PDF
... None of these compounds caused any alterations of polarity. At non-toxic concentrations reconstitution was exclusively monopolar in form, even in isolated digestive zones. At lethal doses animals were axiate with easily recognizable polarity right up to, and during, disintegration; invariably the la ...
... None of these compounds caused any alterations of polarity. At non-toxic concentrations reconstitution was exclusively monopolar in form, even in isolated digestive zones. At lethal doses animals were axiate with easily recognizable polarity right up to, and during, disintegration; invariably the la ...
functional analysis of chromatin assembly genes in tetrahymena
... Renu Jeyapala Bachelor of Science Integrative Biology and Psychology, University of Toronto, 2011 ...
... Renu Jeyapala Bachelor of Science Integrative Biology and Psychology, University of Toronto, 2011 ...
Having it both ways: transcription factors that bind DNA and RNA
... transcription factors, but for which subsequent research has shown apparent RNA-binding activities and functions (Table 2). With the expectation that such `moonlighting' by DNA-binding proteins might be more common than previously imagined, we highlight some old and new examples of this phenomenon. ...
... transcription factors, but for which subsequent research has shown apparent RNA-binding activities and functions (Table 2). With the expectation that such `moonlighting' by DNA-binding proteins might be more common than previously imagined, we highlight some old and new examples of this phenomenon. ...
localization of histone gene transcripts in newt lampbrush
... Ideal preparations have the bivalent chromosomes well separated from one another, all their lateral loops should be anchored down on the coverglass surface, and they should be reasonably free from nucleoli. These considerations determine the ideal oocyte size with which to work, as large as possible ...
... Ideal preparations have the bivalent chromosomes well separated from one another, all their lateral loops should be anchored down on the coverglass surface, and they should be reasonably free from nucleoli. These considerations determine the ideal oocyte size with which to work, as large as possible ...
Genetics - Michael
... level, evolutionary geneticists and genomicists examine how the sum of the genes in a species, also called the genome, changes over long periods of time. The past decade has seen a tremendous focus on this level of genetics as new technologies and computer applications have allowed the generation an ...
... level, evolutionary geneticists and genomicists examine how the sum of the genes in a species, also called the genome, changes over long periods of time. The past decade has seen a tremendous focus on this level of genetics as new technologies and computer applications have allowed the generation an ...
Distortion of quantitative genomic and expression
... regarding reproducibility of these techniques have been raised by cross-validation studies in different laboratories (1–5). Strategies to mitigate variability in the results obtained from replicate studies have focused on standardizing technical factors, such as array production, RNA synthesis, labe ...
... regarding reproducibility of these techniques have been raised by cross-validation studies in different laboratories (1–5). Strategies to mitigate variability in the results obtained from replicate studies have focused on standardizing technical factors, such as array production, RNA synthesis, labe ...
DNA Evolution 3.1 Troubleshooting and Debugging Guide
... sdna-job (Runs on Archive Manager and Archive Client) ........................................................... 7 evo_ticket_processor (Runs on Archive Manager and Archive Client) ....................................... 7 QtSDNAClientProxyService (Runs on Archive Manager and Archive Client) ...... ...
... sdna-job (Runs on Archive Manager and Archive Client) ........................................................... 7 evo_ticket_processor (Runs on Archive Manager and Archive Client) ....................................... 7 QtSDNAClientProxyService (Runs on Archive Manager and Archive Client) ...... ...
Read the Nobel Lecture
... happening. The first assay we tried explored whether a piece of DNA that included a telomere would incorporate DNA precursors more readily than a piece of DNA containing non-telomeric sequences. The idea was that if there was an enzyme that actively elongated telomeres, we might be able to detect it ...
... happening. The first assay we tried explored whether a piece of DNA that included a telomere would incorporate DNA precursors more readily than a piece of DNA containing non-telomeric sequences. The idea was that if there was an enzyme that actively elongated telomeres, we might be able to detect it ...
Introduction to Molecular Diagnostics
... Many of our bodily processes, both normal and abnormal, as well as health or disease states, are driven by the interaction of our genes and the proteins they produce that carry out specific functions within the body. Therefore, the ability to quickly and accurately assess an individual’s health at t ...
... Many of our bodily processes, both normal and abnormal, as well as health or disease states, are driven by the interaction of our genes and the proteins they produce that carry out specific functions within the body. Therefore, the ability to quickly and accurately assess an individual’s health at t ...
Analysis of Drosophila Species Genome Size and Satellite DNA
... Accepted for publication June 20, 2007 ABSTRACT The size of eukaryotic genomes can vary by several orders of magnitude, yet genome size does not correlate with the number of genes nor with the size or complexity of the organism. Although ‘‘whole’’-genome sequences, such as those now available for 12 ...
... Accepted for publication June 20, 2007 ABSTRACT The size of eukaryotic genomes can vary by several orders of magnitude, yet genome size does not correlate with the number of genes nor with the size or complexity of the organism. Although ‘‘whole’’-genome sequences, such as those now available for 12 ...
Higher order structural effects stabilizing the
... geometry is a bifurcated one, involving the central section of the G Watson–Crick face and the C carbonyl group adjacent to the C1’, which is classifiable as a G–C Ww/Bs trans [according to the Leontis and Westhof nomenclature as extended by Lemieux and Major for bifurcated geometries, (8,30)]. This ...
... geometry is a bifurcated one, involving the central section of the G Watson–Crick face and the C carbonyl group adjacent to the C1’, which is classifiable as a G–C Ww/Bs trans [according to the Leontis and Westhof nomenclature as extended by Lemieux and Major for bifurcated geometries, (8,30)]. This ...
Canadian Journal of Microbiology
... Abstract: The presence and taxonomy of endophytic bacteria of the entire aerial parts of crocus (Crocus albiflorus), a wildflower native in the Alps, were investigated. A combination of plating of plant macerates, isolation and sequence identification of isolates, and direct 16S rDNA PCR amplificati ...
... Abstract: The presence and taxonomy of endophytic bacteria of the entire aerial parts of crocus (Crocus albiflorus), a wildflower native in the Alps, were investigated. A combination of plating of plant macerates, isolation and sequence identification of isolates, and direct 16S rDNA PCR amplificati ...
CYP2B6 NESTED PCR: A GOOD APPROACH FOR PATIENTS ON METHADONE Original Article
... attributed primarily to the CYP3A4, CYP2B6, and CYP2D6 proteins in humans [2,9–12]. The detection of various single nucleotide polymorphisms (SNPs) involved in methadone action in vivo could help to identify an individual’s susceptibility to methadone toxicity and improve toxicological interpretatio ...
... attributed primarily to the CYP3A4, CYP2B6, and CYP2D6 proteins in humans [2,9–12]. The detection of various single nucleotide polymorphisms (SNPs) involved in methadone action in vivo could help to identify an individual’s susceptibility to methadone toxicity and improve toxicological interpretatio ...
Echinomycin binding to alternating AT
... To check the effect of the central CpG step on the binding to (AT)n we have performed similar footprinting experiments on DNA fragments containing central GG steps. Figure 4 presents DNase I digestion and DEPC modification of a fragment containing the sequence (AT)15GG(AT)6 in the presence of echino ...
... To check the effect of the central CpG step on the binding to (AT)n we have performed similar footprinting experiments on DNA fragments containing central GG steps. Figure 4 presents DNase I digestion and DEPC modification of a fragment containing the sequence (AT)15GG(AT)6 in the presence of echino ...
Microarray-based comparative genomic hybridisation (array CGH)
... A microarray works by exploiting the ability of a DNA molecule (or strand) to bind specifically to, or hybridise to, another DNA molecule (strand). The DNA in our cells is arranged as a double helix (see Figure 2) in which the two strands of DNA are bound (‘paired’) together by bonds between the bas ...
... A microarray works by exploiting the ability of a DNA molecule (or strand) to bind specifically to, or hybridise to, another DNA molecule (strand). The DNA in our cells is arranged as a double helix (see Figure 2) in which the two strands of DNA are bound (‘paired’) together by bonds between the bas ...
rational selection of pcr-based platforms for pharmacogenomic testing
... annealing temperatures and four primers23. However, elongation of mismatched bases can be avoided when appropriate primers and reaction conditions are applied. Specificity of primer extension may be improved by appropriate adjustment of experimental conditions and a web-based AS primer design applic ...
... annealing temperatures and four primers23. However, elongation of mismatched bases can be avoided when appropriate primers and reaction conditions are applied. Specificity of primer extension may be improved by appropriate adjustment of experimental conditions and a web-based AS primer design applic ...
QUESTION - Cloudfront.net
... C-500 • QUESTION : What are the steps of protein synthesis and their products in order. • ANSWER : Dna is transcibed into mRNA that leaves the nucleus and goes to the ribosome where every 3 letters are read that code for amino acids. This is translation and tRNA brings the amino acids that are put ...
... C-500 • QUESTION : What are the steps of protein synthesis and their products in order. • ANSWER : Dna is transcibed into mRNA that leaves the nucleus and goes to the ribosome where every 3 letters are read that code for amino acids. This is translation and tRNA brings the amino acids that are put ...
Replication of plasmids with the p15A origin in Shewanella
... Shewanella putrefaciens MR-1 (Myers and Nealson 1988a) and Escherichia coli JM109 (Yanisch-Perron et al. 1985) were grown aerobically on LB medium (Sambrook et al. 1989) supplemented, as needed, with antibiotics at the following concentrations : tetracycline (Tc), 8 mg ml−1 and chloramphenicol (Cm), ...
... Shewanella putrefaciens MR-1 (Myers and Nealson 1988a) and Escherichia coli JM109 (Yanisch-Perron et al. 1985) were grown aerobically on LB medium (Sambrook et al. 1989) supplemented, as needed, with antibiotics at the following concentrations : tetracycline (Tc), 8 mg ml−1 and chloramphenicol (Cm), ...
DNA phosphorothioation inStreptomyces lividans: mutational
... Early predictions of genes involved in DNA phosphorothioation and their organization as an operon within a region covering the cloned dnd gene cluster was mostly based on bioinformatic analysis, and no detailed experiments had been performed to provide direct evidence. We refined the conclusions by ...
... Early predictions of genes involved in DNA phosphorothioation and their organization as an operon within a region covering the cloned dnd gene cluster was mostly based on bioinformatic analysis, and no detailed experiments had been performed to provide direct evidence. We refined the conclusions by ...
'This day designing God Hath put into my hand
... Hippocrates (470-370 B.C.) in his 'Book of Epidemics' leaves little doubt that by the fifth century B.C., the disease was present in Europe. Eventually, the disease described as the Roman fever gave rise to the Italian word mal 'aria, meaning 'bad air' to describe the cause of the sickness superstit ...
... Hippocrates (470-370 B.C.) in his 'Book of Epidemics' leaves little doubt that by the fifth century B.C., the disease was present in Europe. Eventually, the disease described as the Roman fever gave rise to the Italian word mal 'aria, meaning 'bad air' to describe the cause of the sickness superstit ...
Microcin B17 Blocks DNA Replication and Induces
... samples were spotted on M63 glucose plates overlaid with 3ml soft agar containing approximately 2 x lo7 indicator bacteria (strain BM21). After overnight incubation at 37 "C, plates were examined for growth inhibition. The antibiotic activity was expressed as units ml-I (AU ml-I), one unit being the ...
... samples were spotted on M63 glucose plates overlaid with 3ml soft agar containing approximately 2 x lo7 indicator bacteria (strain BM21). After overnight incubation at 37 "C, plates were examined for growth inhibition. The antibiotic activity was expressed as units ml-I (AU ml-I), one unit being the ...
PDF
... promoter was amplified by KOD Plus Taq polymerase (Toyobo, Nagoya, Japan) as specified by manufacturer, with primers Lig1-attB1, 5⬘GGGGACAAGTTTGTACAAAAAAGCAGGCTGATTAGTCTGGAGGTCTTGTCGCTC-3⬘ and Lig1-attB2, 5⬘-GGGGACCACTTTGTACAAGAAAGCTGGGTAATCATCGTCACCTTTGACTTCATTAC-3⬘. In the latter primer the stop c ...
... promoter was amplified by KOD Plus Taq polymerase (Toyobo, Nagoya, Japan) as specified by manufacturer, with primers Lig1-attB1, 5⬘GGGGACAAGTTTGTACAAAAAAGCAGGCTGATTAGTCTGGAGGTCTTGTCGCTC-3⬘ and Lig1-attB2, 5⬘-GGGGACCACTTTGTACAAGAAAGCTGGGTAATCATCGTCACCTTTGACTTCATTAC-3⬘. In the latter primer the stop c ...
Press release
... protocol and secondly also on the starting weight or volume. It also depends to a large extent on the sample material itself (leaf and seed material, animal tissue, hair, etc.). sbeadex - high-quality DNA preparations The oKtopure utilises the sbeadexTM extraction chemistry developed by LGC, which i ...
... protocol and secondly also on the starting weight or volume. It also depends to a large extent on the sample material itself (leaf and seed material, animal tissue, hair, etc.). sbeadex - high-quality DNA preparations The oKtopure utilises the sbeadexTM extraction chemistry developed by LGC, which i ...
Nucleic acid double helix
In molecular biology, the term double helix refers to the structure formed by double-stranded molecules of nucleic acids such as DNA. The double helical structure of a nucleic acid complex arises as a consequence of its secondary structure, and is a fundamental component in determining its tertiary structure. The term entered popular culture with the publication in 1968 of The Double Helix: A Personal Account of the Discovery of the Structure of DNA, by James Watson.The DNA double helix polymer of nucleic acids, held together by nucleotides which base pair together. In B-DNA, the most common double helical structure, the double helix is right-handed with about 10–10.5 base pairs per turn. This translates into about 20-21 nucleotides per turn. The double helix structure of DNA contains a major groove and minor groove. In B-DNA the major groove is wider than the minor groove. Given the difference in widths of the major groove and minor groove, many proteins which bind to B-DNA do so through the wider major groove.