerations for highly specific and efficient

... complexes targeting the coding region of the VCP gene. EGFP fluorescence was measured 72 hours post- transfection; an increase in EGFP fluorescence indicates functional knockout of the VCP gene resulting in disruption of proteasome function. crRNAs in different exons are indicated by the different c ...
Help Me Understand Genetics
Help Me Understand Genetics

... Ribosomes are organelles that process the cell’s genetic instructions to create proteins. These organelles can float freely in the cytoplasm or be connected to the endoplasmic reticulum (see above). For more information about cells: The Genetic Science Learning Center at the University of Utah offer ...
Genetic analysis of the floral initiation process (FLIP) in Arabidopsis
Genetic analysis of the floral initiation process (FLIP) in Arabidopsis

... 3° depending on their origin, as described in the text. = rosette leaf; = inflorescence leaf; = inflorescence shoot (1° or 2°); = flower. ...
Base-pair neutral homozygotes can be discriminated by calibrated
Base-pair neutral homozygotes can be discriminated by calibrated

... ATATATATAAATATAATA-C3-30 . The sequence of the high calibrator was 50 -GCGCGGCCGGCACTGACC CGAGACTCTGAGCGGCTGCTGGAGGTGCGGAA GCGGAGGGGCGGG-C3-30 . These oligonucleotides, and their reverse complements, were included at 0.05 mM in each amplification reaction. Importantly, all calibrators were blocked on ...
Table 3 - HAL Descartes
Table 3 - HAL Descartes

... screen for SOX10 gene deletions. Briefly, the 3 coding exons of the SOX10 gene, exon 4 of POLR2F and 4 regions located 5’ of SOX10 were amplified in two multiplex reactions. The beginning of exon 3 and the middle of the exon 5 coding sequences are not covered by the amplicons, however a deletion res ...
Slide 1
Slide 1

... – Both a man and a woman are heterozygous for freckles. Freckles are dominant over no freckles. What is the chance that their child will have freckles? – Both you and your sibling have attached ear lobes, but your parents have unattached lobes. Unattached earlobes (E) are dominant over attached (e). ...
Idic(15)
Idic(15)

... a third of those who took part in the Unique survey suffered from constipation although most children outgrew it (Unique). Many older babies and toddlers with idic(15) have trouble chewing and can choke or gag on lumps in food so may continue to eat puréed food for longer than their peers and the s ...
< 1 ... 20 21 22 23 24 25 26 27 28 ... 1482 >

Gene



A gene is a locus (or region) of DNA that encodes a functional RNA or protein product, and is the molecular unit of heredity. The transmission of genes to an organism's offspring is the basis of the inheritance of phenotypic traits. Most biological traits are under the influence of polygenes (many different genes) as well as the gene–environment interactions. Some genetic traits are instantly visible, such as eye colour or number of limbs, and some are not, such as blood type, risk for specific diseases, or the thousands of basic biochemical processes that comprise life.Genes can acquire mutations in their sequence, leading to different variants, known as alleles, in the population. These alleles encode slightly different versions of a protein, which cause different phenotype traits. Colloquial usage of the term ""having a gene"" (e.g., ""good genes,"" ""hair colour gene"") typically refers to having a different allele of the gene. Genes evolve due to natural selection or survival of the fittest of the alleles.The concept of a gene continues to be refined as new phenomena are discovered. For example, regulatory regions of a gene can be far removed from its coding regions, and coding regions can be split into several exons. Some viruses store their genome in RNA instead of DNA and some gene products are functional non-coding RNAs. Therefore, a broad, modern working definition of a gene is any discrete locus of heritable, genomic sequence which affect an organism's traits by being expressed as a functional product or by regulation of gene expression.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report