• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Slide 1
Slide 1

... NUCLEUS ...
ss_tn_biol_04_using_variation
ss_tn_biol_04_using_variation

... Describe the earlier stages in the history of the discovery of DNA, including the roles of Miescher, Griffith and Franklin. ...
Linkage mapping
Linkage mapping

... Perform a test cross to determine which allelic combinations were passed on in the gametes. If JJKK is crossed with jjkk, and the offspring is test-crossed to jjkk,  offspring arising from parental gametes will be JjKk or jjkk  offspring arising from recombinant gametes will be Jjkk or jjKk ...sco ...
Microsoft Word 97
Microsoft Word 97

... iii ...
Forensic Science
Forensic Science

... •Once the DNA molecules have been cut up by a restriction enzyme, the resulting fragments are sorted out by electrophoresis. •The smaller DNA fragments will move at a faster rate on the gel plate than the larger ones. •The fragments are then transferred to a nylon membrane in a process called Southe ...
Molecular diagnosis and inborn errors of metabolism
Molecular diagnosis and inborn errors of metabolism

... consensus seems to be that this is premature in other instances, although the debate is fierce for hemochromatosis, which may be considered an inborn error. If screening for hemochromatosis were to be undertaken, would DNA screening be more efficient than the periodic screening of ferritin? When dis ...
Cancer Prone Disease Section Nijmegen breakage syndrome Atlas of Genetics and Cytogenetics
Cancer Prone Disease Section Nijmegen breakage syndrome Atlas of Genetics and Cytogenetics

... High frequency and early development of lymphomas, more often involving B-cells, in contrast with those found in AT; other forms of cancer may also be at higher risk. ...
No Slide Title
No Slide Title

... a. It is normally not stably integrated into the plant cell b. It may be intolerant of changes to the organization of its genome c. Genome may show instability ...
tacttgaaagttcaccggagg
tacttgaaagttcaccggagg

... a.) in the nucleus b.) in the cytoplasm c.) outside the cell _____ 3.) When the DNA is “transcribed” during protein synthesis, what is really happening is… a.) DNA is making a copy of itself in preparation for mitosis b.) DNA is making a copy of itself by making an mRNA molecule c.) DNA is being bro ...
Chromatin Structure 1
Chromatin Structure 1

Figure 1-2
Figure 1-2

... 1.4.1 Plants, Animals, and the Food Supply •Biotechnology has been used for the genetic modification of crop plants for increased herbicide, insect, and viral resistance, as well as for nutritional ...
Chapter 11 DNA and Genes
Chapter 11 DNA and Genes

... • Makes up the ribosome. The ribosome binds to mRNA and uses the instructions to hook together amino acids into long chains that will become proteins. ...
Supplementary Methods, Figures and Tables This file contains
Supplementary Methods, Figures and Tables This file contains

... one AMF species in the roots of leek. It should be possible to quantify different coexisting AMF species or genera in the roots of plants using qPCR. However, when the isolates are of the same species and sometimes genetically very closely related, such an approach is not straightforward. There are ...
Dragonfly genome project
Dragonfly genome project

... 9.45 ug (1.92) At Axeq (after 4 days) 4.61 ug (1.91) ...
Slide 1
Slide 1

... NUCLEUS ...
Biology Topic 3
Biology Topic 3

... 3.4.10 Outline a basic technique used for gene transfer Involving plasmids, a host cell (bacterium, yeast orother cell), restriction enzymes (endonuclease) and DNA ligase. The use of E. Coli in gene techonology is well documented. Most of its DNA is in one circular chromosome but it also has plasmi ...
U - West Windsor-Plainsboro Regional School District
U - West Windsor-Plainsboro Regional School District

feature - Schlick Group at NYU
feature - Schlick Group at NYU

... central pole, depicted as a thick line that is broken where the bases lie in front. This axis is a visually useful point of reference, but its early ubiquity seems to depend on the structural necessities of physical models. The developed model, composed from standard brass components with tailor-mad ...
DNA Deoxyribose Nucleic Acid
DNA Deoxyribose Nucleic Acid

chapter8_Sections 1
chapter8_Sections 1

... B In one experiment, bacteria were infected with virus particles that had been labeled with a radioisotope of sulfur (35S). The sulfur had labeled only viral proteins. The viruses were dislodged from the bacteria by whirling the mixture in a kitchen blender. Most of the radioactive sulfur was detect ...
ADVANCES IN GENETICS 2 blog2012
ADVANCES IN GENETICS 2 blog2012

... • Did you know? Gene therapy is an experimental field of medical research in which defective genes are replaced with healthy genes. • One way to insert healthy genes involves using a delivery system called a “gene gun” to inject microscopic gold bullets coated with genetic material. • Genes and DNA: ...
Answers to Mastering Concepts Questions
Answers to Mastering Concepts Questions

... Viruses do not produce colonies on agar; they require living host cells to reproduce. Many bacteria, on the other hand, can live and reproduce using the nutrients present in agar. 19. With a diameter of about 600 nm, mimiviruses are enormous compared with other viruses. The mimivirus genome consists ...
Macromolecules of Life
Macromolecules of Life

... Monomers are identified by the name of the building block followed by the word “residue”, Ex: nucleotide residues. The synthesis of macromolecules occurs only if energy is added to the system.  the synthesis of macromolecules must be coupled to energy-releasing (exergonic) reactions Reverse reactio ...
PCR
PCR

... •In PCR2 tube the primers S19L Fw and S19L Rev should be used for amplification of the HNF1A gene fragment. •In PCR3 tube you can choose one primer set or another. ...
6 Principles of Gene Regulation
6 Principles of Gene Regulation

< 1 ... 335 336 337 338 339 340 341 342 343 ... 766 >

Cre-Lox recombination



In the field of genetics, Cre-Lox recombination is known as a site-specific recombinase technology, and is widely used to carry out deletions, insertions, translocations and inversions at specific sites in the DNA of cells. It allows the DNA modification to be targeted to a specific cell type or be triggered by a specific external stimulus. It is implemented both in eukaryotic and prokaryotic systems.The system consists of a single enzyme, Cre recombinase, that recombines a pair of short target sequences called the Lox sequences. This system can be implemented without inserting any extra supporting proteins or sequences. The Cre enzyme and the original Lox site called the LoxP sequence are derived from bacteriophage P1.Placing Lox sequences appropriately allows genes to be activated, repressed, or exchanged for other genes. At a DNA level many types of manipulations can be carried out. The activity of the Cre enzyme can be controlled so that it is expressed in a particular cell type or triggered by an external stimulus like a chemical signal or a heat shock. These targeted DNA changes are useful in cell lineage tracing and when mutants are lethal if expressed globally.The Cre-Lox system is very similar in action and in usage to the FLP-FRT recombination system.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report