• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Morbidity and Mortality Weekly Report
Morbidity and Mortality Weekly Report

... virus had been documented in 47 states and the District of Columbia (1,2). In addition, the virus had spread to 41 countries (3), with a total of 4,774 cases reported in countries outside the United States. Because producing a novel influenza A (H1N1) virus vaccine will take several months (4), dete ...
Weekly issue 1 - Eurosurveillance
Weekly issue 1 - Eurosurveillance

... seasonal influenza vaccine, A/California/7/2009. Only minor genetic drift has been noted in influenza A(H1N1)2009 viruses circulating in 2010 compared with the earliest isolates in April 2009, and this observed genetic diversity has been consistent with expected patterns of virus evolution (Figure 3 ...
PDF - Prairie Swine Centre
PDF - Prairie Swine Centre

... lamb and pig kidney monolayer tissue cultures (Sutmoller et al., 1968; McVicar and Sutmoller, 1976, 1969; Bouma et al., 2004; Brown et al., 1992, 1996) and bovine thyroid monolayer (BTY) tissue cultures, which from 1981 onwards were used in the majority of experiments. BTY cultures had been found to ...
PRRS Virus – What Happens After a Pig Becomes Infected with
PRRS Virus – What Happens After a Pig Becomes Infected with

... Factors of undetermined significance in virus shedding and persistence Hypothetically, several factors could alter virus shedding and persistence patterns and, thereby, affect the epidemiology of PRRS virus by changing transmission parameters. The most obvious of these is immunity from prior exposur ...
Home Care Manual - 2008
Home Care Manual - 2008

... Practice infectious disease control strategies BEFORE the pandemic influenza affects your community. Droplets containing the flu virus (seasonal or pandemic) from an infected person’s cough or sneeze can stay in the air for 4-6 feet. Those same droplets can contaminate everything in their path befor ...
Biology, Transmission, and Pathogenesis
Biology, Transmission, and Pathogenesis

... time. The period of viral shedding in the saliva prior to or after the onset of clinical symptoms is not known for these animals; therefore, an appropriate observation period following an exposure cannot be ascertained. Animals can acquire the virus not only from bites and scratches with saliva cont ...
EGG INOCULATION Principles Practice and Vaccine Development
EGG INOCULATION Principles Practice and Vaccine Development

... Allantoic inoculation is employed for growing the influenza virus for vaccine production. Other allantoic vaccines include Yellow fever (17D strain), and rabies vaccines. Duck eggs are bigger and have a longer incubation period then hen’s egg. They therefore provide a better yield of rabies virus an ...
Influenza in New Zealand 2009 - ESR
Influenza in New Zealand 2009 - ESR

... In addition to influenza viruses identified from sentinel surveillance, year-round laboratory surveillance of influenza (and other viruses) is carried out by the four regional virus diagnostic laboratories at Auckland, Waikato, Wellington and Christchurch Hospitals, and by the WHO National Influenza ...
Some New Emerging Viral Diseases in South America and East
Some New Emerging Viral Diseases in South America and East

... Iquitos virus is another new virus that has just been mentioned for a few years. It is also in the group of bunyavirus. This virus is also firstly reported from Peru. The genetic reassortment of this virus contains “the S and L segments of Oropouche virus and the M segment of a novel Simbu serogroup ...
Contingency Plan for Management of Human Cases of Avian Influenza
Contingency Plan for Management of Human Cases of Avian Influenza

... Influenza A viruses undergo major antigenic shift at unpredictable intervals causing worldwide epidemics (“pandemics”) with high morbidity and mortality. The present outbreak of H5N1 Avian Influenza in the south-east asian countries merits attention because of increasing evidence to suggest that the ...
Fate and Transport of Zoonotic Bacterial, Viral, and Parasitic
Fate and Transport of Zoonotic Bacterial, Viral, and Parasitic

... a result of differences in farm size and production type. Consequently, all comparisons of microbial survival in manure treatment systems were based on log10 reductions in recovered microbes. The two nonaerated lagoon systems differed in the log10 microbial reductions achieved by half a log10 or mor ...
Isolation and full-genome sequencing of Seneca Valley virus in
Isolation and full-genome sequencing of Seneca Valley virus in

... epidemic transient neonatal losses (ETNL). The first case of SVV infection was reported in Guangdong, South China in 2015. Results: We isolated and characterized an SVV HB-CH-2016 strain from vesicular lesion tissue specimens from piglets with PIVD in Hubei, Central China. The complete genome sequen ...
Amplified visual immunosensor integrated with nanozyme
Amplified visual immunosensor integrated with nanozyme

... cost-effectiveness due to the use of different chemicals and multistep preparation processing ...
Interleukin-18 improves the early defence system against influenza
Interleukin-18 improves the early defence system against influenza

... increases the severity of diseases with lethal endotoxaemia (Dinarello, 2000; Lauw et al., 1999; Netea et al., 2000). Importantly, IL-18 elicits antiviral activity in the acute phase of infection. In the case of vaccinia virus infection, IL-18 is involved in various host defence mechanisms, includin ...
modeling seasonality and viral mutation in an influenza pandemic
modeling seasonality and viral mutation in an influenza pandemic

... shown, public health decision makers may have to predict the subsequent course and severity of a pandemic. We developed an agent-based simulation model and used data from the state of Georgia to explore the influence of virus mutation and seasonal effects on the course of an influenza pandemic. We s ...
Guidance for Infection Prevention and Control
Guidance for Infection Prevention and Control

... Influenza (commonly referred to as ‘the flu’) is a virus that causes respiratory disease. Typical symptoms include fever, cough and muscle ache. In some people, complications can cause pneumonia and death. Due to its genetic make-up, the influenza virus can change and adapt, so new strains that are ...
The role of amniotic passage in the egg
The role of amniotic passage in the egg

... amplification, a sample of cDNA was amplified with primers B/17/1 and B/1140/2 (ACCAGCAATAGCTCCGAAGAAACC)which flank the above cloning primers, and a sample of this amplified DNA was subjected to nested PCR with the cloning primers Eco/B/35/1 and Barn/B/1092/2. Amplified DNA was either sequenced dir ...
item[`#file`]->filename - Open Michigan
item[`#file`]->filename - Open Michigan

... rapidly puts his hands over his face, and wants to know when he will get his pain medication. His physical exam is unremarkable except for temperature of 38.4°C, mild neck stiffness, and photophobia. What do you do next? ...
Specific amino acids of Olive mild mosaic virus coat protein are
Specific amino acids of Olive mild mosaic virus coat protein are

... Dang. An OMMV mutant (OMMVL11) containing two changes in the coat protein (CP), asparagine to tyrosine at position 189 and alanine to threonine at position 216, has been shown not to be Olpidium brassicae-transmissible owing to inefficient attachment of virions to zoospores. In this study, these ami ...
Recent expansion of highly pathogenic avian influenza H5N1: a
Recent expansion of highly pathogenic avian influenza H5N1: a

... been isolated from it (Munster et al. 2005). A study conducted in Italy, from 1992 to 1998, isolated 22 AI subtypes, the subtype H1N1 being the most frequent (De Marco et al. 2003, 2004). Fifty per cent of ducks carried antibodies against AIV, which means they had been in contact with the viruses at ...
Western Equine Encephalitis Virus
Western Equine Encephalitis Virus

... Vertical transmission can happen if the mother is infected during the first two trimesters of pregnancy. If ...
Study of recently identified porcine parvoviruses in pig herds of
Study of recently identified porcine parvoviruses in pig herds of

... substances and extreme environmental conditions like heat and pH and the requirement of cellular DNA synthesis for its viral replication. These are related to the difficulty to eradicate diseases associated with the viruses and their pathogenesis. I have studied porcine parvoviruses infecting pigs. ...
WEST NILE VIRUS AND USUTU
WEST NILE VIRUS AND USUTU

... with WNV bite and infect people, horses and other mammals (1,2). WNV may be also transmitted by blood transfusion, organ transplants, via placenta or breast milk. Although it is theoretically possible, so far there are no proofs of transmission via contact with infected birds, humans, horses (1,2). ...
this PDF file - Slovenian Veterinary Research
this PDF file - Slovenian Veterinary Research

... to other epithelia and cause nephritis or drop in egg production. Subcellular changes in broilers trachea induced by infectious bronchitis virus serotype 4/91 were examined by transmission electron microscopy (TEM). Seventy 1-day-old commercial broiler chicks were divided randomly into two groups (c ...
Genetic evolution of influenza A(H7N9) virus in China
Genetic evolution of influenza A(H7N9) virus in China

... Seven clusters with limited human-to-human transmission, mainly consisting of two cases each, have been investigated during the current wave. Two clusters involve transmission among patients admitted to the same hospital ward, while the five other clusters involve transmission among family members. ...
< 1 ... 7 8 9 10 11 12 13 14 15 ... 62 >

Swine influenza



Swine influenza, also called pig influenza, swine flu, hog flu and pig flu, is an infection caused by any one of several types of swine influenza viruses. Swine influenza virus (SIV) or swine-origin influenza virus (S-OIV) is any strain of the influenza family of viruses that is endemic in pigs. As of 2009, the known SIV strains include influenza C and the subtypes of influenza A known as H1N1, H1N2, H2N1, H3N1, H3N2, and H2N3.Swine influenza virus is common throughout pig populations worldwide. Transmission of the virus from pigs to humans is not common and does not always lead to human flu, often resulting only in the production of antibodies in the blood. If transmission does cause human flu, it is called zoonotic swine flu. People with regular exposure to pigs are at increased risk of swine flu infection.Around the mid-20th century, identification of influenza subtypes became possible, allowing accurate diagnosis of transmission to humans. Since then, only 50 such transmissions have been confirmed. These strains of swine flu rarely pass from human to human. Symptoms of zoonotic swine flu in humans are similar to those of influenza and of influenza-like illness in general, namely chills, fever, sore throat, muscle pains, severe headache, coughing, weakness and general discomfort.In August 2010, the World Health Organization declared the swine flu pandemic officially over.Cases of swine flu have been reported in India, with over 31,156 positive test cases and 1,841 deaths till March 2015.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report