• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Physiology Study Guide 12
Physiology Study Guide 12

... Physiology Study Guide 12: Sensory Physiology ...
Analog Neural Network Hardware For Colour Classification
Analog Neural Network Hardware For Colour Classification

... Analog Neural Network Hardware(LSI) ANN Design Flow Evalution Board and Accessories ...
Sequencing the connectome. - Cold Spring Harbor Laboratory
Sequencing the connectome. - Cold Spring Harbor Laboratory

... that do not exist) and false negatives (actual connections that are missed). Although the prevalence of each type of error will depend on the details of the implementation, with the sequencing approach most errors will likely be false negatives. Possible sources of false negatives include failure of ...
Identification of Dopaminergic Neurons of Nigral and Ventral
Identification of Dopaminergic Neurons of Nigral and Ventral

File - medicalfocus tanzania home of health professional
File - medicalfocus tanzania home of health professional

... with each other in a myriad of forms. We call the larger chemical grouping of atoms, molecules. When molecules combine to form an even larger structure, we term that a macromolecule. Examples of biological macromolecules include proteins, carbohydrates, and fats. Plastics are an excellent nonbiologi ...
A"computational"approach"towards"the"ontogeny"of" mirror"neurons
A"computational"approach"towards"the"ontogeny"of" mirror"neurons

... 1, , 2, and 5. 1,' refers to the amount of stimulation caused by other sources than neurons within the network and can be either on or off. The input signal further consists of the activation bias 2,' and Gaussian noise determined by 5. Each time step # represents 1 ms of activity. The parameters (, ...
The Function & Anatomy of Neurons What is a Neuron?
The Function & Anatomy of Neurons What is a Neuron?

... Impulse Continued The postsynaptic neuron has a concaved surface that creates a gap (synaptic cleft) between the synaptic bulb and the postsynaptic neuron.  Once the impulse reaches the bulb the synaptic vesicles of the bulb move toward the bulb membrane.  At the membrane the vesicles open and rel ...
Reconstruction of Natural Scenes from Ensemble Responses in the
Reconstruction of Natural Scenes from Ensemble Responses in the

... Consistent with the known temporal properties of X cells, which respond poorly to stimuli at high frequencies, some of the quick transients were not well reconstructed. For these four pixels, the mean correlation coefficient between the reconstructed and the actual signals was 0.60 6 0.04. In additi ...
Supplementary Information - Gatsby Computational Neuroscience Unit
Supplementary Information - Gatsby Computational Neuroscience Unit

`Genotypes` for neural networks - laral
`Genotypes` for neural networks - laral

... exclusively binary branchings. In order to obtain feedforward networks without recurrent connections, the branching angles are so restricted that all units send their growing axons in the direction from input units (bottom layer) to output units (top layer). (d) The "synaptic weight gene" determines ...
EN Sokolov`s Neural Model of Stimuli as Neuro
EN Sokolov`s Neural Model of Stimuli as Neuro

... and react to certain physical impacts of stimuli as signals. Receptors are in turn associated with selective detectors – neurons selectively responding to certain stimuli – and this connection can be either direct or, as shown, mediated by the predetectors. Selective detectors operate by the followi ...
Parkinson`s Disease Glossary A guide to the scientific language of
Parkinson`s Disease Glossary A guide to the scientific language of

... trait to be expressed, both parents must have the particular mutated allele or gene, and both must pass it to the offspring who then manifests the genetic disease. Some genetic forms of PD are autosomal recessive, such as from the genes known as parkin, PINK1 and DJ1. In some cases, the gene of inte ...
The Existence of a Layer IV in the Rat Motor Cortex
The Existence of a Layer IV in the Rat Motor Cortex

... pole in coronal sections (one brain) in a consecutive series of 50-µm-thick sections using an Oxford Vibratome®. Three to four sections from each series were used for the counting. In brief, the staining and the counting methods were as follows (see Skoglund et al., 1997): the sections were stained ...
Lesson Plan  - University of Washington
Lesson Plan - University of Washington

... Scientists and clinicians can take advantage of the input-output relationship by recording a neural response and reconstructing the stimulus that likely evoked that response. In the motor system, the activity of a group of neurons is what contracts muscles and allows us to move. If you record from t ...
Neural Networks
Neural Networks

... The Quiet Years: 1970's ...
slides
slides

... monkey. Several axon collaterals branch off the descending axon near the dendritic tree and in three other clusters (arrows), The clustered collaterals project vertically into several layers at regular intervals, consistent with the sequence of functional columns of cells. B). The horizontal connect ...
Cell type-specific pharmacology of NMDA receptors using masked
Cell type-specific pharmacology of NMDA receptors using masked

... Yunlei Yang†, Peter Lee, Scott M Sternson* Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, United States ...
Development of the human cerebral cortex: Boulder Committee
Development of the human cerebral cortex: Boulder Committee

... aspects of mitotic activity, fate determination and differentiation9–12. Recent studies have revealed new types of transient neurons and proliferative cells outside the classical neuroepithelium, new routes of cellular migration and additional cellular compartments13–18. Furthermore, we know much mo ...
Properties of ventromedial hypothalamic neurons with axons
Properties of ventromedial hypothalamic neurons with axons

... Stimulation and Recording Procedures The VMN was systematically explored while biphasic pulses to the CG were applied at 0.5 Hz. For the reduction of stimulus artifact, each negative rectangular pulse (0.2 ms duration) was followed by a positive pulse of 0.1 ms duration. By adjusting the intensity o ...
Eye and Ear Histology
Eye and Ear Histology

... junctions and elaborate zonulae occludentes and adherentes. This junctional complex is the site of the blood–retina barrier. The pigment cells have cylindrical sheaths on their apical surface that are associated with, but do not directly contact, the tip of the photoreceptor processes of the adjacen ...
Citron-Kinase, a Protein Essential to Cytokinesis in Neuronal
Citron-Kinase, a Protein Essential to Cytokinesis in Neuronal

... follows: kinase domain: GAGTCGGTAGCGGAGAGATGTT and CCCGACACAACAGAC TCAGATC; C itron-nonkinase (N) domain: GTGTGC TAGAGAAGTGAC TGCG and CC TCATCGAGTTGTTTGGACAG, TCGCAACAGC TGTAC TGTCATC and CATC TGC TTTGGC TGTATTTGC, TATC TATTCATGGTGCCGTTG and AGGAGGAGTTC TTCAGGC TGAG. PCR products were cloned into T ...
From the Eye to the Brain: Development of the Drosophila
From the Eye to the Brain: Development of the Drosophila

Granger causality analysis of state dependent functional connectivity
Granger causality analysis of state dependent functional connectivity

Neurons and Synapses
Neurons and Synapses

...  OPTIONAL “This is Your Brain” Curriculum worksheets by NSTA Purchase it here  OPTIONAL “This is Your Brain” Curriculum PPT Transparencies H & I Download it here WASS: (Middle School): 6-8 LS1-C Multicellular organisms have specialized cells that perform different functions. These cells join toget ...
Bad Fish - Groch Biology
Bad Fish - Groch Biology

... Three days into their trip, Bill netted a bird with an orange body and black wings and head. Dr. Westwood was very curious and looked closely at the bird. ...
< 1 ... 198 199 200 201 202 203 204 205 206 ... 420 >

Channelrhodopsin



Channelrhodopsins are a subfamily of retinylidene proteins (rhodopsins) that function as light-gated ion channels. They serve as sensory photoreceptors in unicellular green algae, controlling phototaxis: movement in response to light. Expressed in cells of other organisms, they enable light to control electrical excitability, intracellular acidity, calcium influx, and other cellular processes. Channelrhodopsin-1 (ChR1) and Channelrhodopsin-2 (ChR2) from the model organism Chlamydomonas reinhardtii are the first discovered channelrhodopsins. Variants have been cloned from other algal species, and more are expected.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report