printer-friendly sample test questions
... Depth of Knowledge Level 2 7. Nondisjunction of sex chromosomes in a human female during meiosis may result in her son inheriting the disorder represented by A. XXY B. XYY C. XXX D. YYY 8. A child born with Down Syndrome (Trisomy 21) can have parents without the disorder. Down Syndrome is caused by ...
... Depth of Knowledge Level 2 7. Nondisjunction of sex chromosomes in a human female during meiosis may result in her son inheriting the disorder represented by A. XXY B. XYY C. XXX D. YYY 8. A child born with Down Syndrome (Trisomy 21) can have parents without the disorder. Down Syndrome is caused by ...
tacaatccgttat g c cactcatgattagagtcgcgg gatt
... Once it divides, each cell will have identical DNA and function the same way. If the body needs to make a particular protein in order to function, it makes a copy of the section of DNA that it needs. This process is called transcription and a molecule called messenger RNA (mRNA) is made. Transcripti ...
... Once it divides, each cell will have identical DNA and function the same way. If the body needs to make a particular protein in order to function, it makes a copy of the section of DNA that it needs. This process is called transcription and a molecule called messenger RNA (mRNA) is made. Transcripti ...
WS 8 – 3: Translation and Protein Synthesis Name
... Once it divides, each cell will have identical DNA and function the same way. If the body needs to make a particular protein in order to function, it makes a copy of the section of DNA that it needs. This process is called transcription and a molecule called messenger RNA (mRNA) is made. Transcripti ...
... Once it divides, each cell will have identical DNA and function the same way. If the body needs to make a particular protein in order to function, it makes a copy of the section of DNA that it needs. This process is called transcription and a molecule called messenger RNA (mRNA) is made. Transcripti ...
Assuming that Victoria and/or her descendants were
... people in Elizabeth II’s ancestry that carried the hemophilia gene, what is the probability that Elizabeth II herself carries it? Answer Zero, unless the gene mutation arose spontaneously. To see why, look at the family tree above. The mutations for hemophilia are located on the X chromosome. All ch ...
... people in Elizabeth II’s ancestry that carried the hemophilia gene, what is the probability that Elizabeth II herself carries it? Answer Zero, unless the gene mutation arose spontaneously. To see why, look at the family tree above. The mutations for hemophilia are located on the X chromosome. All ch ...
Regulation of Transcription
... A leader region (where transcription starts but leader is an UTR) 3 structural genes: LacZ, LacY and LacA (refer to here as lactose dehydrogenase); actually 3 different genes with different functionality in the utilisation of lactose. ...
... A leader region (where transcription starts but leader is an UTR) 3 structural genes: LacZ, LacY and LacA (refer to here as lactose dehydrogenase); actually 3 different genes with different functionality in the utilisation of lactose. ...
CH 16 PPT
... Helicase:catalyzes the untwisting of the DNA at the replication fork DNA polymerase:catalyzes the elongation of new DNA ...
... Helicase:catalyzes the untwisting of the DNA at the replication fork DNA polymerase:catalyzes the elongation of new DNA ...
Regulation of Gene Expression
... Reading Guide 1. Why is it important for bacterial cells to be able to regulate gene expression? Provide an example. ...
... Reading Guide 1. Why is it important for bacterial cells to be able to regulate gene expression? Provide an example. ...
Name: Period: ___ Date
... What is Translation (include type(s) of RNA, location of the process, and the name given to the triplet of bases on the tRNA strand? mRNA--tRNA--proteins. mRNA attaches to ribosome, tRNA (anticodon) brings amino acids to mRNA to form proteins ...
... What is Translation (include type(s) of RNA, location of the process, and the name given to the triplet of bases on the tRNA strand? mRNA--tRNA--proteins. mRNA attaches to ribosome, tRNA (anticodon) brings amino acids to mRNA to form proteins ...
Genetics Practice Test (H)
... 3. The white-eyed allele is A) recessive and autosomal B) dominant and sex-linked C) dominant and autosomal D) a genetic mutation in the female E) recessive and sex-linked 4. In fruit flies (Drosophila), vestigial wings (v) are recessive to normal wings (V). What phenotype(s) of offspring would you ...
... 3. The white-eyed allele is A) recessive and autosomal B) dominant and sex-linked C) dominant and autosomal D) a genetic mutation in the female E) recessive and sex-linked 4. In fruit flies (Drosophila), vestigial wings (v) are recessive to normal wings (V). What phenotype(s) of offspring would you ...
Italian Association for Cancer Research NETWORK OF
... identification of relevant interactions between genes and the environment through studies of molecular epidemiology in Italy; (b) to rationalize and improve the quality of laboratory measurements by referring to reference laboratories; (c) to pool existing data sets; (d) to create a network web site ...
... identification of relevant interactions between genes and the environment through studies of molecular epidemiology in Italy; (b) to rationalize and improve the quality of laboratory measurements by referring to reference laboratories; (c) to pool existing data sets; (d) to create a network web site ...
Cellular Metabolism
... Enzymes that control the reaction rates must also act in a specific sequence Enzymes are positioned in the exact sequence as that of the reaction ...
... Enzymes that control the reaction rates must also act in a specific sequence Enzymes are positioned in the exact sequence as that of the reaction ...
susceptible to certain infections than whites. For example
... submerged electrophoresis (120 V, 80 min). The resolved amplicons were then stained with 0.5 mg/L ethidium bromide and viewed under ultraviolet illumination. Like other PCR techniques, mutagenically separated PCR (MS-PCR) requires careful optimization of each reaction condition, including magnesium ...
... submerged electrophoresis (120 V, 80 min). The resolved amplicons were then stained with 0.5 mg/L ethidium bromide and viewed under ultraviolet illumination. Like other PCR techniques, mutagenically separated PCR (MS-PCR) requires careful optimization of each reaction condition, including magnesium ...
The Cell Cycle
... S-Phase Controls • Replication must occur only 1 time / cell cycle • Origin “licensing” • ORC – origin recognition complex • SPF – S-phase promoting factor • Mcms – helicases that are only loaded once ...
... S-Phase Controls • Replication must occur only 1 time / cell cycle • Origin “licensing” • ORC – origin recognition complex • SPF – S-phase promoting factor • Mcms – helicases that are only loaded once ...
Control of Gene Expression and Cancer
... • Tumor-suppressor genes – Mutations in tumor suppressor genes result in loss of function so products no longer inhibit cyclin nor promote apoptosis • “loss of function” mutations • Ex: retinoblastoma protein controls transcription factor for cyclin D – When tumor-suppressor gene p16 mutates, the re ...
... • Tumor-suppressor genes – Mutations in tumor suppressor genes result in loss of function so products no longer inhibit cyclin nor promote apoptosis • “loss of function” mutations • Ex: retinoblastoma protein controls transcription factor for cyclin D – When tumor-suppressor gene p16 mutates, the re ...
Sickle Cell Activity File
... red blood cells from their normal disk shape to a sickle shape. Sickle-shaped red blood cells can block the blood flow in the tiny capillaries, causing pain and damage to body organs. In addition, sickleshaped red blood cells do not last nearly as long as normal red blood cells, so the person does n ...
... red blood cells from their normal disk shape to a sickle shape. Sickle-shaped red blood cells can block the blood flow in the tiny capillaries, causing pain and damage to body organs. In addition, sickleshaped red blood cells do not last nearly as long as normal red blood cells, so the person does n ...
slides
... new alleles to populations or changes the frequency of alleles already present. http://evolution.berkeley.edu/evolibrary/article ...
... new alleles to populations or changes the frequency of alleles already present. http://evolution.berkeley.edu/evolibrary/article ...
Biology 211 Intro Molecular and Cell Biology
... removed or added usually requires "sorting signals". These are bits of information carried in the amino acid sequence that sends the proteins to the correct locations in the cell. Example: Signal peptide of hydrophobic amino acids for targeting proteins to endoplasmic reticulum. ...
... removed or added usually requires "sorting signals". These are bits of information carried in the amino acid sequence that sends the proteins to the correct locations in the cell. Example: Signal peptide of hydrophobic amino acids for targeting proteins to endoplasmic reticulum. ...
NJBCT - Sample Biology EOC Exam
... mitochondria and chloroplasts. endoplasmic reticulum and lysosomes. ...
... mitochondria and chloroplasts. endoplasmic reticulum and lysosomes. ...
Level 3 Biology (90715) 2011 Assessment Schedule
... • Explains the role of translation. Eg: Translation is the process happening at the ribosome, where RNA codons are matched with tRNA anti codons, resulting in the joining of amino acids. Each amino acid is specific to an anticodon / codon. • Explains a link between amino acids and protein folding Eg ...
... • Explains the role of translation. Eg: Translation is the process happening at the ribosome, where RNA codons are matched with tRNA anti codons, resulting in the joining of amino acids. Each amino acid is specific to an anticodon / codon. • Explains a link between amino acids and protein folding Eg ...
View/Open - Oregon State University
... 2. The information in mRNA is encoded as the Genetic Code. The genetic code specifies how nucleic acid information is converted to make a protein. Information in mRNA is encoded in groups of three nucleotides (called a codon or a triplet). There are 64 possible codons. 61 of them code for amino acid ...
... 2. The information in mRNA is encoded as the Genetic Code. The genetic code specifies how nucleic acid information is converted to make a protein. Information in mRNA is encoded in groups of three nucleotides (called a codon or a triplet). There are 64 possible codons. 61 of them code for amino acid ...
Point mutation
A point mutation, or single base modification, is a type of mutation that causes a single nucleotide base change, insertion, or deletion of the genetic material, DNA or RNA. The term frameshift mutation indicates the addition or deletion of a base pair. A point mutant is an individual that is affected by a point mutation.Repeat induced point mutations are recurring point mutations, discussed below.