• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Provisional PDF
Provisional PDF

... in the respective species. The taxonomic abundance in each specimen was calculated at the domain, kingdom, phylum, class, order, family, and genus levels. Thus, the abundance profiles at the corresponding taxonomic levels were built. Differences in the abundance profile at each level between two gro ...
LAB 1: Scientific Method/Tools of Scientific Inquiry
LAB 1: Scientific Method/Tools of Scientific Inquiry

... DNA we want to make sure you understand DNA structure , how DNA is copied in cells, and how specific genes are expressed into “gene products”, which for most genes is a specific protein. While it would be good to learn about all these aspects of DNA before learning how to purify and analyze it in th ...
The importance of alternative splicing in the drug discovery process
The importance of alternative splicing in the drug discovery process

... This approach was also employed to alter the alternative was not knocked out [29]. Thus, when trying to shut down splicing of the Tau gene that causes frontotemporal dethe activity of a gene, the knockout cassette should be inmentia and parkinsonism linked to chromosome 17 [26]. serted into an exon ...
Do  the  Time-Warp:  Continuous  Alignment ... Expression  Time-Series  Data Georg  Kurt  Gerber UC
Do the Time-Warp: Continuous Alignment ... Expression Time-Series Data Georg Kurt Gerber UC

... a gene at random from the data set and then removing one, two, and three consecutive time-points. Values for these time-points were then estimated using all remaining data and this process was repeated 100 times. A mean error was then computed for each case of one, two, or three consecutive missing ...
PDF - WashU Epigenome Browser
PDF - WashU Epigenome Browser

... A numerical track displays a series of quantitative values along the genome as a highly customizable graph. When the track height is small, the track is shown as a heatmap, otherwise it is shown as a bar plot. ...
CSE 181 Project guidelines
CSE 181 Project guidelines

... • Some forms of RNA can form secondary structures by “pairing up” with itself. This can have change its properties • Several types exist, classified by function • mRNA – this is what is usually being referred to when a Bioinformatician says “RNA”. This is used to carry a gene’s message out of the nu ...
Giant viruses, giant chimeras: The multiple evolutionary histories of
Giant viruses, giant chimeras: The multiple evolutionary histories of

... tree of life [7,10]. Moreover, there is compelling evidence for the polyphyletic origin of viruses, which further complicates the issue [11]. These debates have recently gained an unprecedented impetus when Raoult and co-workers published the description of the genome of Mimivirus, a giant virus fir ...
Determining the cause of patchwork HBA1 and HBA2 genes
Determining the cause of patchwork HBA1 and HBA2 genes

... allele, while those members who were heterozygous for the α212 allele alone (but not the -α3.7 allele) had MCV values greater than 80 fL. These observations suggest that the α212 allele is unlikely to be associated with microcytosis. Systematic screening for these patchwork alleles in a larger cohor ...
Biofilms
Biofilms

... their isolated existence. This image of bacterial existence, it turns out, is not only oversimplified but perhaps misleading as well. In nature, the majority of microorganisms live together in large numbers, attached to a surface. Rather than living as lonely hermits in tbe socalled planktonic form, ...
CS790 – Introduction to Bioinformatics
CS790 – Introduction to Bioinformatics

...  Indels are difficult, must align sequences: ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT Intro to Bioinformatics – Sequence Alignment ...
A-2015A: Amplified Fragment Length
A-2015A: Amplified Fragment Length

... 0.625 µM of each primer was the optimum concentration (Figure 2). Varying the amount of MseI primer appeared to have no effect on fragment numbers, size, or distribution (Figure 3). When the D4 (Beckman Coulter, Inc.) dye-labeled EcoRI primer was held at a constant concentration and the unlabeled Ms ...
Identification of alternative spliced mRNA variants related to(1).
Identification of alternative spliced mRNA variants related to(1).

...  This implies that new splicing variants might be generated during carcinogenesis  This result supports the observation that during carcinogenesis not only is the expression profile affected but the splicing Patten BIOINFORMATICS ...
3- PARTE I Comparative cytogenetic mapping of Sox2 and
3- PARTE I Comparative cytogenetic mapping of Sox2 and

... clearly observed among mammals but not much clear for fishes maybe because the (i) limited amount of genomic data available or (ii) the intense dynamism that rules the genome evolution in teleost fishes. The size of the syntenic blocks looks smaller in fishes, maybe because the low level of sequence ...
Estonian HumanGenesResearchAct.
Estonian HumanGenesResearchAct.

... a Gene Bank, to organise the genetic research necessary therefor, to ensure the voluntary nature of gene donation and the confidentiality of the identity of gene donors, and to protect persons from misuse of genetic data and from discrimination based on interpretation of the structure of their DNA a ...
AtMetExpress Development: A Phytochemical
AtMetExpress Development: A Phytochemical

... (AtMetExpress development) demonstrated that Arabidopsis has the capability of producing diverse metabolites with high tissue specificity. The AtMetExpress development dataset also makes it possible to understand the mechanism behind the variations in metabolic profiles among plant tissues by invest ...
Genetic Markers for Sex Identification in Forensic DNA Analysis
Genetic Markers for Sex Identification in Forensic DNA Analysis

... The amelogenin (AMEL) locus encodes a matrix protein forming tooth enamel. Mutations in the AMEL locus can lead to the enamel defect known as amelogenesis imperfecta, which results in the abnormal formation of tooth enamel [3]. The AMEL locus has two homologous genes: AMELX, which is located on the ...
Solid Tumour Section Mesothelioma: t(14;22)(q32;q12) in mesothelioma Atlas of Genetics and Cytogenetics
Solid Tumour Section Mesothelioma: t(14;22)(q32;q12) in mesothelioma Atlas of Genetics and Cytogenetics

... analysis have been reported in 128 mesotheliomas (Mitelman database). The changes are mostly complex, but a number of nonrandom abnormalities have been found involving chromosome arms 1p, 3p, 6q, 9p, and 22q. Studies using comparative genomic hybridization, loss of heterozygosity, and fluorescence i ...
Antimicrobial resistance: Mechanisms of action of antimicrobial agents
Antimicrobial resistance: Mechanisms of action of antimicrobial agents

... proteins, such as adhesins [9]. On the basis of the number of antimicrobial drugs in clinical use, bacterial cell wall synthesis has been perhaps the target area most extensively exploited for antimicrobial development. The components of the cell wall synthesis machinery are appealing antimicrobial ...
Package `rDNA`
Package `rDNA`

... If the attenuation algorithm is used, lambda provides the decay constant for the exponential decay function. The default value of 0.1 attributes relatively high weight to statements which are made within approximately five to ten days. ignore.agreement This argument is only used if algorithm="attenu ...
Bacterial Symbioses and the Innate Immune Response of the Model
Bacterial Symbioses and the Innate Immune Response of the Model

... Bacterial Symbioses and the Innate Immune Response of the Model Host: Euprymna scolopes Andrew Collins University of Connecticut, 2014 All animals enter into beneficial relationships with bacteria. The light organ of the Hawaiian Bobtail squid, Euprymna scolopes, is a unique model for studying the ...
Principal Components Analysis
Principal Components Analysis

... factors. So with three factors, covariance is measured between factor x and y; y and z, and x and z. When more than 2 factors are involved, covariance values can be placed into a matrix. This is where PCA becomes useful. PCA will find Eigenvectors and eigenvalues relevant to the data using a covaria ...
The Topology of the Possible
The Topology of the Possible

... conditions under which a phenotypic innovation can, once generated, invade an existing population. The classical fields of inquiry concerned with selection are population genetics and ecology. The main variables are frequencies of genes or species representatives whose change is typically described ...
Reveal—visual eQTL analytics
Reveal—visual eQTL analytics

... if a conservative threshold is chosen. A popular stand-alone tool is WGAViewer (Ge et al., 2008) which offers an interactive Manhattan plot embedded into an annotation environment in order to help identify those associations with large biological relevance. Genevar (Yang et al., 2010) combines a dat ...
E M C
E M C

... Microbial mats are prokaryotic communities that are thought to represent the present-day analogues of the first ecosystems on Earth. Their study reveals microbial strategies for survival under a broad range of environments. Here, we report the combination of different methods such as lipid analysis, ...
Evaluation of genomic DNA from paraffin
Evaluation of genomic DNA from paraffin

... Dogs that are clinically diagnosed with DCM reveal two distinct histological forms of DCM. Cardiomyopathy of Boxers and Doberman Pinschers are called “fatty infiltration-degenerative” type and in many giant, large- and medium-sized breeds DCM can be classified as “attenuated wavy fiber” type. Attenu ...
< 1 ... 36 37 38 39 40 41 42 43 44 ... 359 >

Metagenomics



Metagenomics is the study of genetic material recovered directly from environmental samples. The broad field may also be referred to as environmental genomics, ecogenomics or community genomics. While traditional microbiology and microbial genome sequencing and genomics rely upon cultivated clonal cultures, early environmental gene sequencing cloned specific genes (often the 16S rRNA gene) to produce a profile of diversity in a natural sample. Such work revealed that the vast majority of microbial biodiversity had been missed by cultivation-based methods. Recent studies use either ""shotgun"" or PCR directed sequencing to get largely unbiased samples of all genes from all the members of the sampled communities. Because of its ability to reveal the previously hidden diversity of microscopic life, metagenomics offers a powerful lens for viewing the microbial world that has the potential to revolutionize understanding of the entire living world. As the price of DNA sequencing continues to fall, metagenomics now allows microbial ecology to be investigated at a much greater scale and detail than before.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report