• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
PPT
PPT

SPECIFIC PROTEIN SYNTHESIS IN CELLULAR
SPECIFIC PROTEIN SYNTHESIS IN CELLULAR

... Near the end of vitellogenesis, the nurse cells degenerate (King and Aggarwal, 1965) ; the follicle then consists of only two cell types, the oocyte (which can be destroyed easily) and the enveloping follicular cells . In sum, pure preparations of follicular epithelial cells (Fig . I c) can be obtai ...
Diapositiva 1
Diapositiva 1

... > To become an active ligand requires: > > Autoprocessing reaction > > Palmitoylation of the most amino-terminal cysteine > Once released into the extracellular environment, interacts with different proteins in multimeric form > Targets Patched (Ptc) protein ...
Improving penicillin biosynthesis in Penicillium chrysogenum
Improving penicillin biosynthesis in Penicillium chrysogenum

... AA GATATC TTACATCGAATTCTTCATCTC CGGCACTGAGAATGACCCC ...
Centennial Honors College Western Illinois University Undergraduate Research Day 2012
Centennial Honors College Western Illinois University Undergraduate Research Day 2012

... Cathepsins are proteases used in intracellular peptide hydrolysis. The type of cathepsin studied in this research is known as Cathepsin D encoded by the CTSD gene in human. Due to its association with tumor invasion and metastasis when found outside the lysosomes, this enzyme has been considered as ...
Chloroplast phosphoglycerate kinase from Euglena gracilis
Chloroplast phosphoglycerate kinase from Euglena gracilis

... Cells were harvested 5 days after inoculation. PGK purification from whole cells and chloroplasts All steps were performed at 4 C unless stated otherwise. Euglena cells (200 g) were homogenized in buffer 1 (10 mM Tris/HCl pH 7.5, 1 mM dithiothreitol) using a French-Press at 8000 p.s.i. and centrifu ...
Poster
Poster

... During embryogenesis, in all mammals, the eyelids grow across the eye anterior, fuse together, and subsequently reopen. This process is essential for proper eye development. ADAM17 is a Zn2+ metalloprotease that has a role in cleaving numerous proteins including growth factors involved in EGFR signa ...
Leukaemia Section t(9;22)(q34;q11) in CML Atlas of Genetics and Cytogenetics
Leukaemia Section t(9;22)(q34;q11) in CML Atlas of Genetics and Cytogenetics

... anomalies also emerge frequently at the time of acute transformation; 2- These are: +der(22), +8, i(17q), +19, most often, but also: +21, -Y, -7, -17, +17; acute transformation can also be accompanied with t(3;21)(q26;q22) (1% of cases); near haploidy can occur; of note, although rare, is the occurr ...
global warming and an increasing price and unsafe supply of fossil
global warming and an increasing price and unsafe supply of fossil

Posttranslational Protein Modiications in Plant
Posttranslational Protein Modiications in Plant

... et al., 2013). MS is the most versatile and precise technique, since it can identify multiple different PTMs in the same sample and, importantly, determine which residue(s) carries the PTM. The latter is important for understanding how the PTM may affect protein function; however, such localization ...
Posttranslational Protein Modiications in Plant
Posttranslational Protein Modiications in Plant

... et al., 2013). MS is the most versatile and precise technique, since it can identify multiple different PTMs in the same sample and, importantly, determine which residue(s) carries the PTM. The latter is important for understanding how the PTM may affect protein function; however, such localization ...
Supplementary Table 1
Supplementary Table 1

Poster
Poster

... Each atom in these amino acids is replaced by a point charge. The coordinate of each point charge is from the respective Protein Data Bank file (2MGK, 2MGA, 2MGC); the positive or negative partial atomic charge of each point charge was given by the residue-specific value as published by Cornell, et ...
Hemoglobin Myoglobin Lecture
Hemoglobin Myoglobin Lecture

... a. At low pH (high H+ concentration), protons can act as effectors (bind to Hb and affect affinity of O2 binding) by creating salt bridges that stabilize the T-statedecreasing Oxygen affinity, releasing it into the tissues; It is physiologically important because the Bohr effect facilitates the de ...
Williams, Brandon: A Review on Common Applications Designed to Optimize the SEQUEST Search Algorithm With Respect to Limiting False Positive Identification
Williams, Brandon: A Review on Common Applications Designed to Optimize the SEQUEST Search Algorithm With Respect to Limiting False Positive Identification

... individual proteins in the high molecular weight range, their modifications or protein complexes, suppressed the broad application of proteomics. This technological hurdle has for the most part been overcome through the application of mass spectrometry (MS) when used in combination with developing p ...
Meal ingestion, amino acids and brain
Meal ingestion, amino acids and brain

... divided by the sum of the concentrations of its transport competitors (e.g., serum TRP/ΣLNAA = TRP/(TYR+ PHE+ LEU + ILE + VAL)) [14]. Using this method, serum concentrations, serum ratios and cortical concentrations of each amino acid studied were very similar to those reported previously, using oth ...
Isolation of Proteins which Interact with Phospholipase A2 (PLA
Isolation of Proteins which Interact with Phospholipase A2 (PLA

ppt - Bio 5068
ppt - Bio 5068

... Expanded View of an “Average” Structure ...
Document
Document

... New studies suggest that whey may uniquely influence food intake through its effects on cholecystokinin and other pathways. While many studies have shown that protein is the most filling or satiating macronutrient, all proteins may not be equal in this regard. Two human studies conducted at the Univ ...
- Impact Journals
- Impact Journals

APG Phytochemical Database - American Pistachio Growers
APG Phytochemical Database - American Pistachio Growers

... Mineral Table salt is made up of the elements sodium and chlorine - the technical name for salt is sodium chloride. Your body needs some sodium to work properly. It helps with the function of nerves an muscles. It also helps to keep the right balance of fluids in your body. Your kidneys control how ...
Molecular characteristics of sucrose synthase
Molecular characteristics of sucrose synthase

... Ipomoea batatas L.) [20]. Depending on ionic strength of buffer solution, the enzyme may form aggregated structures. Explanation of high molecular mass of SuSy is also S170 phosphorylation that promotes the formation of complex dimensional forms. Subunit composition of the sucrose synthase was evalu ...
Activity 3
Activity 3

... The boiling of the solution in test tube 1 gave rise to the difference in optical density measurements between tubes 1 and 2. The boiling of the solution in test tube 1 caused the denaturing of pepsin, rendering this inactive and unable to digest BAPNA. ...
Acyl Carrier Protein (ACP) lmport into Chloroplasts Does not
Acyl Carrier Protein (ACP) lmport into Chloroplasts Does not

... lysate translation products from thermolysin-treated chloroplasts (lane 1), and the products of organelle-free processing reactions using translation products from a wheat germ lysate and soluble chloroplast extracts prepared from pea (lane 2) and spinach (lane 3) leaves were analyzed on a 15% SDS-p ...
Identification of fungal oxaloacetate hydrolyase within the
Identification of fungal oxaloacetate hydrolyase within the

... Two ORFs directly adjacent to ORFs encoding OAHlike class proteins were used to query fungal genomes encoding one or more OAH-like class proteins by blastX and if a single very highly significant hit resulted (E-value < 1 E 210), this was considered to be the likely ortholog of the query. When two g ...
< 1 ... 12 13 14 15 16 17 18 19 20 ... 197 >

Protein purification



Protein purification is a series of processes intended to isolate one or a few proteins from a complex mixture, usually cells, tissues or whole organisms. Protein purification is vital for the characterization of the function, structure and interactions of the protein of interest. The purification process may separate the protein and non-protein parts of the mixture, and finally separate the desired protein from all other proteins. Separation of one protein from all others is typically the most laborious aspect of protein purification. Separation steps usually exploit differences in protein size, physico-chemical properties, binding affinity and biological activity. The pure result may be termed protein isolate.The methods used in protein purification can roughly be divided into analytical and preparative methods. The distinction is not exact, but the deciding factor is the amount of protein that can practically be purified with that method. Analytical methods aim to detect and identify a protein in a mixture, whereas preparative methods aim to produce large quantities of the protein for other purposes, such as structural biology or industrial use. In general, the preparative methods can be used in analytical applications, but not the other way around.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report