Computational neuroanatomy and co
... equal to one. This diagonal is trivial in the sense that it expresses the perfect alignment of any vector in voxel space with itself. When we consider the distribution of the entries of the co-expression matrix, we really mean the distribution of the upper-diagonal coefficients. Given a set of gene ...
... equal to one. This diagonal is trivial in the sense that it expresses the perfect alignment of any vector in voxel space with itself. When we consider the distribution of the entries of the co-expression matrix, we really mean the distribution of the upper-diagonal coefficients. Given a set of gene ...
Cloning in Livestock Animal
... introduced into an unfertilized egg cell from which the nucleus has been removed. An electrical pulse is used to fuse the donor nucleus and the egg cell together and to activate the development of the “reconstructed embryo”. The embryo is cultured a few days in the laboratory and if it develops norm ...
... introduced into an unfertilized egg cell from which the nucleus has been removed. An electrical pulse is used to fuse the donor nucleus and the egg cell together and to activate the development of the “reconstructed embryo”. The embryo is cultured a few days in the laboratory and if it develops norm ...
Identification of Major Proteins in Maize Egg Cells
... triosephosphate isomerase, which also belongs to the enzymes of the glycolytic pathway. Calculated molecular mass and isoelectric point of cytosolic triosephosphate isomerase (accession number GI136063) are 27,292 and 5.52, respectively. These values fit the position of the gel where spot 5 was dete ...
... triosephosphate isomerase, which also belongs to the enzymes of the glycolytic pathway. Calculated molecular mass and isoelectric point of cytosolic triosephosphate isomerase (accession number GI136063) are 27,292 and 5.52, respectively. These values fit the position of the gel where spot 5 was dete ...
$doc.title
... Klinghoffer, et al. “Reduced seed region-based off-target activity with lentivirus-mediated RNAi (2010) RNA 16:879-884. ...
... Klinghoffer, et al. “Reduced seed region-based off-target activity with lentivirus-mediated RNAi (2010) RNA 16:879-884. ...
Preferential expression of one P-tubulin gene during
... The microbial eukaryote Physarum pofycephahm displays several distinct cell types in its life cycle, including amoebae, flagellates and plasmodia. Despite its relative simplicity, Physarum has a tubulin gene family of complexity comparable to that of Drosophifa. We have identified P-tubulin cDNAs fr ...
... The microbial eukaryote Physarum pofycephahm displays several distinct cell types in its life cycle, including amoebae, flagellates and plasmodia. Despite its relative simplicity, Physarum has a tubulin gene family of complexity comparable to that of Drosophifa. We have identified P-tubulin cDNAs fr ...
Gene Section NMT1 (N-myristoyltransferase 1) Atlas of Genetics and Cytogenetics
... of NMT1 may arise from an alternative splice variant or through initiation of translation at an internal methionine. ...
... of NMT1 may arise from an alternative splice variant or through initiation of translation at an internal methionine. ...
biochemical tests and their use for identification purposes
... Switch to the tab labeled "Features in Subsystems" and select the Carbohydrates category in the first column header. Select any of the subheadings, and the table will display the subsystem names as well as the roles and genes (features) that play a part in the process. Scroll through the table for t ...
... Switch to the tab labeled "Features in Subsystems" and select the Carbohydrates category in the first column header. Select any of the subheadings, and the table will display the subsystem names as well as the roles and genes (features) that play a part in the process. Scroll through the table for t ...
Human Pentraxin 3/TSG
... peripheral fibroblasts, endothelial cells, and macrophages (7). At the amino acid level, human and mouse TSG14 share 88% aa sequence homology (8). TSG14 concentration is elevated in the joint fluid of patients with rheumatoid arthritis (RA), indicating that TSG14 may be a potential mediator of i ...
... peripheral fibroblasts, endothelial cells, and macrophages (7). At the amino acid level, human and mouse TSG14 share 88% aa sequence homology (8). TSG14 concentration is elevated in the joint fluid of patients with rheumatoid arthritis (RA), indicating that TSG14 may be a potential mediator of i ...
Chapter 20 powerpoint - Bremen High School District 228
... Overview: The DNA Toolbox • Sequencing of the human genome was completed by 2007 • DNA sequencing has depended on advances in technology, starting with making recombinant DNA • In recombinant DNA, nucleotide sequences from two different sources, often two species, are combined in vitro into the sam ...
... Overview: The DNA Toolbox • Sequencing of the human genome was completed by 2007 • DNA sequencing has depended on advances in technology, starting with making recombinant DNA • In recombinant DNA, nucleotide sequences from two different sources, often two species, are combined in vitro into the sam ...
Chapter 20
... Overview: The DNA Toolbox • Sequencing of the human genome was completed by 2007 • DNA sequencing has depended on advances in technology, starting with making recombinant DNA ...
... Overview: The DNA Toolbox • Sequencing of the human genome was completed by 2007 • DNA sequencing has depended on advances in technology, starting with making recombinant DNA ...
Drosophila Forkhead Homologues Are Expressed in
... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...
... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...
Drosophila Forkhead Homologues Are Expressed in
... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...
... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...
Antigen Binding and Idiotype Analysis of Antibodies Obtained
... cells along with one of the three dominant L chain genes from PC-binding antibodies (Table 1, cell lines 1-3). As expected, the antibodies produced by all combinations of electroporated H and L chain genes expressed K, #~-allotype, and VHI-Id markers. The homologous T15 cell line, which resulted fro ...
... cells along with one of the three dominant L chain genes from PC-binding antibodies (Table 1, cell lines 1-3). As expected, the antibodies produced by all combinations of electroporated H and L chain genes expressed K, #~-allotype, and VHI-Id markers. The homologous T15 cell line, which resulted fro ...
QTL analysis of yield traits in an advanced backcross
... 413 bp ORF, starting with an initiating codon at 238 bp and ending with a stop codon at 1 650 bp (accession number FJ768729). The predicted protein product of AhKASⅠ comprises 470 amino acids with the calculated molecular mass of 49.958 9 kD and a pI of 8.46. Prediction of subcellular location sugge ...
... 413 bp ORF, starting with an initiating codon at 238 bp and ending with a stop codon at 1 650 bp (accession number FJ768729). The predicted protein product of AhKASⅠ comprises 470 amino acids with the calculated molecular mass of 49.958 9 kD and a pI of 8.46. Prediction of subcellular location sugge ...
Gene Section RBBP8 (retinoblastoma binding protein 8) Atlas of Genetics and Cytogenetics
... Domain structure of hCtIP. All known CtIP proteins contain a highly conserved CtBP-binding motif, two CXXC motifs and a phosphorylation site that corresponds to Ser327 in hCtIP. The Rb-binding motif is conserved only in mammalian CtIP. The N-terminal and C-terminal regions of all the CtIP homologs s ...
... Domain structure of hCtIP. All known CtIP proteins contain a highly conserved CtBP-binding motif, two CXXC motifs and a phosphorylation site that corresponds to Ser327 in hCtIP. The Rb-binding motif is conserved only in mammalian CtIP. The N-terminal and C-terminal regions of all the CtIP homologs s ...
D-loop - BioMed Central
... mechanism [8-10]. Review of both models of DNA replication with their supporting evidence has recently been published in a series of arguments [11-14]. It is interesting that in insects the replication origins of both strands (the leading strand is termed the minor and the lagging strand is termed t ...
... mechanism [8-10]. Review of both models of DNA replication with their supporting evidence has recently been published in a series of arguments [11-14]. It is interesting that in insects the replication origins of both strands (the leading strand is termed the minor and the lagging strand is termed t ...
List of Possible Bacteria
... and capsule." Further expand (click on the plus) the categories for Gram negative and positive cell wall components. Explore any of these subsystems. Because you are opening them from the subsystems tree rather than from a particular organism's subsystem summary, the spreadsheet will list all organi ...
... and capsule." Further expand (click on the plus) the categories for Gram negative and positive cell wall components. Explore any of these subsystems. Because you are opening them from the subsystems tree rather than from a particular organism's subsystem summary, the spreadsheet will list all organi ...
View Full Text-PDF
... transfer the Tn5 plasmid in another strain of E. coli DH5 and this transfer was confirmed by Kanamycin resistant and PCR analysis of E. coli DH5. The plasmid of strain S1 was eliminated through EtBr along with heat shock treatment and showed that there was no biodegradation activity for cyfluthrin. ...
... transfer the Tn5 plasmid in another strain of E. coli DH5 and this transfer was confirmed by Kanamycin resistant and PCR analysis of E. coli DH5. The plasmid of strain S1 was eliminated through EtBr along with heat shock treatment and showed that there was no biodegradation activity for cyfluthrin. ...
Replication Patterns of Specific Viruses
... Part of the reason for this error rate for RNA is that there is no truly double-stranded intermediate; therefore, there is no template for error correction or “proofreading” of the newly synthesized strand as there is in DNA replication. A second reason is that RNA polymerases using RNA templates se ...
... Part of the reason for this error rate for RNA is that there is no truly double-stranded intermediate; therefore, there is no template for error correction or “proofreading” of the newly synthesized strand as there is in DNA replication. A second reason is that RNA polymerases using RNA templates se ...
Document
... • enzymes in the eukaryotic nucleus modify pre-mRNA before exporting the mRNA to the cytoplasm – known as RNA processing ...
... • enzymes in the eukaryotic nucleus modify pre-mRNA before exporting the mRNA to the cytoplasm – known as RNA processing ...
v7a29-zhu pgmkr - Molecular Vision
... We have cloned and characterized Xenopus cry homologs with high sequence similarity to the mammalian crys. However, in contrast to the two cry genes found in both mouse and human, we identified three distinct clones from the Xenopus retinal cDNA library. One of the clones, xcry1, is most similar to ...
... We have cloned and characterized Xenopus cry homologs with high sequence similarity to the mammalian crys. However, in contrast to the two cry genes found in both mouse and human, we identified three distinct clones from the Xenopus retinal cDNA library. One of the clones, xcry1, is most similar to ...
34. Measuring Selection in RNA molecules.
... RiboNucleic Acid (RNA) is a polymer with a ribose sugar backbone. Each sugar has one of the four bases adenine (A), cytosine (C), guanine (G) and uracil (U) linked to it as a side group. Messenger RNA (mRNA) is one of the early discovered RNAs; it codes for protein. There is a wealth of other types ...
... RiboNucleic Acid (RNA) is a polymer with a ribose sugar backbone. Each sugar has one of the four bases adenine (A), cytosine (C), guanine (G) and uracil (U) linked to it as a side group. Messenger RNA (mRNA) is one of the early discovered RNAs; it codes for protein. There is a wealth of other types ...
Endogenous retrovirus
Endogenous retroviruses (ERVs) are endogenous viral elements in the genome that closely resemble and can be derived from retroviruses. They are abundant in the genomes of jawed vertebrates, and they comprise up to 5–8% of the human genome (lower estimates of ~1%). ERVs are a subclass of a type of gene called a transposon, which can be packaged and moved within the genome to serve a vital role in gene expression and in regulation. Researchers have suggested that retroviruses evolved from a type of transposable gene called a retrotransposon, which includes ERVs; these genes can mutate and instead of moving to another location in the genome they can become exogenous or pathogenic. This means that all ERVs may not have originated as an insertion by a retrovirus but that some may have been the source for the genetic information in the retroviruses they resemble.