Application No. DIR 108 SUMMARY INFORMATION
									
... (EPSPS) enzyme. EPSPS enzymes participate in a biosynthetic pathway found in both plants and microorganisms that is required for the synthesis of some essential amino acids. Most plant EPSPS enzymes are inhibited by glyphosate, which results in plant death due to the lack of essential amino acids. H ...
                        	... (EPSPS) enzyme. EPSPS enzymes participate in a biosynthetic pathway found in both plants and microorganisms that is required for the synthesis of some essential amino acids. Most plant EPSPS enzymes are inhibited by glyphosate, which results in plant death due to the lack of essential amino acids. H ...
									`Candidatus Phytoplasma mali`, `Candidatus Phytoplasma pyri` and
									
... Recent investigations, particularly sequence analysis of 16S rDNA, have revealed that phytoplasmas constitute a coherent, genus-level taxon. In the monophyletic phytoplasma clade, groups and subgroups have been delineated, many of which are being considered as putative species under the provisional ...
                        	... Recent investigations, particularly sequence analysis of 16S rDNA, have revealed that phytoplasmas constitute a coherent, genus-level taxon. In the monophyletic phytoplasma clade, groups and subgroups have been delineated, many of which are being considered as putative species under the provisional ...
									000927 - JHBS Revista Cientifica 3ª edicao
									
... treatment reduces this rate to 20-30%. This mortality rate is still higher than for endocarditis caused by another bacteria, which is typically 14% lethal4. L. monocytogenes endocarditis is clinically diagnosed by symptoms associated with bacteremia, and treatment of infections is usually accomplish ...
                        	... treatment reduces this rate to 20-30%. This mortality rate is still higher than for endocarditis caused by another bacteria, which is typically 14% lethal4. L. monocytogenes endocarditis is clinically diagnosed by symptoms associated with bacteremia, and treatment of infections is usually accomplish ...
									Deciphering the developmental program in the ascidian
									
... different ways during early development. It is possible to envisage that the expression patterns of some genes are determined via a two-step (rough and fine) mechanism. The segment-polarity or pair-rule genes, such as even-skipped, are expressed in a constant pattern of seven stripes in D. melanogas ...
                        	... different ways during early development. It is possible to envisage that the expression patterns of some genes are determined via a two-step (rough and fine) mechanism. The segment-polarity or pair-rule genes, such as even-skipped, are expressed in a constant pattern of seven stripes in D. melanogas ...
									Diploidy and the selective advantage for sexual reproduction in
									
... the population must be taken to be “small” in some sense. This is an ill-defined term, since it is not clear what the cutoff for a “small” population should be (generally this means that the population is sufficiently small that there are measurable deviations from infinite population behavior, due ...
                        	... the population must be taken to be “small” in some sense. This is an ill-defined term, since it is not clear what the cutoff for a “small” population should be (generally this means that the population is sufficiently small that there are measurable deviations from infinite population behavior, due ...
									Essential Bioinformatics and Biocomputing (LSM2104
									
... After the discovery of a new gene or protein related to a disease, these questions are usually asked: • What is its function and structure? – Is it similar in sequence to a known gene or protein? (sequence similarity search) – Does it contain sequence pattern similar to that of a group of known gene ...
                        	... After the discovery of a new gene or protein related to a disease, these questions are usually asked: • What is its function and structure? – Is it similar in sequence to a known gene or protein? (sequence similarity search) – Does it contain sequence pattern similar to that of a group of known gene ...
									Fulltext PDF - Indian Academy of Sciences
									
... translocations (Fedak and Han 2005; Li et al. 2008; Li and Wang 2009). But there had no reports about the reduced height gene introduced from Th. ponticum. We had developed an addition line 31504, with reduced plant height than its wheat parent, from the cross between wheat cultivar Lumai 5 and whea ...
                        	... translocations (Fedak and Han 2005; Li et al. 2008; Li and Wang 2009). But there had no reports about the reduced height gene introduced from Th. ponticum. We had developed an addition line 31504, with reduced plant height than its wheat parent, from the cross between wheat cultivar Lumai 5 and whea ...
									bacterial plasmids - Acta Medica Medianae
									
... acid. If we accept the proposed virus definition which says that microorganism is a single unit with continuous parentage and individual evolution history, than plasmids could be considered as live organism in spite of their simple structure (1). Plasmids, extrachromosomal DNA were at first identifi ...
                        	... acid. If we accept the proposed virus definition which says that microorganism is a single unit with continuous parentage and individual evolution history, than plasmids could be considered as live organism in spite of their simple structure (1). Plasmids, extrachromosomal DNA were at first identifi ...
									Online resources for genetic variation study-Part One
									
... results from published studies.  Each OMIM record provides a summary of the current state of knowledge of the genetic basis of a disorder, which contains the following information:  description and clinical features of a disorder or a gene involved in genetic disorders;  biochemical and other fea ...
                        	... results from published studies.  Each OMIM record provides a summary of the current state of knowledge of the genetic basis of a disorder, which contains the following information:  description and clinical features of a disorder or a gene involved in genetic disorders;  biochemical and other fea ...
									Identification of novel endogenous antisense transcripts by DNA
									
... by microarray analysis using AFAS probes are transcribed in vivo. We also analyzed the expression of Aard (alanine- and arginine-rich domain-containing protein), which is a functionally uncharacterized gene but is known to be expressed within the adult testis and XY fetal gonad [35]. In humans, exon ...
                        	... by microarray analysis using AFAS probes are transcribed in vivo. We also analyzed the expression of Aard (alanine- and arginine-rich domain-containing protein), which is a functionally uncharacterized gene but is known to be expressed within the adult testis and XY fetal gonad [35]. In humans, exon ...
									CS790 – Introduction to Bioinformatics
									
...  Indels are difficult, must align sequences: ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT Intro to Bioinformatics – Sequence Alignment ...
                        	...  Indels are difficult, must align sequences: ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT Intro to Bioinformatics – Sequence Alignment ...
									Microsoft Word (Chapter 3) - DORAS
									
... was due to the production and utilisation of the endogenous siderophore rhizobactin 1021. The indicator strain S. meliloti 2011rhbA62 produced the clearest halos because background was eliminated by the mutation in the rhizobactin 1021 biosynthesis operon. The results for S. meliloti 2011rhbA62 conf ...
                        	... was due to the production and utilisation of the endogenous siderophore rhizobactin 1021. The indicator strain S. meliloti 2011rhbA62 produced the clearest halos because background was eliminated by the mutation in the rhizobactin 1021 biosynthesis operon. The results for S. meliloti 2011rhbA62 conf ...
									pdf
									
... Here we report the first combined phylogeny of magical and ordinary organisms using an eight gene set (Figure 1). All magical creatures sampled appear with Animalia, specifically Vertebrata and Arthropoda. This isn’t to say that all magical creatures are necessarily animals, just the ones sampled in ...
                        	... Here we report the first combined phylogeny of magical and ordinary organisms using an eight gene set (Figure 1). All magical creatures sampled appear with Animalia, specifically Vertebrata and Arthropoda. This isn’t to say that all magical creatures are necessarily animals, just the ones sampled in ...
									Identification and isolation of active N2O reducers in rice paddy soil
									
... Evaluation of the soil microcosm. Based on the preliminary experiments, all of the added N2O disappeared within 24 h of incubation when <2% N2O was added (data not shown). Since N2O should always be present to minimize utilization of succinate by metal reducers, the concentration of N2O should be >2 ...
                        	... Evaluation of the soil microcosm. Based on the preliminary experiments, all of the added N2O disappeared within 24 h of incubation when <2% N2O was added (data not shown). Since N2O should always be present to minimize utilization of succinate by metal reducers, the concentration of N2O should be >2 ...
									The Parasexual Cycle in Candida albicans Provides an
									
... The parasexual cycle of C. albicans, as currently envisaged, is shown in Figure 1A. Note that no meiotic program has been observed in C. albicans, despite the presence of many genes in the genome whose homologues function specifically in meiosis in other fungi [18]. However, C. albicans strains have ...
                        	... The parasexual cycle of C. albicans, as currently envisaged, is shown in Figure 1A. Note that no meiotic program has been observed in C. albicans, despite the presence of many genes in the genome whose homologues function specifically in meiosis in other fungi [18]. However, C. albicans strains have ...
									Forche et al. 2008 PLoS Biology
									
... The parasexual cycle of C. albicans, as currently envisaged, is shown in Figure 1A. Note that no meiotic program has been observed in C. albicans, despite the presence of many genes in the genome whose homologues function specifically in meiosis in other fungi [18]. However, C. albicans strains have ...
                        	... The parasexual cycle of C. albicans, as currently envisaged, is shown in Figure 1A. Note that no meiotic program has been observed in C. albicans, despite the presence of many genes in the genome whose homologues function specifically in meiosis in other fungi [18]. However, C. albicans strains have ...
									CS790 – Introduction to Bioinformatics
									
...  Indels are difficult, must align sequences: ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT Intro to Bioinformatics – Sequence Alignment ...
                        	...  Indels are difficult, must align sequences: ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT Intro to Bioinformatics – Sequence Alignment ...
									Molecular Evolution, Functional Variation, and Proposed
									
... The composition of venom varies widely across species but includes cytotoxins, neurotoxins with specific neurophysiological targets, and antimicrobial components (reviews in Schulz 1997; Rash and Hodgson 2002; Kuhn-Nentwig 2003; Adams 2004; Tedford et al. 2004; Escoubas 2006; Estrada et al. 2007; Ki ...
                        	... The composition of venom varies widely across species but includes cytotoxins, neurotoxins with specific neurophysiological targets, and antimicrobial components (reviews in Schulz 1997; Rash and Hodgson 2002; Kuhn-Nentwig 2003; Adams 2004; Tedford et al. 2004; Escoubas 2006; Estrada et al. 2007; Ki ...